Search Results

Search found 2750 results on 110 pages for 'recursive subquery factor'.

Page 44/110 | < Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >

  • Recursion in prepared statements

    - by Rob
    I've been using PDO and preparing all my statements primarily for security reasons. However, I have a part of my code that does execute the same statement many times with different parameters, and I thought this would be where the prepared statements really shine. But they actually break the code... The basic logic of the code is this. function someFunction($something) { global $pdo; $array = array(); static $handle = null; if (!$handle) { $handle = $pdo->prepare("A STATEMENT WITH :a_param"); } $handle->bindValue(":a_param", $something); if ($handle->execute()) { while ($row = $handle->fetch()) { $array[] = someFunction($row['blah']); } } return $array; } It looked fine to me, but it was missing out a lot of rows. Eventually I realised that the statement handle was being changed (executed with different param), which means the call to fetch in the while loop will only ever work once, then the function calls itself again, and the result set is changed. So I am wondering what's the best way of using PDO prepared statements in a recursive way. One way could be to use fetchAll(), but it says in the manual that has a substantial overhead. The whole point of this is to make it more efficient. The other thing I could do is not reuse a static handle, and instead make a new one every time. I believe that since the query string is the same, internally the MySQL driver will be using a prepared statement anyway, so there is just the small overhead of creating a new handle on each recursive call. Personally I think that defeats the point. Or is there some way of rewriting this?

    Read the article

  • [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

    - by The chicken in the kitchen
    Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

    Read the article

  • What exactly is a reentrant function?

    - by eSKay
    Most of the times, the definition of reentrance is quoted from Wikipedia: A computer program or routine is described as reentrant if it can be safely called again before its previous invocation has been completed (i.e it can be safely executed concurrently). To be reentrant, a computer program or routine: Must hold no static (or global) non-constant data. Must not return the address to static (or global) non-constant data. Must work only on the data provided to it by the caller. Must not rely on locks to singleton resources. Must not modify its own code (unless executing in its own unique thread storage) Must not call non-reentrant computer programs or routines. How is safely defined? If a program can be safely executed concurrently, does it always mean that it is reentrant? What exactly is the common thread between the six points mentioned that I should keep in mind while checking my code for reentrant capabilities? Also, Are all recursive functions reentrant? Are all thread-safe functions reentrant? Are all recursive and thread-safe functions reentrant? While writing this question, one thing comes to mind: Are the terms like reentrance and thread safety absolute at all i.e. do they have fixed concrete definations? For, if they are not, this question is not very meaningful. Thanks!

    Read the article

  • Running a Model::find in for loop in cakephp v1.3

    - by Gaurav Sharma
    Hi all, How can I achieve the following result in cakephp: In my application a Topic is related to category, category is related to city and city is finally related to state in other words: topic belongs to category, category belongs to city , city belongs to state.. Now in the Topic controller's index action I want to find out all the topics and it's city and state. How can I do this. I can easily do this using a custom query ($this-Model-query() function ) but then I will be facing pagination difficulties. I tried doing like this function index() { $this->Topic->recursive = 0; $topics = $this->paginate(); for($i=0; $i<count($topics);$i++) { $topics[$i]['City'] = $this->Topic->Category->City->find('all', array('conditions' => array('City.id' => $topics[$i]['Category']['city_id']))); } $this->set(compact('messages')); } The method that I have adopted is not a good one (running query in a loop) Using the recursive property and setting it to highest value (2) will degrade performance and is not going to yield me state information. How shall I solve this ? Please help Thanks

    Read the article

  • Trait, FunctionN, or trait-inheriting-FunctionN in Scala?

    - by Willis Blackburn
    I have a trait in Scala that has a single method. Call it Computable and the single method is compute(input: Int): Int. I can't figure out whether I should Leave it as a standalone trait with a single method. Inherit from (Int = Int) and rename "compute" to "apply." Just get rid of Computable and use (Int = Int). A factor in favor of it being a trait is that I could usefully add some additional methods. But of course if they were all implemented in terms of the compute method then I could just break them out into a separate object. A factor in favor of just using the function type is simplicity and the fact that the syntax for an anonymous function is more concise than that for an anonymous Computable instance. But then I've no way to distinguish objects that are actually Computable instances from other functions that map Int to Int but aren't meant to be used in the same context as Computable. How do other people approach this type of problem? No right or wrong answers here; I'm just looking for advice.

    Read the article

  • Is there a IDE/compiler PC benchmark I can use to compare my PCs performance?

    - by RickL
    I'm looking for a benchmark (and results on other PCs) which would give me an idea of the development performance gain I could get by upgrading my PC, also the benchmark could be used to justify the upgrade to my boss. I use Visual Studio 2008 for my development, so I'd like to get an idea of by what factor the build times would be improved, and also it would be good if the benchmark could incorporate IDE performance (i.e. when editing, using intellisense, opening code files etc) into its result. I currently have an AMD 3800x2, with 2GB RAM on Vista 32. For example, I'd like to know what kind of performance gain I'd see in Visual Studio 2008 with a Q6600, 4GB RAM on Vista 64. And also with other processors, and other RAM sizes... also see whether hard disk performance is a big factor. EDIT: I mentioned Vista 64 because I'm aware that Vista 32 can only use 3GB RAM maximum. So I'd presume that wanting to use more RAM would require Vista 64, but perhaps it could still be slower overall there is a large overhead in using the 32 bit VS 2008 on 64 bit OS.

    Read the article

  • git submodule pull and commit automatically on webserver

    - by Lukas Oppermann
    I have the following setup, I am working on a project project with the submodule submodule. Whenever I push changes to github it sends a post request to update.php on the server. This php file executes a git command. Without submodules I can just do a git pull and everything is fine but with submodules it is much more difficult. I have this at the moment, but it does not do what I want. I should git pull the repo and update and pull the latest version of each submodule. <?php echo `git submodule foreach 'git checkout master; git pull; git submodule update --init --recursive; git commit -m "updating"' && git pull && git submodule foreach 'git add -A .' && git commit -m "updating to latest version including submodules" 2>&1s`; EDIT// Okay, I got it half way done. <?php echo `git submodule foreach 'git checkout master; git pull; git submodule update --init --recursive; git commit -am "updating"; echo "updated"' && git pull && git commit -am "updating to latest version including submodules" && echo 'updated'`; The echo prevents the script to stop because of non-zero returned. It works 100% fine when I run it from the console using php update.php. When github initialized the file, or I run it from the browser it still does not work. Any ideas?

    Read the article

  • How to work with CTE. There is some error related to anchor.

    - by Shantanu Gupta
    I am creating a hierarchy representaion of a column. But an error occurs Details are Msg 240, Level 16, State 1, Line 1 Types don't match between the anchor and the recursive part in column "DISPLAY" of recursive query "CTE". I know there is some typecasting error. But I dont know how to remove error. Please just dont only sort out my error. I need explanation why this error is coming. When this error occurs. I am trying to sort table on the basis of sort col that i m introducing. I want to add '-' at every level and want to sort accordingly. Please help WITH CTE (PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, DISPLAY, SORT, DEPTH) AS ( SELECT PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, '-' AS DISPLAY, '--' AS SORT, 0 AS DEPTH FROM dbo.L_CATEGORY_TYPE WHERE FK_CATEGORY_ID IS NULL UNION ALL SELECT T.PK_CATEGORY_ID, T.[DESCRIPTION], T.FK_CATEGORY_ID, CAST(DISPLAY+T.[DESCRIPTION] AS VARCHAR(1000)), '--' AS SORT, C.DEPTH +1 FROM dbo.L_CATEGORY_TYPE T JOIN CTE C ON C.PK_CATEGORY_ID = T.FK_CATEGORY_ID --SELECT T.PK_CATEGORY_ID, C.SORT+T.[DESCRIPTION], T.FK_CATEGORY_ID --, CAST('--' + C.SORT AS VARCHAR(1000)) AS SORT, CAST(DEPTH +1 AS INT) AS DEPTH --FROM dbo.L_CATEGORY_TYPE T JOIN CTE C ON C.FK_CATEGORY_ID = T.PK_CATEGORY_ID ) SELECT PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, DISPLAY, SORT, DEPTH FROM CTE ORDER BY SORT

    Read the article

  • C# Recursion SumOfOnlyNeg Elements

    - by Chris
    Hello, A array gets filled up with random elements (negative and positive). Now i want to calculate the sum of ONLY the postive elements. Iterative there is no problem, but in the recursion version i can only get the sum of both negative and postive. How can i "check" in the recursive version that it only sums up the Postive elements? Best Regards. Iterative version: public int IterSomPosElem(int[] tabel, int n) { n = 0; for (int i = 0; i < tabel.Length; i++) { if (tabel[i] >= 0) { n += tabel[i]; } } return n; } Recursive version atm (sums up all the elements insteed, of only the positive) public int RecuSomPosElem(int[] tabel, int n) { if(n == 1) return tabel[0]; //stopCriterium else { return (tabel[n - 1] + RecuSomPosElem(tabel, n - 1)); // how to check, so it only sums up the postive elements and "ignores" the negative elements. } }

    Read the article

  • Efficient Multiplication of Varying-Length #s [Conceptual]

    - by Milan Patel
    Write the pseudocode of an algorithm that takes in two arbitrary length numbers (provided as strings), and computes the product of these numbers. Use an efficient procedure for multiplication of large numbers of arbitrary length. Analyze the efficiency of your algorithm. I decided to take the (semi) easy way out and use the Russian Peasant Algorithm. It works like this: a * b = a/2 * 2b if a is even a * b = (a-1)/2 * 2b + a if a is odd My pseudocode is: rpa(x, y){ if x is 1 return y if x is even return rpa(x/2, 2y) if x is odd return rpa((x-1)/2, 2y) + y } I have 3 questions: Is this efficient for arbitrary length numbers? I implemented it in C and tried varying length numbers. The run-time in was near-instant in all cases so it's hard to tell empirically... Can I apply the Master's Theorem to understand the complexity...? a = # subproblems in recursion = 1 (max 1 recursive call across all states) n / b = size of each subproblem = n / 1 - b = 1 (problem doesn't change size...?) f(n^d) = work done outside recursive calls = 1 - d = 0 (the addition when a is odd) a = 1, b^d = 1, a = b^d - complexity is in n^d*log(n) = log(n) this makes sense logically since we are halving the problem at each step, right? What might my professor mean by providing arbitrary length numbers "as strings". Why do that? Many thanks in advance

    Read the article

  • model.matrix() with na.action=NULL?

    - by Vincent
    I have a formula and a data frame, and I want to extract the model.matrix(). However, I need the resulting matrix to include the NAs that were found in the original dataset. If I were to use model.frame() to do this, I would simply pass it na.action=NULL. However, the output I need is of the model.matrix() format. Specifically, I need only the right-hand side variables, I need the output to be a matrix (not a data frame), and I need factors to be converted to a series of dummy variables. I'm sure I could hack something together using loops or something, but I was wondering if anyone could suggest a cleaner and more efficient workaround. Thanks a lot for your time! And here's an example: dat <- data.frame(matrix(rnorm(20),5,4), gl(5,2)) dat[3,5] <- NA names(dat) <- c(letters[1:4], 'fact') ff <- a ~ b + fact # This omits the row with a missing observation on the factor model.matrix(ff, dat) # This keeps the NA, but it gives me a data frame and does not dichotomize the factor model.frame(ff, dat, na.action=NULL) Here is what I would like to obtain: (Intercept) b fact2 fact3 fact4 fact5 1 1 0.7266086 0 0 0 0 2 1 -0.6088697 0 0 0 0 3 NA 0.4643360 NA NA NA NA 4 1 -1.1666248 1 0 0 0 5 1 -0.7577394 0 1 0 0 6 1 0.7266086 0 1 0 0 7 1 -0.6088697 0 0 1 0 8 1 0.4643360 0 0 1 0 9 1 -1.1666248 0 0 0 1 10 1 -0.7577394 0 0 0 1

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Generate unique ID from multiple values with fault tolerance

    - by ojreadmore
    Given some values, I'd like to make a (pretty darn) unique result. $unique1 = generate(array('ab034', '981kja7261', '381jkfa0', 'vzcvqdx2993883i3ifja8', '0plnmjfys')); //now $unique1 == "sqef3452y"; I also need something that's pretty close to return the same result. In this case, 20% of the values is missing. $unique2 = generate(array('ab034', '981kja7261', '381jkfa0', 'vzcvqdx2993883i3ifja8')); //also $unique2 == "sqef3452y"; I'm not sure where to begin with such an algorithm but I have some assumptions. I assume that the more values given, the more accurate the resulting ID – in other words, using 20 values is better than 5. I also assume that a confidence factor can be calculated and adjusted. What would be nice to have is a weight factor where one can say 'value 1 is more important than value 3'. This would require a multidimensional array for input instead of one dimension. I just mashed on the keyboard for these values, but in practice they may be short or long alpha numeric values.

    Read the article

  • ggplot: showing % instead of counts in charts of categorical variables

    - by wishihadabettername
    I'm plotting a categorical variable and instead of showing the counts for each category value, I'm looking for a way to get ggplot to display the percentage of values in that category. Of course, it is possible to create another variable with the calculated percentage and plot that one, but I have to do it several dozens of times and I hope to achieve that in one command. I was experimenting with something like qplot (mydataf) + stat_bin(aes(n=nrow(mydataf), y=..count../n)) + scale_y_continuous(formatter="percent") but I must be using it incorrectly, as I got errors. To easily reproduce the setup, here's a simplified example: mydata <- c ("aa", "bb", null, "bb", "cc", "aa", "aa", "aa", "ee", null, "cc"); mydataf <- factor(mydata); qplot (mydataf); #this shows the count, I'm looking to see % displayed. In the real case I'll probably use ggplot instead of qplot, but the right way to use stat_bin still eludes me. Thank you. UPDATE: I've also tried these four approaches: ggplot(mydataf, aes(y = (..count..)/sum(..count..))) + scale_y_continuous(formatter = 'percent'); ggplot(mydataf, aes(y = (..count..)/sum(..count..))) + scale_y_continuous(formatter = 'percent') + geom_bar(); ggplot(mydataf, aes(x = levels(mydataf), y = (..count..)/sum(..count..))) + scale_y_continuous(formatter = 'percent'); ggplot(mydataf, aes(x = levels(mydataf), y = (..count..)/sum(..count..))) + scale_y_continuous(formatter = 'percent') + geom_bar(); but all 4 give: Error: ggplot2 doesn't know how to deal with data of class factor The same error appears for the simple case of ggplot (data=mydataf, aes(levels(mydataf))) + geom_bar() so it's clearly something about how ggplot interacts with a single vector. I'm scratching my head, googling for that error gives a single result.

    Read the article

  • Top n items in a List ( including duplicates )

    - by Krishnan
    Trying to find an efficient way to obtain the top N items in a very large list, possibly containing duplicates. I first tried sorting & slicing, which works. But this seems unnnecessary. You shouldn't need to sort a very large list if you just want the top 20 members. So I wrote a recursive routine which builds the top-n list. This also works, but is very much slower than the non-recursive one! Question: Which is my second routine (elite2) so much slower than elite, and how do I make it faster ? My code is attached below. Thanks. import scala.collection.SeqView import scala.math.min object X { def elite(s: SeqView[Int, List[Int]], k:Int):List[Int] = { s.sorted.reverse.force.slice(0,min(k,s.size)) } def elite2(s: SeqView[Int, List[Int]], k:Int, s2:List[Int]=Nil):List[Int] = { if( k == 0 || s.size == 0) s2.reverse else { val m = s.max val parts = s.force.partition(_==m) val whole = if( parts._1.size > 1) parts._1.tail:::parts._2 else parts._2 elite2( whole.view, k-1, m::s2 ) } } def main(args:Array[String]) = { val N = 1000000/3 val x = List(N to 1 by -1).flatten.map(x=>List(x,x,x)).flatten.view println(elite2(x,20)) println(elite(x,20)) } }

    Read the article

  • Populate an Object Model from a data dataTable(C#3.0)

    - by Newbie
    I have a situation I am getting data from some external sources and is populating into the datatable. The data looks like this DATE WEEK FACTOR 3/26/2010 1 RM_GLOBAL_EQUITY 3/26/2010 1 RM_GLOBAL_GROWTH 3/26/2010 2 RM_GLOBAL_VALUE 3/26/2010 2 RM_GLOBAL_SIZE 3/26/2010 2 RM_GLOBAL_MOMENTUM 3/26/2010 3 RM_GLOBAL_HIST_BETA I have a object model like this public class FactorReturn { public int WeekNo { get; set; } public DateTime WeekDate { get; set; } public Dictionary<string, decimal> FactorCollection { get; set; } } As can be seen that the Date field is always constant. And a single(means unique) week can have multiple FACTORS. i.e. For a date(3/26/2010), for Week No. 1, there are two FACTORS(RM_GLOBAL_EQUITY and RM_GLOBAL_GROWTH). Similarly, For a date(3/26/2010), for Week No. 2, there are three FACTORS(RM_GLOBAL_VALUE , RM_GLOBAL_SIZE and RM_GLOBAL_MOMENTUM ). Now we need to populate this data into our object model. The final output will be WeekDate: 3/26/2010 WeekNo : 1 FactorCollection : RM_GLOBAL_EQUITY FactorCollection : RM_GLOBAL_GROWTH WeekNo : 2 FactorCollection : RM_GLOBAL_VALUE FactorCollection : RM_GLOBAL_SIZE FactorCollection : RM_GLOBAL_MOMENTUM WeekNo : 3 FactorCollection : RM_GLOBAL_HIST_BETA That is, overall only 1 single collection, where the Factor type will vary depending on week numbers. I have tried but of useless. Nothing works. Could you please help me?. I feel it is very tough I am using C# 3.0 Thanks

    Read the article

  • Insertion into BST without header Node JAVA

    - by Petiatil
    I am working on a recursive insertion method for a BST. This function is suppose to be a recursive helper method and is in a private class called Node. The Node class is in a class called BinarySearchTree which contains an instance variable for the root. When I am trying to insert an element, I get a NullPointerException at : this.left = insert(((Node)left).element); I am unsure about why this occurs. If I understand correctly, in a BST, I am suppose to insert the item at the last spot on the path transversed. Any help is appreciated! private class Node implements BinaryNode<E> { E item; BinaryNode<E> left, right; public BinaryNode<E> insert(E item) { int compare = item.compareTo(((Node)root).item); if(root == null) { root = new Node(); ((Node)root).item = item; } else if(compare < 0) { this.left = insert(((Node)left).item); } else if(compare > 0) { this.right = insert(((Node)right).item); } return root; } }

    Read the article

  • SQL SERVER – Weekly Series – Memory Lane – #032

    - by Pinal Dave
    Here is the list of selected articles of SQLAuthority.com across all these years. Instead of just listing all the articles I have selected a few of my most favorite articles and have listed them here with additional notes below it. Let me know which one of the following is your favorite article from memory lane. 2007 Complete Series of Database Coding Standards and Guidelines SQL SERVER Database Coding Standards and Guidelines – Introduction SQL SERVER – Database Coding Standards and Guidelines – Part 1 SQL SERVER – Database Coding Standards and Guidelines – Part 2 SQL SERVER Database Coding Standards and Guidelines Complete List Download Explanation and Example – SELF JOIN When all of the data you require is contained within a single table, but data needed to extract is related to each other in the table itself. Examples of this type of data relate to Employee information, where the table may have both an Employee’s ID number for each record and also a field that displays the ID number of an Employee’s supervisor or manager. To retrieve the data tables are required to relate/join to itself. Insert Multiple Records Using One Insert Statement – Use of UNION ALL This is very interesting question I have received from new developer. How can I insert multiple values in table using only one insert? Now this is interesting question. When there are multiple records are to be inserted in the table following is the common way using T-SQL. Function to Display Current Week Date and Day – Weekly Calendar Straight blog post with script to find current week date and day based on the parameters passed in the function.  2008 In my beginning years, I have almost same confusion as many of the developer had in their earlier years. Here are two of the interesting question which I have attempted to answer in my early year. Even if you are experienced developer may be you will still like to read following two questions: Order Of Column In Index Order of Conditions in WHERE Clauses Example of DISTINCT in Aggregate Functions Have you ever used DISTINCT with the Aggregation Function? Here is a simple example about how users can do it. Create a Comma Delimited List Using SELECT Clause From Table Column Straight to script example where I explained how to do something easy and quickly. Compound Assignment Operators SQL SERVER 2008 has introduced new concept of Compound Assignment Operators. Compound Assignment Operators are available in many other programming languages for quite some time. Compound Assignment Operators is operator where variables are operated upon and assigned on the same line. PIVOT and UNPIVOT Table Examples Here is a very interesting question – the answer to the question can be YES or NO both. “If we PIVOT any table and UNPIVOT that table do we get our original table?” Read the blog post to get the explanation of the question above. 2009 What is Interim Table – Simple Definition of Interim Table The interim table is a table that is generated by joining two tables and not the final result table. In other words, when two tables are joined they create an interim table as resultset but the resultset is not final yet. It may be possible that more tables are about to join on the interim table, and more operations are still to be applied on that table (e.g. Order By, Having etc). Besides, it may be possible that there is no interim table; sometimes final table is what is generated when the query is run. 2010 Stored Procedure and Transactions If Stored Procedure is transactional then, it should roll back complete transactions when it encounters any errors. Well, that does not happen in this case, which proves that Stored Procedure does not only provide just the transactional feature to a batch of T-SQL. Generate Database Script for SQL Azure When talking about SQL Azure the most common complaint I hear is that the script generated from stand-along SQL Server database is not compatible with SQL Azure. This was true for some time for sure but not any more. If you have SQL Server 2008 R2 installed you can follow the guideline below to generate a script which is compatible with SQL Azure. Convert IN to EXISTS – Performance Talk It is NOT necessary that every time when IN is replaced by EXISTS it gives better performance. However, in our case listed above it does for sure give better performance. You can read about this subject in the associated blog post. Subquery or Join – Various Options – SQL Server Engine Knows the Best Every single time whenever there is a performance tuning exercise, I hear the conversation from developer where some prefer subquery and some prefer join. In this two part blog post, I explain the same in the detail with examples. Part 1 | Part 2 Merge Operations – Insert, Update, Delete in Single Execution MERGE is a new feature that provides an efficient way to do multiple DML operations. In earlier versions of SQL Server, we had to write separate statements to INSERT, UPDATE, or DELETE data based on certain conditions; however, at present, by using the MERGE statement, we can include the logic of such data changes in one statement that even checks when the data is matched and then just update it, and similarly, when the data is unmatched, it is inserted. 2011 Puzzle – Statistics are not updated but are Created Once Here is the quick scenario about my setup. Create Table Insert 1000 Records Check the Statistics Now insert 10 times more 10,000 indexes Check the Statistics – it will be NOT updated – WHY? Question to You – When to use Function and When to use Stored Procedure Personally, I believe that they are both different things - they cannot be compared. I can say, it will be like comparing apples and oranges. Each has its own unique use. However, they can be used interchangeably at many times and in real life (i.e., production environment). I have personally seen both of these being used interchangeably many times. This is the precise reason for asking this question. 2012 In year 2012 I had two interesting series ran on the blog. If there is no fun in learning, the learning becomes a burden. For the same reason, I had decided to build a three part quiz around SEQUENCE. The quiz was to identify the next value of the sequence. I encourage all of you to take part in this fun quiz. Guess the Next Value – Puzzle 1 Guess the Next Value – Puzzle 2 Guess the Next Value – Puzzle 3 Guess the Next Value – Puzzle 4 Simple Example to Configure Resource Governor – Introduction to Resource Governor Resource Governor is a feature which can manage SQL Server Workload and System Resource Consumption. We can limit the amount of CPU and memory consumption by limiting /governing /throttling on the SQL Server. If there are different workloads running on SQL Server and each of the workload needs different resources or when workloads are competing for resources with each other and affecting the performance of the whole server resource governor is a very important task. Tricks to Replace SELECT * with Column Names – SQL in Sixty Seconds #017 – Video  Retrieves unnecessary columns and increases network traffic When a new columns are added views needs to be refreshed manually Leads to usage of sub-optimal execution plan Uses clustered index in most of the cases instead of using optimal index It is difficult to debug SQL SERVER – Load Generator – Free Tool From CodePlex The best part of this SQL Server Load Generator is that users can run multiple simultaneous queries again SQL Server using different login account and different application name. The interface of the tool is extremely easy to use and very intuitive as well. A Puzzle – Swap Value of Column Without Case Statement Let us assume there is a single column in the table called Gender. The challenge is to write a single update statement which will flip or swap the value in the column. For example if the value in the gender column is ‘male’ swap it with ‘female’ and if the value is ‘female’ swap it with ‘male’. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Memory Lane, PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • iPhone 3GS lens data for Hugin / Panorama Tools

    - by david-ocallaghan
    I'm using the Hugin frontend to Panorama Tools and it requires camera and lens data for the images it handles (details here: http://wiki.panotools.org/Hugin_Camera_and_Lens_tab). Can anyone tell me the appropriate values for the iPhone 3GS camera? Lens: rectilinear Horizontal Field of View: ? focal length: 3.85mm crop factor / focal length multiplier: ?

    Read the article

  • OpenNMS monitoring SAP

    - by HannesFostie
    I was wondering if anyone had any experience plugging SAP into their OpenNMS installation. Mostly looking for experiences, perhaps Nagios comparisons, or some more concrete information on what is being monitored and how you did it. Go into as much details as you like. I am currently in the process of evaluating both Nagios and OpenNMS and the possibilities with SAP might be the deciding factor here. Sadly, I didn't find a whole lot on google on the subject.

    Read the article

  • Proftp error message Fatal: unknown configuration directive 'DisplayFirstChdir' on line 22 of '/etc/proftpd/proftpd.conf'

    - by LedZeppelin
    Sorry for the newb factor but I'm trying to set up a server using this guide: http://www.intac.net/build-your-own-server/ I'm at the end of step 5 and when I try to restart proftp I get the following error message me@me-desktop:~$ sudo service proftpd restart * Stopping ftp server proftpd [ OK ] * Starting ftp server proftpd Fatal: unknown configuration directive 'DisplayFirstChdir' on line 22 of '/etc/proftpd/proftpd.conf' [fail] Any clues on how to change line 22?

    Read the article

  • What causes style corruption in MS Word?

    - by Phil.Wheeler
    I've had a few documents across my desk that appear to have a corrupted or recursive style for much of the body text: Char char char char char char Does anyone know what causes this and how to permanently delete this style? When I try to delete it, it disappears from the Styles and Formatting pane of Word, only to reappear later when different text is selected. Input or guidance much appreciated.

    Read the article

  • Server have 2 psu, can i only turn on 1 psu, to reduce cost in colocation?

    - by Earl
    i just got a server & want to colocation it in datacenter server details : HP DL380, 2x intel Xeon (3,06GHz/533, 512KB L2 Cache), 8x Fans, Form Factor Rack (2U), 2x 400W Power Supplies, the server have 2 psu, can i only turn on 1 psu, to reduce cost in colocation? will the server still running good? the standart colocation packages in my city only give default power 400w, if need additional power 400w need additional cost about $40-60 again permonth please give suggestion from your experience

    Read the article

  • Benchmark MySQL Cluster using flexAsynch: No free node id found for mysqld(API)?

    - by quanta
    I am going to benchmark MySQL Cluster using flexAsynch follow this guide, details as below: mkdir /usr/local/mysqlc732/ cd /usr/local/src/mysql-cluster-gpl-7.3.2 cmake . -DCMAKE_INSTALL_PREFIX=/usr/local/mysqlc732/ -DWITH_NDB_TEST=ON make make install Everything works fine until this step: # /usr/local/mysqlc732/bin/flexAsynch -t 1 -p 80 -l 2 -o 100 -c 100 -n FLEXASYNCH - Starting normal mode Perform benchmark of insert, update and delete transactions 1 number of concurrent threads 80 number of parallel operation per thread 100 transaction(s) per round 2 iterations Load Factor is 80% 25 attributes per table 1 is the number of 32 bit words per attribute Tables are with logging Transactions are executed with hint provided No force send is used, adaptive algorithm used Key Errors are disallowed Temporary Resource Errors are allowed Insufficient Space Errors are disallowed Node Recovery Errors are allowed Overload Errors are allowed Timeout Errors are allowed Internal NDB Errors are allowed User logic reported Errors are allowed Application Errors are disallowed Using table name TAB0 NDBT_ProgramExit: 1 - Failed ndb_cluster.log: WARNING -- Failed to allocate nodeid for API at 127.0.0.1. Returned eror: 'No free node id found for mysqld(API).' I also have recompiled with -DWITH_DEBUG=1 -DWITH_NDB_DEBUG=1. How can I run flexAsynch in the debug mode? # /usr/local/mysqlc732/bin/flexAsynch -h FLEXASYNCH Perform benchmark of insert, update and delete transactions Arguments: -t Number of threads to start, default 1 -p Number of parallel transactions per thread, default 32 -o Number of transactions per loop, default 500 -l Number of loops to run, default 1, 0=infinite -load_factor Number Load factor in index in percent (40 -> 99) -a Number of attributes, default 25 -c Number of operations per transaction -s Size of each attribute, default 1 (PK is always of size 1, independent of this value) -simple Use simple read to read from database -dirty Use dirty read to read from database -write Use writeTuple in insert and update -n Use standard table names -no_table_create Don't create tables in db -temp Create table(s) without logging -no_hint Don't give hint on where to execute transaction coordinator -adaptive Use adaptive send algorithm (default) -force Force send when communicating -non_adaptive Send at a 10 millisecond interval -local 1 = each thread its own node, 2 = round robin on node per parallel trans 3 = random node per parallel trans -ndbrecord Use NDB Record -r Number of extra loops -insert Only run inserts on standard table -read Only run reads on standard table -update Only run updates on standard table -delete Only run deletes on standard table -create_table Only run Create Table of standard table -drop_table Only run Drop Table on standard table -warmup_time Warmup Time before measurement starts -execution_time Execution Time where measurement is done -cooldown_time Cooldown time after measurement completed -table Number of standard table, default 0

    Read the article

< Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >