Search Results

Search found 5765 results on 231 pages for 'pre compilation'.

Page 44/231 | < Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >

• SVN Error 403 Forbidden

  - by Chris

  I can't figure this out. I try to import a new project into a svn repository from Netbeans and get 403 Forbidden. I just setup svn on my serverbox today. I can get to it through a browser just fine, though its empty as I haven't imported my project yet. Apache's path for html files is /var/www I setup the svn repo in /var/svn This is the structure of /var/svn [root@localhost svn]# ls -lR /var/svn /var/svn: total 4 drwxrwxrwx 7 apache apache 4096 2010-03-26 10:18 repo /var/svn/repo: total 36 drwxrwxrwx 2 apache apache 4096 2010-03-26 09:47 conf drwxrwxrwx 3 apache apache 4096 2010-03-26 10:18 dav drwxrwsrwx 6 apache apache 4096 2010-03-26 11:19 db -rwxrwxrwx 1 apache apache 2 2010-03-26 09:47 format drwxrwxrwx 2 apache apache 4096 2010-03-26 09:47 hooks drwxrwxrwx 2 apache apache 4096 2010-03-26 09:47 locks -rwxrwxrwx 1 apache apache 229 2010-03-26 09:47 README.txt -rwxrwxrwx 1 apache apache 15 2010-03-26 09:47 svnauth -rwxrwxrwx 1 apache apache 43 2010-03-26 09:48 svnpass /var/svn/repo/conf: total 12 -rwxrwxrwx 1 apache apache 1080 2010-03-26 09:47 authz -rwxrwxrwx 1 apache apache 309 2010-03-26 09:47 passwd -rwxrwxrwx 1 apache apache 2279 2010-03-26 09:47 svnserve.conf /var/svn/repo/dav: total 4 drwxrwxrwx 2 apache apache 4096 2010-03-26 11:19 activities.d /var/svn/repo/dav/activities.d: total 0 /var/svn/repo/db: total 48 -rwxrwxrwx 1 apache apache 2 2010-03-26 09:47 current -rwxrwxrwx 1 apache apache 22 2010-03-26 09:47 format -rwxrwxrwx 1 apache apache 1920 2010-03-26 09:47 fsfs.conf -rwxrwxrwx 1 apache apache 5 2010-03-26 09:47 fs-type -rwxrwxrwx 1 apache apache 2 2010-03-26 09:47 min-unpacked-rev -rwxrwxrwx 1 apache apache 4096 2010-03-26 09:47 rep-cache.db drwxrwsrwx 3 apache apache 4096 2010-03-26 09:47 revprops drwxrwsrwx 3 apache apache 4096 2010-03-26 09:47 revs drwxrwsrwx 2 apache apache 4096 2010-03-26 11:19 transactions -rwxrwxrwx 1 apache apache 2 2010-03-26 11:19 txn-current -rwxrwxrwx 1 apache apache 0 2010-03-26 09:47 txn-current-lock drwxrwsrwx 2 apache apache 4096 2010-03-26 11:19 txn-protorevs -rwxrwxrwx 1 apache apache 37 2010-03-26 09:47 uuid -rwxrwxrwx 1 apache apache 0 2010-03-26 09:47 write-lock /var/svn/repo/db/revprops: total 4 drwxrwsrwx 2 apache apache 4096 2010-03-26 09:47 0 /var/svn/repo/db/revprops/0: total 4 -rwxrwxrwx 1 apache apache 50 2010-03-26 09:47 0 /var/svn/repo/db/revs: total 4 drwxrwsrwx 2 apache apache 4096 2010-03-26 09:47 0 /var/svn/repo/db/revs/0: total 4 -rwxrwxrwx 1 apache apache 115 2010-03-26 09:47 0 /var/svn/repo/db/transactions: total 0 /var/svn/repo/db/txn-protorevs: total 0 /var/svn/repo/hooks: total 36 -rwxrwxrwx 1 apache apache 1955 2010-03-26 09:47 post-commit.tmpl -rwxrwxrwx 1 apache apache 1638 2010-03-26 09:47 post-lock.tmpl -rwxrwxrwx 1 apache apache 2267 2010-03-26 09:47 post-revprop-change.tmpl -rwxrwxrwx 1 apache apache 1567 2010-03-26 09:47 post-unlock.tmpl -rwxrwxrwx 1 apache apache 3404 2010-03-26 09:47 pre-commit.tmpl -rwxrwxrwx 1 apache apache 2410 2010-03-26 09:47 pre-lock.tmpl -rwxrwxrwx 1 apache apache 2764 2010-03-26 09:47 pre-revprop-change.tmpl -rwxrwxrwx 1 apache apache 2100 2010-03-26 09:47 pre-unlock.tmpl -rwxrwxrwx 1 apache apache 2758 2010-03-26 09:47 start-commit.tmpl /var/svn/repo/locks: total 8 -rwxrwxrwx 1 apache apache 139 2010-03-26 09:47 db.lock -rwxrwxrwx 1 apache apache 139 2010-03-26 09:47 db-logs.lock I've got httpd.conf loading svn.conf which contains: <Location /svn> DAV on DAV svn #SVNParentPath /var/svn SVNPath /var/svn/repo Authtype Basic AuthName "Subversion" AuthUserFile /var/svn/repo/svnpass Require valid-user AuthzSVNAccessFile /var/svn/repo/svnauth </Location> Full error message is: org.tigris.subversion.javahl.ClientException: RA layer request failed Server sent unexpected return value (403 Forbidden) in response to CHECKOUT request for '/svn/!svn/bln/0' Sorry for the incredibly long post, but I thought more info would be better than less. I've been fidgeting with this problem for a long time now.

  Read the article

• Paypal NVP API - Keep getting error 81002

  - by Andree

  Hi there, I am new to PayPal API, and I'm having trouble calling SetExpressCheckout using CURL in PHP. I have set everything correctly, as far as I'm concerned, but I kept getting an 81002 error "Method Specified is not Supported". The code snippet is below. I got the CA Root certificates file from here. <?php $paypal_data = array( 'USER' => urlencode('andree_1272823561_biz_api1.gmail.com'), 'PWD' => urlencode('1272823576'), 'SIGNATURE' => urlencode('Am1t0wiu2tv7VwZ5ebdeY9zv1GF6Ad0PFz-qTGFFf7vbWU6ee4bxy8KL'), 'VERSION' => urlencode('52.0'), 'PAYMENTACTION' => urlencode('Sale'), 'METHOD' => urlencode('SetExpressCheckout'), 'AMT' => urlencode('52.00'), 'RETURNURL' => urlencode('get_express_checkout_details.php'), 'CANCELURL' => urlencode('index.php') ); $url = 'https://api-3t.sandbox.paypal.com/nvp?' . http_build_query($paypal_data); $curl = curl_init(); curl_setopt($curl, CURLOPT_URL, $url); curl_setopt($curl, CURLOPT_RETURNTRANSFER, 1); curl_setopt($curl, CURLOPT_CAINFO, dirname(__FILE__) . '/cacert.pem'); $result = curl_exec($curl); curl_close($curl); parse_str($result, $result); ?> <pre>Data sent: <?php print_r($paypal_data); ?></pre> <pre>Result: <?php print_r($result); ?></pre> When I run the code, the output is the following: Data sent: Array ( [USER] => andree_1272823561_biz_api1.gmail.com [PWD] => 1272823576 [SIGNATURE] => Am1t0wiu2tv7VwZ5ebdeY9zv1GF6Ad0PFz-qTGFFf7vbWU6ee4bxy8KL [VERSION] => 52.0 [PAYMENTACTION] => Sale [METHOD] => SetExpressCheckout [AMT] => 52.00 [RETURNURL] => get_express_checkout_details.php [CANCELURL] => index.php ) Result: Array ( [ACK] => Failure [L_ERRORCODE0] => 81002 [L_SHORTMESSAGE0] => Unspecified Method [L_LONGMESSAGE0] => Method Specified is not Supported [L_SEVERITYCODE0] => Error ) Anyone knows what could be the problem? Regards, Andree.

  Read the article

• Installing Rails 3 - /usr/local/bin/rails: No such file or directory

  - by viatropos

  I just ran these two commands: sudo gem install rails --pre sudo gem install railties --pre Now when I run rails myapp, I get this: -bash: /usr/local/bin/rails: No such file or directory Here's some system info: $ ruby -v ruby 1.8.7 (2009-06-12 patchlevel 174) [i686-darwin9.7.0] $ sudo gem update --system Updating RubyGems Nothing to update I tried copy/pasting the bin/rails file into /usr/local/bin/rails, and changing permissions to sudo chmod 755 /usr/local/bin/rails, but that doesn't work. Any ideas how to get up and running?

  Read the article

• aspNetCompatibility WCF and WinForm

  - by user190084

  I would like to use Windows Forms with a WCF service and leverage the pre-built authentication of asp.net by using aspNetCompatibilityEnabled = true in the WCF service. Is there any module or pre-built assemblies that can add ASP.NET functionality to a Windows Forms application? As far as I understand, this functionality isn't built into Windows Forms and can't be leveraged.

  Read the article

• Regex in Python

  - by newToProgramming

  SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

  Read the article

• how to generate PMK?

  - by sebby_zml

  Hi everyone, I would like to know how can I generate a random pre-master key PMK in java? (related in key exchange and authentication) Is it similar with other randam key generating? What particularly is a pre master key? Thanks, Sebby.

  Read the article

• problems with chili source code highlighter (mysql)

  - by jason

  I am using Chili source code highlighter it works fine with php source using php as the class. But when i change it to mysql it doesnt highlight any SQL code i also tried sql as the classname, i double checked the recipes' and there is a mysql recipes in there. ... What could i be doing wrong? <pre><code id="code" class="php"></code></pre>

  Read the article

• iPhone HTTP Live Streaming not working on models below 3GS

  - by dreamer

  We are using http live streaming for on demand video from within our iPhone app and on the 3GS models the videos play as they are meant to. However, on the models pre 3GS it gives an error saying this movie format is not supported. I have seen other threads on this however no solutions or insights. Does anyone know if this really is a hardware limitation of the pre 3GS phones or does it have something to do with our code?

  Read the article

• shell_exec() Doesn't Show The Output

  - by Nathan Campos

  I'm doing a PHP site that uses a shell_exec() function like this: $file = "upload/" . $_FILES["file"]["name"]; $output = shell_exec("leaf $file"); echo "<pre>$output</pre>"; Where leaf is a program that is located in the same directory of my script, but when I tried to run this script on the server, I just got nothing. What is wrong?

  Read the article

• Visual C++ preprocessor definitions

  - by alemjerus

  Is there a way to transfer C++ preprocessor definitions into a custom pre-link step procedure call as a command-line parameter or export them into a file any other way? Example: Let's say, I have a c++ project, and in it's Debug configuration I put a preprocessor definition like MAKUMBA_OBA=0x13 Then I add custom pre-link step which executes some javascript like sarahjessicaparker.js /to tomsrhinoplasty $(MAKUMBA_OBA) It would be great, if it just worked, but I never get a third parameter in my js. So the question is: how to pass a preprocessor definition to s script?

  Read the article

• Difference in DocumentBuilder.parse when using JRE 1.5 and JDK 1.6

  - by dhiller

  Recently at last we have switched our projects to Java 1.6. When executing the tests I found out that using 1.6 a SAXParseException is not thrown which has been thrown using 1.5. Below is my test code to demonstrate the problem. import java.io.StringReader; import javax.xml.parsers.DocumentBuilder; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.stream.StreamSource; import javax.xml.validation.SchemaFactory; import org.junit.Test; import org.xml.sax.InputSource; import org.xml.sax.SAXParseException; /** * Test class to demonstrate the difference between JDK 1.5 to JDK 1.6. * * Seen on Linux: * * <pre> * #java version "1.6.0_18" * Java(TM) SE Runtime Environment (build 1.6.0_18-b07) * Java HotSpot(TM) Server VM (build 16.0-b13, mixed mode) * </pre> * * Seen on OSX: * * <pre> * java version "1.6.0_17" * Java(TM) SE Runtime Environment (build 1.6.0_17-b04-248-10M3025) * Java HotSpot(TM) 64-Bit Server VM (build 14.3-b01-101, mixed mode) * </pre> * * @author dhiller (creator) * @author $Author$ (last editor) * @version $Revision$ * @since 12.03.2010 11:32:31 */ public class TestXMLValidation { /** * Tests the schema validation of an XML against a simple schema. * * @throws Exception * Falls ein Fehler auftritt * @throws junit.framework.AssertionFailedError * Falls eine Unit-Test-Pruefung fehlschlaegt */ @Test(expected = SAXParseException.class) public void testValidate() throws Exception { final StreamSource schema = new StreamSource( new StringReader( "<?xml version=\"1.0\" encoding=\"UTF-8\"?>" + "<xs:schema xmlns:xs=\"http://www.w3.org/2001/XMLSchema\" " + "elementFormDefault=\"qualified\" xmlns:xsd=\"undefined\">" + "<xs:element name=\"Test\"/>" + "</xs:schema>" ) ); final String xml = "<Test42/>"; final DocumentBuilderFactory newFactory = DocumentBuilderFactory.newInstance(); newFactory.setSchema( SchemaFactory.newInstance( "http://www.w3.org/2001/XMLSchema" ).newSchema( schema ) ); final DocumentBuilder documentBuilder = newFactory.newDocumentBuilder(); documentBuilder.parse( new InputSource( new StringReader( xml ) ) ); } } When using a JVM 1.5 the test passes, on 1.6 it fails with "Expected exception SAXParseException". The Javadoc of the DocumentBuilderFactory.setSchema(Schema) Method says: When errors are found by the validator, the parser is responsible to report them to the user-specified ErrorHandler (or if the error handler is not set, ignore them or throw them), just like any other errors found by the parser itself. In other words, if the user-specified ErrorHandler is set, it must receive those errors, and if not, they must be treated according to the implementation specific default error handling rules. The Javadoc of the DocumentBuilder.parse(InputSource) method says: BTW: I tried setting an error handler via setErrorHandler, but there still is no exception. Now my question: What has changed to 1.6 that prevents the schema validation to throw a SAXParseException? Is it related to the schema or to the xml that I tried to parse?

  Read the article

• Algorithm to suggest a list of tags to users

  - by Itay Moav

  Given a free text, I need to analyse this this text and suggest a list of tags from a pre existing list. What algorithms are out there in the market? Can they handle a case where, for example, the text have a word like high cholesterol and I would like it so suggest heart disease although "high cholesterol" might not exists (initially) in the pre defined list.

  Read the article

• Is an editable select box the right way?

  - by Neil Middleton

  I have a scenario where a user is emailing another user in an HTML based web app. For the To: field, the user may select one of a pre-defined list of emails OR enter their own ignoring the pre-defined options. What would be the best way of doing this from a UI point of view? I've looked at editable select boxes using jQuery but none seem to let you enter your own option. Is there some other UI mechanism that would work here?

  Read the article

• jQuery datepicker calendar - call to function updates database

  - by erbaker

  So I'm using the datepicker plugin to make an availability calendar. Here is my javascript: http://pastebin.com/H7D9PcAg When dpSetSelected() is called it is also calling dateSelected() which triggers the AJAX call to my PHP script. I need a way to only update the database if the date is clicked on and not pre-loaded. When I pre-load the dates they are sent to the PHP page and subsequently removed.

  Read the article

• How to avoid my this facebook app api login page?

  - by user1035140

  I got a problem regrading with my apps which is once I go to my apps, it sure will show me a login page instead of allow page? it always display the login page 1st then only display allow page, I had tried other apps, if I am 1st time user, It sure will appear the allow page only, it did not show me the login page. my question is how to I avoid my login page direct go to allow page? here is my login page picture here is my apps link https://apps.facebook.com/christmas_testing/ here is my facebook php jdk api coding <?php $fbconfig['appid' ] = "XXXXXXXXXXXXX"; $fbconfig['secret'] = "XXXXXXXXXXXXX"; $fbconfig['baseUrl'] = "myserverlink"; $fbconfig['appBaseUrl'] = "http://apps.facebook.com/christmas_testing/"; if (isset($_GET['code'])){ header("Location: " . $fbconfig['appBaseUrl']); exit; } if (isset($_GET['request_ids'])){ //user comes from invitation //track them if you need header("Location: " . $fbconfig['appBaseUrl']); } $user = null; //facebook user uid try{ include_once "facebook.php"; } catch(Exception $o){ echo '<pre>'; print_r($o); echo '</pre>'; } // Create our Application instance. $facebook = new Facebook(array( 'appId' => $fbconfig['appid'], 'secret' => $fbconfig['secret'], 'cookie' => true, )); //Facebook Authentication part $user = $facebook->getUser(); $loginUrl = $facebook->getLoginUrl( array( 'scope' => 'email,publish_stream,user_birthday,user_location,user_work_history,user_about_me,user_hometown' ) ); if ($user) { try { // Proceed knowing you have a logged in user who's authenticated. $user_profile = $facebook->api('/me'); } catch (FacebookApiException $e) { //you should use error_log($e); instead of printing the info on browser d($e); // d is a debug function defined at the end of this file $user = null; } } if (!$user) { echo "<script type='text/javascript'>top.location.href = '$loginUrl';</script>"; exit; } //get user basic description $userInfo = $facebook->api("/$user"); function d($d){ echo '<pre>'; print_r($d); echo '</pre>'; } ?

  Read the article

• selenium, get text from id

  - by user3766148

  on the following url - http://www.filestube.to/26frq-Buffalo-Clover-Test-Your-Love-2014-9Jai9TJFukAS9fq9sWngAD.html I am trying to copy the; Direct links: turbobit.net/9mrb0eu9eksx/26frq.Buffalo.Clover..Test.Your.Love.2014.rar.html via css path or xpath and unable to retrieve the information and store it to a variable. firebug gives me html body div.cnt div.rH.no-js.fd div.rl div.fgBx pre span#copy_paste_links but when I apply css=html.body.div.cnt.div.rH.no-js.fd.div.rl.div.fgBx.pre.span#copy_paste_links/text() to the target, I get error not found http://i.imgur.com/KdBmDHE.png

  Read the article

• Code example with annotation in JavaDoc

  - by John

  Hello, my JavaDoc doesn't work when I have a code example with an annotation. Any suggestions? /** * <pre> * public class Demo { * @DemoAnnotation * public void demoMethod() { * } * } * </pre> */ @Retention(RetentionPolicy.RUNTIME) @Target({ElementType.METHOD}) public @interface DemoAnnotation {

  Read the article

• What's the fastest lookup algorithm for a key, pair data structure (i.e, a map)?

  - by truncheon

  In the following example a std::map structure is filled with 26 values from A - Z (for key) and 0 – 26 for value. The time taken (on my system) to lookup the last entry (10000000 times) is roughly 250 ms for the vector, and 125 ms for the map. (I compiled using release mode, with O3 option turned on for g++ 4.4) But if for some odd reason I wanted better performance than the std::map, what data structures and functions would I need to consider using? I apologize if the answer seems obvious to you, but I haven't had much experience in the performance critical aspects of C++ programming. #include <ctime> #include <map> #include <vector> #include <iostream> struct mystruct { char key; int value; mystruct(char k = 0, int v = 0) : key(k), value(v) { } }; int find(const std::vector<mystruct>& ref, char key) { for (std::vector<mystruct>::const_iterator i = ref.begin(); i != ref.end(); ++i) if (i->key == key) return i->value; return -1; } int main() { std::map<char, int> mymap; std::vector<mystruct> myvec; for (int i = 'a'; i < 'a' + 26; ++i) { mymap[i] = i - 'a'; myvec.push_back(mystruct(i, i - 'a')); } int pre = clock(); for (int i = 0; i < 10000000; ++i) { find(myvec, 'z'); } std::cout << "linear scan: milli " << clock() - pre << "\n"; pre = clock(); for (int i = 0; i < 10000000; ++i) { mymap['z']; } std::cout << "map scan: milli " << clock() - pre << "\n"; return 0; }

  Read the article

• Google App Engine + AWS S3 file protection!

  - by grep

  Hi all, I have an application running on GAE/J that streams video from AWS S3. I need a solution for protecting the video from being stolen and I found that pre-signed URLs might be it (??). How can I create pre-signed URLs from GAE/J or there's a better solution to secure the videos? thanks

  Read the article

• How can I forward ALL traffic over a site-to-site VPN on Cisco ASA?

  - by Scott Clements

  Hi There, I currently have two Cisco ASA 5100 routers. They are at different physical sites and are configured with a site-to-site VPN which is active and working. I can communicate with the subnets on either site from the other and both are connected to the internet, however I need to ensure that all the traffic at my remote site goes through this VPN to my site here. I know that the web traffic is doing so as a "tracert" confirms this, but I need to ensure that all other network traffic is being directed over this VPN to my network here. Here is my config for the ASA router at my remote site: hostname ciscoasa domain-name xxxxx enable password 78rl4MkMED8xiJ3g encrypted names ! interface Ethernet0/0 nameif NIACEDC security-level 100 ip address x.x.x.x 255.255.255.0 ! interface Ethernet0/1 description External Janet Connection nameif JANET security-level 0 ip address x.x.x.x 255.255.255.248 ! interface Ethernet0/2 shutdown no nameif security-level 100 no ip address ! interface Ethernet0/3 shutdown no nameif security-level 100 ip address dhcp setroute ! interface Management0/0 nameif management security-level 100 ip address 192.168.100.1 255.255.255.0 management-only ! passwd 2KFQnbNIdI.2KYOU encrypted ftp mode passive clock timezone GMT/BST 0 clock summer-time GMT/BDT recurring last Sun Mar 1:00 last Sun Oct 2:00 dns domain-lookup NIACEDC dns server-group DefaultDNS name-server 154.32.105.18 name-server 154.32.107.18 domain-name XXXX same-security-traffic permit inter-interface same-security-traffic permit intra-interface access-list ren_access_in extended permit ip any any access-list ren_access_in extended permit tcp any any access-list ren_nat0_outbound extended permit ip 192.168.6.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list NIACEDC_nat0_outbound extended permit ip 192.168.12.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list JANET_20_cryptomap extended permit ip 192.168.12.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list NIACEDC_access_in extended permit ip any any access-list NIACEDC_access_in extended permit tcp any any access-list JANET_access_out extended permit ip any any access-list NIACEDC_access_out extended permit ip any any pager lines 24 logging enable logging asdm informational mtu NIACEDC 1500 mtu JANET 1500 mtu management 1500 icmp unreachable rate-limit 1 burst-size 1 asdm image disk0:/asdm-522.bin no asdm history enable arp timeout 14400 nat-control global (NIACEDC) 1 interface global (JANET) 1 interface nat (NIACEDC) 0 access-list NIACEDC_nat0_outbound nat (NIACEDC) 1 192.168.12.0 255.255.255.0 access-group NIACEDC_access_in in interface NIACEDC access-group NIACEDC_access_out out interface NIACEDC access-group JANET_access_out out interface JANET route JANET 0.0.0.0 0.0.0.0 194.82.121.82 1 route JANET 0.0.0.0 0.0.0.0 192.168.3.248 tunneled timeout xlate 3:00:00 timeout conn 1:00:00 half-closed 0:10:00 udp 0:02:00 icmp 0:00:02 timeout sunrpc 0:10:00 h323 0:05:00 h225 1:00:00 mgcp 0:05:00 mgcp-pat 0:05:00 timeout sip 0:30:00 sip_media 0:02:00 sip-invite 0:03:00 sip-disconnect 0:02:00 timeout uauth 0:05:00 absolute http server enable http 192.168.12.0 255.255.255.0 NIACEDC http 192.168.100.0 255.255.255.0 management http 192.168.9.0 255.255.255.0 NIACEDC no snmp-server location no snmp-server contact snmp-server enable traps snmp authentication linkup linkdown coldstart crypto ipsec transform-set ESP-3DES-SHA esp-3des esp-sha-hmac crypto ipsec transform-set ESP-AES-256-SHA esp-aes-256 esp-sha-hmac crypto map JANET_map 20 match address JANET_20_cryptomap crypto map JANET_map 20 set pfs crypto map JANET_map 20 set peer X.X.X.X crypto map JANET_map 20 set transform-set ESP-AES-256-SHA crypto map JANET_map interface JANET crypto isakmp enable JANET crypto isakmp policy 10 authentication pre-share encryption aes-256 hash sha group 2 lifetime 86400 crypto isakmp policy 30 authentication pre-share encryption 3des hash sha group 2 lifetime 86400 crypto isakmp policy 50 authentication pre-share encryption aes-256 hash sha group 5 lifetime 86400 tunnel-group X.X.X.X type ipsec-l2l tunnel-group X.X.X.X ipsec-attributes pre-shared-key * telnet timeout 5 ssh timeout 5 console timeout 0 dhcpd address 192.168.100.2-192.168.100.254 management dhcpd enable management ! ! class-map inspection_default match default-inspection-traffic ! ! policy-map type inspect dns preset_dns_map parameters message-length maximum 512 policy-map global_policy class inspection_default inspect dns preset_dns_map inspect ftp inspect h323 h225 inspect h323 ras inspect rsh inspect rtsp inspect esmtp inspect sqlnet inspect skinny inspect sunrpc inspect xdmcp inspect sip inspect netbios inspect tftp inspect http ! service-policy global_policy global prompt hostname context no asdm history enable Thanks in advance, Scott

  Read the article

• Objective-C: how to prevent abstraction leaks

  - by iter

  I gather that in Objective-C I must declare instance variables as part of the interface of my class even if these variables are implementation details and have private access. In "subjective" C, I can declare a variable in my .c file and it is not visible outside of that compilation unit. I can declare it in the corresponding .h file, and then anyone who links in that compilation unit can see the variable. I wonder if there is an equivalent choice in Objective-C, or if I must indeed declare every ivar in the .h for my class. Ari.

  Read the article

• How to install Python ssl module on Windows?

  - by Jader Dias

  The Google App Engine Launcher tells me: WARNING appengine_rpc.py:399 ssl module not found. Without the ssl module, the identity of the remote host cannot be verified, and connections may NOT be secure. To fix this, please install the ssl module from http://pypi.python.org/pypi/ssl . I downloaded the package and it contained a setup.py file. I ran: python setup.py install and then: Python was built with Visual Studio 2003; blablabla use MinGW32 Then I installed MinGW32 and now the compilation doesn't work. The end of the compilation errors contains: ssl/_ssl2.c:1561: error: `CRYPTO_LOCK' undeclared (first use in this function) error: command 'gcc' failed with exit status 1 What should I do?

  Read the article

• Sublime Text LaTeXTools console autohide

  - by DCh

  The build script in the LaTeXTools plugin for Sublime Text editor pops up the console, where the result of the compilation is written. I would like the console to auto-hide once the compilation is finished and there are no errors (and to stay open otherwise). I knew how to achieve this with Sublime Text 2. (I think I inserted two lines sublime.active_window().run_command("show_panel", {"panel": "console", "toggle": True})) somewhere in the build script.) How to achieve this behavior with Sublime Text 3? How to (properly) achieve this behavior with Sublime Text 2?

  Read the article

• Nullable Enum nullable type question

  - by Michael Kniskern

  I get the following compilation error with the following source code: Compilation Error: Type of conditional expression cannot be determined because there is no implicit conversion between '' and 'MyEnum' Source Code public enum MyEnum { Value1, Value2, Value3 } public class MyClass { public MyClass() {} public MyEnum? MyClassEnum { get; set; } } public class Main() { object x = new object(); MyClass mc = new MyClass() { MyClassEnum = Convert.IsDBNull(x) : null ? (MyEnum) Enum.Parse(typeof(MyEnum), x.ToString(), true) }; } How can I resolve this error?

  Read the article

• Why is my app running

  - by John Smith

  I have compiled my iPhone app with setting (Device, Release). I install it on the test machine and it runs with no problem. Here's the problem. The app is linked to a C++ library. The compilation on the simulator has no errors. However the device compilation produces 568 errors, mostly about different visibilities w.r.t AppDelegate.o. They all look like: QL::Error::~Error()has different visibility (default) in /QL/build/Release-iphoneos/libQLLibrary.a(abcd.o) and (hidden) in /Programming/ObjC/Second/build/Second.build/Release-iphoneos/FG.build/Objects-normal/armv6/AppDelegate.o Why is this, and how can I stop the errors anyway?

  Read the article

< Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >