Search Results

Search found 37573 results on 1503 pages for 'browser close event'.

Page 442/1503 | < Previous Page | 438 439 440 441 442 443 444 445 446 447 448 449  | Next Page >

  • html widget communicating with server

    - by Nikita Rybak
    I'm making html widget for websites. Let's say, it will display current stock indexes. In short, arbitrary website owner takes code snippet from me and includes it on his webpage http://website.com/index.html. When arbitrary user opens http://website.com/index.html, my code sends request to my server (provider.com), which performs necessary operations and returns information to user's browser. When response has arrived, user will see relevant stock value on http://website.com/index.html. In index.html service could be called like this <script type="text/javascript" src="provider.com/service.js"> </script> <div id="target_area"></div> <script type="text/javascript"> service.show("target_area", options); </script> Now, the problem is in the same origin policy: I can't just send ajax request from website.com to provided.com and return html to embed in client's webpage. I see several solutions, which I list below, but none quite satisfy me. I wonder, if you could suggest something, especially if you had some relevant experience. 1) iframe, plain and simple. Disadvantage: must have fixed dimensions + stupid scroll bars appearing in some browsers. Can be fixed with javascript, but all this browser-specific tinkering doesn't sound good to me. 2) JSONP. Problem: can't return whole chunk of html, must return only data. Then, on browser side, I'll have to use javascript to embed data into html snippet placed statically in index.html. Doesn't sound nice, because data format is not very simple and may even change later. 3) Use hidden iframe to do ajax requests. A bit tricky, but sounds like a way to go. Well, that's my thoughts on the subject. Are there any better ways? BTW, I tried to check some existing widgets too, but didn't find much useful information. All domain names used in this text are fictional and any resemblance is purely coincidental :)

    Read the article

  • Hibernate "JOIN ... ON"?

    - by CaptainAwesomePants
    I have an application that uses Hibernate for its domain objects. One part of the app is common between a few apps, and it has no knowledge of the other systems. In order to handle relations, our class looks like this: @Entity public class SystemEvent { @Id @GeneratedValue public int entity_id; @Column(name="event_type") public String eventType; @Column(name="related_id") public int relatedObjectId; } relatedObjectId holds a foreign key to one of several different objects, depending on the type of event. When a system wants to know about events that are relevant to its interests, it grabs all the system events with eventType "NewAccounts" or some such thing, and it knows that all of those relatedObjectIds are IDs to a "User" object or similar. Unfortunately, this has caused a problem down the line. I can't figure out a way to tell Hibernate about this mapping, which means that HQL queries can't do joins. I'd really like to create an HQL query that looks like this: SELECT users FROM SystemEvent event join Users newUsers where event.eventType = 'SignUp' However, Hibernate has no knowledge of the relationship between SystemEvent and Users, and as far as I can tell, there's no way to tell it. So here's my question: Is there any way to tell Hibernate about a relationship when your domain objects reference each other via ID numbers and not class references?

    Read the article

  • How to best handle exception to repeating calendar events

    - by blcArmadillo
    I'm working on a project that will require me to implement a calendar. I'm trying to come up with a system that is very flexible: can handle repeating events, exceptions to repeats, etc. I've looked at the schema for applications like iCal, Lotus Notes, and Mozilla to get an idea of how to go about implementing such a system. Currently I'm having trouble deciding what is the best way to handle exceptions to repeating events. I've used databases quite a bit but don't have a ton of experience with really optimizing everything so I'm not sure which method of the two I'm considering would be optimal in terms of overall performance and ability to query/search: Breaking the repeating event. So taking the changing the ending date on the current row for the repeating event, inserting a new row with the exception, and adding another row continuing the old sequence. Simply adding an exception. So adding a new row with some field that indicates it as an override. So here is why I can't decide. Method one will result in a lot more rows since each edit requires 2 extra rows as apposed to only one row by the second method. On the other hand I think the query to find an event would be much simper, and thus possibly faster(?) using the first method. The second method seems like it will require more calculating on the application server since once you get the data you'll have to remove the intersection of the two rows. I know databases are often the bottleneck for websites and while I'm sure a lot of you are thinking either is fine because your project will probably never get large enough for the difference in efficiency to really matter, I'd still like to implement the best solution. So what method would you guys pick, or would you do something completely different? Also, as a side note I'll be using MySQL and PHP. If there is another technology that you think would be better suited for this, especially in the database area, please mention it. Thanks for the advice.

    Read the article

  • WPF Update Binding when Bound directly to DataContext w/ Converter

    - by Adam
    Normally when you want a databound control to 'update,' you use the "PropertyChanged" event to signal to the interface that the data has changed behind the scenes. For instance, you could have a textblock that is bound to the datacontext with a property "DisplayText" <TextBlock Text="{Binding Path=DisplayText}"/> From here, if the DataContext raises the PropertyChanged event with PropertyName "DisplayText," then this textblock's text should update (assuming you didn't change the Mode of the binding). However, I have a more complicated binding that uses many properties off of the datacontext to determine the final look and feel of the control. To accomplish this, I bind directly to the datacontext and use a converter. In this case I am working with an image source. <Image Source="{Binding Converter={StaticResource ImageConverter}}"/> As you can see, I use a {Binding} with no path to bind directly to the datacontext, and I use an ImageConverter to select the image I'm looking for. But now I have no way (that I know of) to tell that binding to update. I tried raising the propertychanged event with "." as the propertyname, which did not work. Is this possible? Do I have to wrap up the converting logic into a property that the binding can attach to, or is there a way to tell the binding to refresh (without explicitly refreshing the binding)? Any help would be greatly appreciated. Thanks! -Adam

    Read the article

  • Ignore whitespace in HTML

    - by IP
    Is there anything in HTML/CSS that tells the browser to ignore whitespace completely? So many times when you want to put, say, two images next to each other - you try desperately to keep the HTML readable, but the browser puts a space between them. So instead of something like this: <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> you end up with this <imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /> Which is just so horrible!

    Read the article

  • Javascript/CSS rollover menus are patented and subject to licensing?

    - by Scott B
    Very interesting finding that a client brought to my attention today regarding javascript style rollover menus. They got a call from their legal dept that they need to change the manner in which their rollover menu is activated (at the risk of having to pay license to continue using the navigation technique). Its no April fools joke, apparently this is really happening. Apparently a company named Webvention LLC has obtained enforcement rights to a patent, U.S. Patent No. 5,251,294 - "Accessing, assembling, and using bodies of Information." A menu link, that when rolled over, expands to show a list of categorized, related links. Dropdown menus and slide-out menus are examples of this patented navigational methodology. A key component of this patent is that the dropdown/slide-out action must be initiated by a rollover or mouseover event. If the dropdown/slide-out action is initiated by any other event, such as a mouse-click event, then this behavior is not in violation of the patent. Anyone ever heard of this or know of the validity of its claims? Website is here: http://www.webventionllc.com/

    Read the article

  • jQueryUI Ajax.NET Postback Bug

    - by nigative
    Hi, I have this ASP.NET page with ASP.NET UpdatePanel and jQueryUI droppable and sortable components. The page works fine in all browsers, but doesn't in Internet Explorer (IE8 tested). After I try to call ASP.NET AJAX event (by pressing my asp.net button inside the UpdatePanel) my sortable list stops working properly inside IE browser and the browser throws the following error: Message: Unspecified error. Line: 145 Char: 186 Code: 0 URI: http://code.jquery.com/jquery-1.4.2.min.js I found out that the problem is caused by the code on line 66: $("#droppable").droppable(); If I comment it out, the sortable list works fine after ajax postbacks. But it doesn't make sense. Does anyone know what could be wrong? Thanks. P.S. I am using jQueryUI 1.8.1 and jQuery 1.4.2

    Read the article

  • PhantomJS not exactly rendering HTML to PNG

    - by John Leonard
    I'm having trouble adjusting PhantomJS to create a PNG file that matches the original browser presentation. Here is the entire sample html file. It's a sankey diagram creating using rCharts and d3-sankey. (You'll need to save the file to your hard drive and view it from there.) I'm running on Windows and using rasterize.js: >> phantomjs.exe rasterize.js test.html test.png ISSUE: Below is a snip of one of the text strings when viewed in a browser: And here is a snip of the same string from the PNG created by PhantomJS: How do I make the text-shadow go away? I've played around with various CSS attributes (text-shadow) and webkit-specific attributes (e.g., -webkit-text-rendering), but can't seem to make it go away. Is this a setting in PhantomJS? in the underlying webkit? or somewhere else? Many thanks!

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Understanding try..catch in Javascript

    - by user295189
    I have this try and catch problem. I am trying to redirect to a different page. But sometimes it does and some times it doesnt. I think the problem is in try and catch . can someone help me understand this. Thanks var pg = new Object(); var da = document.all; var wo = window.opener; pg.changeHideReasonID = function(){ if(pg.hideReasonID.value == 0 && pg.hideReasonID.selectedIndex > 0){ pg.otherReason.style.backgroundColor = "ffffff"; pg.otherReason.disabled = 0; pg.otherReason.focus(); } else { pg.otherReason.style.backgroundColor = "f5f5f5"; pg.otherReason.disabled = 1; } } pg.exit = function(pid){ try { if(window.opener.hideRecordReload){ window.opener.hideRecordReload(pg.recordID, pg.recordTypeID); } else { window.opener.pg.hideRecord(pg.recordID, pg.recordTypeID); } } catch(e) {} try { window.opener.pg.hideEncounter(pg.recordID); } catch(e) {} try { window.opener.pg.hideRecordResponse(pg.hideReasonID.value == 0 ? pg.otherReason.value : pg.hideReasonID.options[pg.hideReasonID.selectedIndex].text); } catch(e) {} try { window.opener.pg.hideRecord_Response(pg.recordID, pg.recordTypeID); } catch(e) {} try { window.opener.pg.hideRecord_Response(pg.recordID, pg.recordTypeID); } catch(e) {} try { window.opener.window.parent.frames[1].pg.loadQualityMeasureRequest(); } catch(e) {} try { window.opener.pg.closeWindow(); } catch(e) {} parent.loadCenter2({reportName:'redirectedpage',patientID:pid}); parent.$.fancybox.close(); } pg.hideRecord = function(){ var pid = this.pid; pg.otherReason.value = pg.otherReason.value.trim(); if(pg.hideReasonID.selectedIndex == 0){ alert("You have not indicated your reason for hiding this record."); pg.hideReasonID.focus(); } else if(pg.hideReasonID.value == 0 && pg.hideReasonID.selectedIndex > 0 && pg.otherReason.value.length < 2){ alert("You have indicated that you wish to enter a reason\nnot on the list, but you have not entered a reason."); pg.otherReason.focus(); } else { pg.workin(1); var n = new Object(); n.noheaders = 1; n.recordID = pg.recordID; n.recordType = pg.recordType; n.recordTypeID = pg.recordTypeID; n.encounterID = request.encounterID; n.hideReasonID = pg.hideReasonID.value; n.hideReason = pg.hideReasonID.value == 0 ? pg.otherReason.value : pg.hideReasonID.options[pg.hideReasonID.selectedIndex].text; Connect.Ajax.Post("/emr/hideRecord/act_hideRecord.php", n, pg.exit(pid)); } } pg.init = function(){ pg.blocker = da.blocker; pg.hourglass = da.hourglass; pg.content = da.pageContent; pg.recordType = da.recordType.value; pg.recordID = parseInt(da.recordID.value); pg.recordTypeID = parseInt(da.recordTypeID.value); pg.information = da.information; pg.hideReasonID = da.hideReasonID; pg.hideReasonID.onchange = pg.changeHideReasonID; pg.hideReasonID.tabIndex = 1; pg.otherReason = da.otherReason; pg.otherReason.tabIndex = 2; pg.otherReason.onblur = function(){ this.value = this.value.trim(); } pg.otherReason.onfocus = function(){ this.select(); } pg.btnCancel = da.btnCancel; pg.btnCancel.tabIndex = 4; pg.btnCancel.title = "Close this window"; pg.btnCancel.onclick = function(){ //window.close(); parent.$.fancybox.close(); } pg.btnHide = da.btnHide; pg.btnHide.tabIndex = 3; pg.btnHide.onclick = pg.hideRecord; pg.btnHide.title = "Hide " + pg.recordType.toLowerCase() + " record"; document.body.onselectstart = function(){ if(event.srcElement.tagName.search(/INPUT|TEXT/i)){ return false; } } pg.workin(0); } pg.workin = function(){ var n = arguments.length ? arguments[0] : 1; pg.content.disabled = pg.hideReasonID.disabled = n; pg.blocker.style.display = pg.hourglass.style.display = n ? "block" : "none"; if(n){ pg.otherReason.disabled = 1; pg.otherReason.style.backgroundColor = "f5f5f5"; } else { pg.otherReason.disabled = !(pg.hideReasonID.value == 0 && pg.hideReasonID.selectedIndex > 0); pg.otherReason.style.backgroundColor = pg.otherReason.disabled ? "f5f5f5" : "ffffff"; pg.hideReasonID.focus(); } }

    Read the article

  • Persist subclass as superclass using Hibernate

    - by franziga
    I have a subclass and a superclass. However, only the fields of the superclass are needed to be persist. session.saveOrUpdate((Superclass) subclass); If I do the above, I will get the following exception. org.hibernate.MappingException: Unknown entity: test.Superclass at org.hibernate.impl.SessionFactoryImpl.getEntityPersister(SessionFactoryImpl.java:628) at org.hibernate.impl.SessionImpl.getEntityPersister(SessionImpl.java:1366) at org.hibernate.engine.ForeignKeys.isTransient(ForeignKeys.java:203) at org.hibernate.event.def.AbstractSaveEventListener.getEntityState(AbstractSaveEventListener.java:535) at org.hibernate.event.def.DefaultSaveOrUpdateEventListener.performSaveOrUpdate(DefaultSaveOrUpdateEventListener.java:103) at org.hibernate.event.def.DefaultSaveOrUpdateEventListener.onSaveOrUpdate(DefaultSaveOrUpdateEventListener.java:93) at org.hibernate.impl.SessionImpl.fireSaveOrUpdate(SessionImpl.java:535) at org.hibernate.impl.SessionImpl.saveOrUpdate(SessionImpl.java:527) at org.hibernate.impl.SessionImpl.saveOrUpdate(SessionImpl.java:523) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.hibernate.context.ThreadLocalSessionContext$TransactionProtectionWrapper.invoke(ThreadLocalSessionContext.java:342) at $Proxy54.saveOrUpdate(Unknown Source) How can I persist a subclass as a superclass? I do not prefer creating a superclass instance and then passing the values from the subclass instance. Because, it is easy to forget updating the logic if extra fields are added to superclass in the future.

    Read the article

  • How do I position an element so that it acts like both 'absolutely' & 'relatively' positioned at the same time? - CSS

    - by marcamillion
    You can see the implementation here: http://jsfiddle.net/BMWZd/25/ When you click on one of the names in Box#1, you will see the circle in the top left corner of the box move up and down. How do I stop that? While also, making sure that it shows in the top left corner of each of the boxes on all browser sizes? So position:absolute will keep it in one place regardless of what happens around it. But it won't put it in the exact same position (relatively) on diff browser sizes. But position:relative will. How do I get the best of both worlds?

    Read the article

  • AutoCompleteTextView displays 'android.database.sqlite.SQLiteCursor@'... after making selection

    - by user244190
    I am using the following code to set the adapter (SimpleCursorAdapter) for an AutoCompleteTextView mComment = (AutoCompleteTextView) findViewById(R.id.comment); Cursor cComments = myAdapter.getDistinctComments(); scaComments = new SimpleCursorAdapter(this,R.layout.auto_complete_item,cComments,new String[] {DBAdapter.KEY_LOG_COMMENT},new int[]{R.id.text1}); mComment.setAdapter(scaComments); auto_complete_item.xml <?xml version="1.0" encoding="utf-8"?> <TextView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/text1" android:layout_width="wrap_content" android:layout_height="wrap_content"/> and thi is the xml for the actual control <AutoCompleteTextView android:id="@+id/comment" android:hint="@string/COMMENT" android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="18dp"/> The dropdown appears to work correctly, and shows a list of items. When I make a selection from the list I get a sqlite object ('android.database.sqlite.SQLiteCursor@'... ) in the textview. Anyone know what would cause this, or how to resolve this? thanks Ok I am able to hook into the OnItemClick event, but the TextView.setText() portion of the AutoCompleteTextView widget is updated after this point. The OnItemSelected() event never gets fired, and the onNothingSelected() event gets fired when the dropdown items are first displayed. mComment.setOnItemClickListener( new OnItemClickListener() { @Override public void onItemClick(AdapterView<?> arg0, View arg1, int arg2, long arg3) { // TODO Auto-generated method stub SimpleCursorAdapter sca = (SimpleCursorAdapter) arg0.getAdapter(); String str = getSpinnerSelectedValue(sca,arg2,"comment"); TextView txt = (TextView) arg1; txt.setText(str); Toast.makeText(ctx, "onItemClick", Toast.LENGTH_SHORT).show(); } }); mComment.setOnItemSelectedListener(new OnItemSelectedListener() { @Override public void onItemSelected(AdapterView<?> arg0, View arg1, int arg2, long arg3) { Toast.makeText(ctx, "onItemSelected", Toast.LENGTH_SHORT).show(); } @Override public void onNothingSelected(AdapterView<?> arg0) { // TODO Auto-generated method stub Toast.makeText(ctx, "onNothingSelected", Toast.LENGTH_SHORT).show(); } }); Anyone alse have any ideas on how to override the updating of the TextView? thanks patrick

    Read the article

  • Accessing XUL anonymous content using C++

    - by Vaibhav Gade
    Hi All, I am writing Firefox extension using C++. I am trying to access XUL:tabox element in "TabOpen" event handler, but I am unable access any XUL element. I am putting here pseudocode of my extension for reference: HandleEvent() { if (event type is TabOpen) { nsCOMPtr<nsIDOMNode> OriginalNode = do_QueryInterface(event->GetTarget); nsCOMPtr<nsIDOMNodeList> childlist; // // Note here that I got OriginalNode's local name as "tabbrowser" // OriginalNode->GetChildNodes(getter_AddRefs(childlist)); PRUint32 len; childlist->GetLength(&len); // Return 1; consider only "popup" child element. nsString localName; nsCOMPtr<nsIDOMNode> node1; childlist->Item(0, getter_AddRefs(node1)); node1->GetLocalName(localName); // Returns "popup" as the local name. } } By traversing the DOM tree through DOM Inspector, I came to know that XUL elements are anonymous content. How do I access these XUL elements? Very Thanks in advance, Vaibhav.

    Read the article

  • Prevent Jquery Accordion tab from expanding

    - by Edwin
    I'm trying to use JQuery UI Accordion as a menu, but I can't figure out how to prevent some tabs from expanding. My JS: $("#sidebar").accordion({ collapsible: true, changestart: function(event, ui) { switch ($(ui.newHeader).attr("id")) { case "sidebar_grades": return false; break; } } }); the HTML: <div id="sidebar"> <h3 id="sidebar_home"> <a href="/blah">Home</a> </h3> <div> <a href="/child">Settings</a> </div> <h3 id="sidebar_grades"> <a href="/grades">Grades</a> </h3> <div></div> <h3 id="sidebar_calendar"> <a href="/calendar">Calendar</a> </h3> <div></div> </div> In the above example, since #sidebar_grades doesn't have any child, it should not be expandable, but user can click on the link. I tried using "changestart" event and return false when #sidebar_grades is clicked, but it doesn't work. I also tried attaching onClick event to #sidebar_grades to return false, but that didn't work either. Any idea how to do this? Thank you!

    Read the article

  • How to Convert using of SqlLit to Simple SQL command in C#

    - by Nasser Hajloo
    I want to get start with DayPilot control I do not use SQLLite and this control documented based on SQLLite. I want to use SQL instead of SQL Lite so if you can, please do this for me. main site with samples http://www.daypilot.org/calendar-tutorial.html The database contains a single table with the following structure CREATE TABLE event ( id VARCHAR(50), name VARCHAR(50), eventstart DATETIME, eventend DATETIME); Loading Events private DataTable dbGetEvents(DateTime start, int days) { SQLiteDataAdapter da = new SQLiteDataAdapter("SELECT [id], [name], [eventstart], [eventend] FROM [event] WHERE NOT (([eventend] <= @start) OR ([eventstart] >= @end))", ConfigurationManager.ConnectionStrings["db"].ConnectionString); da.SelectCommand.Parameters.AddWithValue("start", start); da.SelectCommand.Parameters.AddWithValue("end", start.AddDays(days)); DataTable dt = new DataTable(); da.Fill(dt); return dt; } Update private void dbUpdateEvent(string id, DateTime start, DateTime end) { using (SQLiteConnection con = new SQLiteConnection(ConfigurationManager.ConnectionStrings["db"].ConnectionString)) { con.Open(); SQLiteCommand cmd = new SQLiteCommand("UPDATE [event] SET [eventstart] = @start, [eventend] = @end WHERE [id] = @id", con); cmd.Parameters.AddWithValue("id", id); cmd.Parameters.AddWithValue("start", start); cmd.Parameters.AddWithValue("end", end); cmd.ExecuteNonQuery(); } }

    Read the article

  • Remove the elements and contents before an element

    - by Jerry
    Hello guys I am trying to remove the elements and contents before a link inside a div when a user clicks a button. What is the best way to do it?? <div id="dialog" class="window"> //will be inserted a <select> element and few text here //but I want to clear them after the user click a button <a href="#" class="close">Close it</a> // I want to keep this <a> link. </div> My Jquery $('.model').click(function(e) { $("#dialog").empty(); //I can't use this because <a> will be deleted. Any better ideas? }); Thanks for the reply...

    Read the article

  • Python CGI on Amazon AWS EC2 micro-instance -- a how-to!

    - by user595585
    How can you make an EC2 micro instance serve CGI scripts from lighthttpd? For instance Python CGI? Well, it took half a day, but I have gotten Python cgi running on a free Amazon AWS EC2 micro-instance, using the lighttpd server. I think it will help my fellow noobs to put all the steps in one place. Armed with the simple steps below, it will take you only 15 minutes to set things up! My question for the more experienced users reading this is: Are there any security flaws in what I've done? (See file and directory permissions.) Step 1: Start your EC2 instance and ssh into it. [Obviously, you'll need to sign up for Amazon EC2 and save your key pairs to a *.pem file. I won't go over this, as Amazon tells you how to do it.] Sign into your AWS account and start your EC2 instance. The web has tutorials on doing this. Notice that default instance-size that Amazon presents to you is "small." This is not "micro" and so it will cost you money. Be sure to manually choose "micro." (Micro instances are free only for the first year...) Find the public DNS code for your running instance. To do this, click on the instance in the top pane of the dashboard and you'll eventually see the "Public DNS" field populated in the bottom pane. (You may need to fiddle a bit.) The Public DNS looks something like: ec2-174-129-110-23.compute-1.amazonaws.com Start your Unix console program. (On Max OS X, it's called Terminal, and lives in the Applications - Utilities folder.) cd to the directory on your desktop system that has your *.pem file containing your AWS keypairs. ssh to your EC2 instance using a command like: ssh -i <<your *.pem filename>> ec2-user@<< Public DNS address >> So, for me, this was: ssh -i amzn_ec2_keypair.pem [email protected] Your EC2 instance should let you in. Step 2: Download lighttpd to your EC2 instance. To install lighttpd, you will need root access on your EC2 instance. The problem is: Amazon will not let you sign in as root. (Not straightforwardly, at least.) But there is a workaround. Type this command: sudo /bin/bash The system prompt-character will change from $ to #. We won't exit from "sudo" until the very last step in this whole process. Install the lighttpd application (version 1.4.28-1.3.amzn1 for me): yum install lighttpd Install the FastCGI libraries for lighttpd (not needed, but why not?): yum install lighttpd-fastcgi Test that your server is working: /etc/init.d/lighttpd start Step 3: Let the outside world see your server. If you now tried to hit your server from the browser on your desktop, it would fail. The reason: By default, Amazon AWS does not open any ports to your EC2 instance. So, you have to open the ports manually. Go to your EC2 dashboard in your desktop's browser. Click on "Security Groups" in the left pane. One or more security groups will appear in the upper right pane. Choose the one that was assigned to your EC2 instance when you launched your instance. A table called "Allowed Connections" will appear in the lower right pane. A pop-up menu will let you choose "HTTP" as the connection method. The other values in that line of the table should be: tcp, 80, 80, 0.0.0.0/0 Now hit your EC2 instance's server from the desktop in your browser. Use the Public DNS address that you used earlier to SSH in. You should see the lighttpd generic web page. If you don't, I can't help you because I am such a noob. :-( Step 4: Configure lighttpd to serve CGI. Back in the console program, cd to the configuration directory for lighttpd: cd /etc/lighttpd To enable CGI, you want to uncomment one line in the < modules.conf file. (I could have enabled Fast CGI, but baby steps are best!) You can do this with the "ed" editor as follows: ed modules.conf /include "conf.d\/cgi.conf"/ s/#// w q Create the directory where CGI programs will live. (The /etc/lighttpd/lighttpd.conf file determines where this will be.) We'll create our directory in the default location, so we don't have to do any editing of configuration files: cd /var/www/lighttpd mkdir cgi-bin chmod 755 cgi-bin Almost there! Of course you need to put a test CGI program into the cgi-bin directory. Here is one: cd cgi-bin ed a #!/usr/bin/python print "Content-type: text/html\n\n" print "<html><body>Hello, pyworld.</body></html>" . w hellopyworld.py q chmod 655 hellopyworld.py Restart your lighttpd server: /etc/init.d/lighttpd restart Test your CGI program. In your desktop's browser, hit this URL, substituting your EC2 instance's public DNS address: http://<<Public DNS>>/cgi-bin/hellopyworld.py For me, this was: http://ec2-174-129-110-23.compute-1.amazonaws.com/cgi-bin/hellopyworld.py Step 5: That's it! Clean up, and give thanks! To exit from the "sudo /bin/bash" command given earlier, type: exit Acknowledgements: Heaps of thanks to: wiki.vpslink.com/Install_and_Configure_lighttpd www.cyberciti.biz/tips/lighttpd-howto-setup-cgi-bin-access-for-perl-programs.html aws.typepad.com/aws/2010/06/building-three-tier-architectures-with-security-groups.html Good luck, amigos! I apologize for the non-traditional nature of this "question" but I have gotten so much help from Stackoverflow that I was eager to give something back.

    Read the article

  • Incremental hot deployment on Tomcat with Maven and NetBeans

    - by deamon
    I'm using NetBeans 6.8, Tomcat 6, and Maven 2.2 and want to see changes in my code immediately in the browser (showing http://localhost:8080) after saving the file. The tomcat-maven-plugin has the following configuration: <plugin> <groupId>org.codehaus.mojo</groupId> <artifactId>tomcat-maven-plugin</artifactId> <version>1.0-beta-1</version> </plugin> Following to the output it should perform in-place deployment. What can I do to see changes in my Java code immediately in the browser?

    Read the article

  • System.IO.IOException: file used by another process

    - by Srodriguez
    Dear all, I've been working in this small piece of code that seems trivial but still i cannot really see where is the problem. My functions does a pretty simple thing. Opens a file, copy its contents, replace a string inside and copy it back to the original file (a simple search and replace inside a text file then). I didn't really know how to do that as I'm adding lines to the original file, so i just create a copy of the file, (file.temp) copy also a backup (file.temp) then delete the original file(file) and copy the file.temp to file. I get an exception while doing the delete of the file. Here is the sample code: private static bool modifyFile(FileInfo file, string extractedMethod, string modifiedMethod) { Boolean result = false; FileStream fs = new FileStream(file.FullName + ".tmp", FileMode.Create, FileAccess.Write); StreamWriter sw = new StreamWriter(fs); StreamReader streamreader = file.OpenText(); String originalPath = file.FullName; string input = streamreader.ReadToEnd(); Console.WriteLine("input : {0}", input); String tempString = input.Replace(extractedMethod, modifiedMethod); Console.WriteLine("replaced String {0}", tempString); try { sw.Write(tempString); sw.Flush(); sw.Close(); sw.Dispose(); fs.Close(); fs.Dispose(); streamreader.Close(); streamreader.Dispose(); File.Copy(originalPath, originalPath + ".old", true); FileInfo newFile = new FileInfo(originalPath + ".tmp"); File.Delete(originalPath); File.Copy(fs., originalPath, true); result = true; } catch (Exception ex) { Console.WriteLine(ex); } return result; }` And the related exception System.IO.IOException: The process cannot access the file 'E:\mypath\myFile.cs' because it is being used by another process. at System.IO.__Error.WinIOError(Int32 errorCode, String maybeFullPath) at System.IO.File.Delete(String path) at callingMethod.modifyFile(FileInfo file, String extractedMethod, String modifiedMethod) Normally these errors come from unclosed file streams, but I've taken care of that. I guess I've forgotten an important step but cannot figure out where. Thank you very much for your help,

    Read the article

  • IE9 syntax on jquery crossbrowser with jsonp and FF, Chrome

    - by Andrew Walker
    I have the following code and i have a problem in ensuring part of it is used when a IE browser is used, and remove it when any other browser is used: $.ajax({ url: 'http://mapit.mysociety.org/areas/'+ulo, type: 'GET', cache: false, crossDomain: true, dataType: 'jsonp', success: function(response) { This works fine in IE9 because I have put the dataType as jsonp. But this will not work on Chrome or FF. So I need to remove the dataType. I tried this: <!--[IF IE]> dataType: 'jsonp', <![endif]--> But it did not work. It's worth noting, it does not need the dataType set when in FF or Chrome as it's json. Whats the correct syntax to have this work ? Thanks Andrew

    Read the article

  • Insert a Script into a iFrame's Header, without clearing out the body of the iFrame

    - by nobosh
    Hello, I'm looking to add a script to an iFrame's header while not losing everything contained in the iFrame's body or header... here is what I have right now which does update the iFrame with the new script, but it cleans everything in the iframe out, not appends which is what I'd like. thxs! B // Find the iFrame var iframe = document.getElementById('hi-world'); // create a string to use as a new document object var val = '<scr' + 'ipt type="text/javascript" src="http://jqueryjs.googlecode.com/files/jquery-1.3.2.min.js"></scr' + 'ipt>'; // get a handle on the <iframe>d document (in a cross-browser way) var doc = iframe.contentWindow || iframe.contentDocument; if (doc.document) { doc = doc.document;} // open, write content to, and close the document doc.open(); doc.write(val); doc.close();

    Read the article

  • Back button loop with IFRAMES

    - by Tim Jackson
    In my (school) website we use Iframes to display class blogs (on blogger). This works well EXCEPT if the user then clicks on (say) a photo inside the iframe. Blogger (in this case) then displays the photo in the whole browser window and the back button loops; that is if the back button is hit, the browser (IE, FF, Chrome) stays on the same page. The only way out is for the user to jump back two pages (which many of our users don't know how to do). I've read a lot of posts on back buttons and iframes and there doesn't appear to be a simple solution. Bear in mind that I don't have control over the iframe content (so no embedded back buttons in the frame are possible). Ideas anyone?

    Read the article

  • python MySQLdb got invalid syntax when trying to INSERT INTO table

    - by Michelle Jun Lee
    ## COMMENT OUT below just for reference "" cursor.execute (""" CREATE TABLE yellowpages ( business_id BIGINT(20) NOT NULL AUTO_INCREMENT, categories_name VARCHAR(255), business_name VARCHAR(500) NOT NULL, business_address1 VARCHAR(500), business_city VARCHAR(255), business_state VARCHAR(255), business_zipcode VARCHAR(255), phone_number1 VARCHAR(255), website1 VARCHAR(1000), website2 VARCHAR(1000), created_date datetime, modified_date datetime, PRIMARY KEY(business_id) ) """) "" ## TOP COMMENT OUT (just for reference) ## code website1g = "http://www.triman.com" business_nameg = "Triman Sales Inc" business_address1g = "510 E Airline Way" business_cityg = "Gardena" business_stateg = "CA" business_zipcodeg = "90248" phone_number1g = "(310) 323-5410" phone_number2g = "" website2g = "" cursor.execute (""" INSERT INTO yellowpages(categories_name, business_name, business_address1, business_city, business_state, business_zipcode, phone_number1, website1, website2) VALUES ('%s','%s','%s','%s','%s','%s','%s','%s','%s') """, (''gas-stations'', business_nameg, business_address1g, business_cityg, business_stateg, business_zipcodeg, phone_number1g, website1g, website2g)) cursor.close() conn.close() I keep getting this error File "testdb.py", line 51 """, (''gas-stations'', business_nameg, business_address1g, business_cityg, business_stateg, business_zipcodeg, phone_number1g, website1g, website2g)) ^ SyntaxError: invalid syntax any idea why? By the way, the up arrow is pointing to website1g (the b character) . Thanks for the help in advance

    Read the article

< Previous Page | 438 439 440 441 442 443 444 445 446 447 448 449  | Next Page >