Search Results

Search found 37573 results on 1503 pages for 'browser close event'.

Page 442/1503 | < Previous Page | 438 439 440 441 442 443 444 445 446 447 448 449  | Next Page >

  • Get variables in c# from ajax call

    - by fzshah76
    I've got an Ajax call for log in here is the code: //if MOUSE class is clicked $('.mouse').click(function () { //get the form to submit and return a message //how to call the function var name = $('#name').val(); var pwd2 = $('#pwd2').val(); $.ajax({ type:"POST", url: "http://localhost:51870/code/Login.aspx", data: "{ 'name':'" + $('#name').val() + "', 'pwd':'" + $('#pwd2').val() + "' }", contentType: "application/json; charset=utf-8", dataType: "json", context: document.body, success: function () { //$(this).addClass("done"); $(this).hide(); $('.mouse, .window').hide(); } }); }); the problem is I can't seem to catch name and pwd variables in Login page's preinit event or page load event here is the code in c#: protected void Page_PreInit(object sender, EventArgs e) { //taking javascript argument in preinit event //from here I'll have to build the page for specific lookbook var name = Request.QueryString["name"]; var pwd = Request.QueryString["pwd"]; } protected void Page_Load(object sender, EventArgs e) { var name = Request.QueryString["name"]; var pwd = Request.QueryString["pwd"]; SignIn(name); } I can't seem to get username name and password in c# side, help is appreciated. Here is my final javascript code c# code remains the same: <script type="text/javascript"> $(document).ready(function () { //if MOUSE class is clicked $('.mouse').click(function () { var name = $('#name').val(); var pwd = $('#pwd').val(); $.ajax({ url: "http://localhost:51870/code/Login.aspx?name="+ name +"&pwd="+pwd, context: document.body, success: function () { //$(this).addClass("done"); $(this).hide(); $('.mouse, .window').hide(); } }); }); }); </script> Thanks Zachary

    Read the article

  • Ignore whitespace in HTML

    - by IP
    Is there anything in HTML/CSS that tells the browser to ignore whitespace completely? So many times when you want to put, say, two images next to each other - you try desperately to keep the HTML readable, but the browser puts a space between them. So instead of something like this: <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> you end up with this <imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /> Which is just so horrible!

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Hibernate "JOIN ... ON"?

    - by CaptainAwesomePants
    I have an application that uses Hibernate for its domain objects. One part of the app is common between a few apps, and it has no knowledge of the other systems. In order to handle relations, our class looks like this: @Entity public class SystemEvent { @Id @GeneratedValue public int entity_id; @Column(name="event_type") public String eventType; @Column(name="related_id") public int relatedObjectId; } relatedObjectId holds a foreign key to one of several different objects, depending on the type of event. When a system wants to know about events that are relevant to its interests, it grabs all the system events with eventType "NewAccounts" or some such thing, and it knows that all of those relatedObjectIds are IDs to a "User" object or similar. Unfortunately, this has caused a problem down the line. I can't figure out a way to tell Hibernate about this mapping, which means that HQL queries can't do joins. I'd really like to create an HQL query that looks like this: SELECT users FROM SystemEvent event join Users newUsers where event.eventType = 'SignUp' However, Hibernate has no knowledge of the relationship between SystemEvent and Users, and as far as I can tell, there's no way to tell it. So here's my question: Is there any way to tell Hibernate about a relationship when your domain objects reference each other via ID numbers and not class references?

    Read the article

  • Persist subclass as superclass using Hibernate

    - by franziga
    I have a subclass and a superclass. However, only the fields of the superclass are needed to be persist. session.saveOrUpdate((Superclass) subclass); If I do the above, I will get the following exception. org.hibernate.MappingException: Unknown entity: test.Superclass at org.hibernate.impl.SessionFactoryImpl.getEntityPersister(SessionFactoryImpl.java:628) at org.hibernate.impl.SessionImpl.getEntityPersister(SessionImpl.java:1366) at org.hibernate.engine.ForeignKeys.isTransient(ForeignKeys.java:203) at org.hibernate.event.def.AbstractSaveEventListener.getEntityState(AbstractSaveEventListener.java:535) at org.hibernate.event.def.DefaultSaveOrUpdateEventListener.performSaveOrUpdate(DefaultSaveOrUpdateEventListener.java:103) at org.hibernate.event.def.DefaultSaveOrUpdateEventListener.onSaveOrUpdate(DefaultSaveOrUpdateEventListener.java:93) at org.hibernate.impl.SessionImpl.fireSaveOrUpdate(SessionImpl.java:535) at org.hibernate.impl.SessionImpl.saveOrUpdate(SessionImpl.java:527) at org.hibernate.impl.SessionImpl.saveOrUpdate(SessionImpl.java:523) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.hibernate.context.ThreadLocalSessionContext$TransactionProtectionWrapper.invoke(ThreadLocalSessionContext.java:342) at $Proxy54.saveOrUpdate(Unknown Source) How can I persist a subclass as a superclass? I do not prefer creating a superclass instance and then passing the values from the subclass instance. Because, it is easy to forget updating the logic if extra fields are added to superclass in the future.

    Read the article

  • AutoCompleteTextView displays 'android.database.sqlite.SQLiteCursor@'... after making selection

    - by user244190
    I am using the following code to set the adapter (SimpleCursorAdapter) for an AutoCompleteTextView mComment = (AutoCompleteTextView) findViewById(R.id.comment); Cursor cComments = myAdapter.getDistinctComments(); scaComments = new SimpleCursorAdapter(this,R.layout.auto_complete_item,cComments,new String[] {DBAdapter.KEY_LOG_COMMENT},new int[]{R.id.text1}); mComment.setAdapter(scaComments); auto_complete_item.xml <?xml version="1.0" encoding="utf-8"?> <TextView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/text1" android:layout_width="wrap_content" android:layout_height="wrap_content"/> and thi is the xml for the actual control <AutoCompleteTextView android:id="@+id/comment" android:hint="@string/COMMENT" android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="18dp"/> The dropdown appears to work correctly, and shows a list of items. When I make a selection from the list I get a sqlite object ('android.database.sqlite.SQLiteCursor@'... ) in the textview. Anyone know what would cause this, or how to resolve this? thanks Ok I am able to hook into the OnItemClick event, but the TextView.setText() portion of the AutoCompleteTextView widget is updated after this point. The OnItemSelected() event never gets fired, and the onNothingSelected() event gets fired when the dropdown items are first displayed. mComment.setOnItemClickListener( new OnItemClickListener() { @Override public void onItemClick(AdapterView<?> arg0, View arg1, int arg2, long arg3) { // TODO Auto-generated method stub SimpleCursorAdapter sca = (SimpleCursorAdapter) arg0.getAdapter(); String str = getSpinnerSelectedValue(sca,arg2,"comment"); TextView txt = (TextView) arg1; txt.setText(str); Toast.makeText(ctx, "onItemClick", Toast.LENGTH_SHORT).show(); } }); mComment.setOnItemSelectedListener(new OnItemSelectedListener() { @Override public void onItemSelected(AdapterView<?> arg0, View arg1, int arg2, long arg3) { Toast.makeText(ctx, "onItemSelected", Toast.LENGTH_SHORT).show(); } @Override public void onNothingSelected(AdapterView<?> arg0) { // TODO Auto-generated method stub Toast.makeText(ctx, "onNothingSelected", Toast.LENGTH_SHORT).show(); } }); Anyone alse have any ideas on how to override the updating of the TextView? thanks patrick

    Read the article

  • html widget communicating with server

    - by Nikita Rybak
    I'm making html widget for websites. Let's say, it will display current stock indexes. In short, arbitrary website owner takes code snippet from me and includes it on his webpage http://website.com/index.html. When arbitrary user opens http://website.com/index.html, my code sends request to my server (provider.com), which performs necessary operations and returns information to user's browser. When response has arrived, user will see relevant stock value on http://website.com/index.html. In index.html service could be called like this <script type="text/javascript" src="provider.com/service.js"> </script> <div id="target_area"></div> <script type="text/javascript"> service.show("target_area", options); </script> Now, the problem is in the same origin policy: I can't just send ajax request from website.com to provided.com and return html to embed in client's webpage. I see several solutions, which I list below, but none quite satisfy me. I wonder, if you could suggest something, especially if you had some relevant experience. 1) iframe, plain and simple. Disadvantage: must have fixed dimensions + stupid scroll bars appearing in some browsers. Can be fixed with javascript, but all this browser-specific tinkering doesn't sound good to me. 2) JSONP. Problem: can't return whole chunk of html, must return only data. Then, on browser side, I'll have to use javascript to embed data into html snippet placed statically in index.html. Doesn't sound nice, because data format is not very simple and may even change later. 3) Use hidden iframe to do ajax requests. A bit tricky, but sounds like a way to go. Well, that's my thoughts on the subject. Are there any better ways? BTW, I tried to check some existing widgets too, but didn't find much useful information. All domain names used in this text are fictional and any resemblance is purely coincidental :)

    Read the article

  • PhantomJS not exactly rendering HTML to PNG

    - by John Leonard
    I'm having trouble adjusting PhantomJS to create a PNG file that matches the original browser presentation. Here is the entire sample html file. It's a sankey diagram creating using rCharts and d3-sankey. (You'll need to save the file to your hard drive and view it from there.) I'm running on Windows and using rasterize.js: >> phantomjs.exe rasterize.js test.html test.png ISSUE: Below is a snip of one of the text strings when viewed in a browser: And here is a snip of the same string from the PNG created by PhantomJS: How do I make the text-shadow go away? I've played around with various CSS attributes (text-shadow) and webkit-specific attributes (e.g., -webkit-text-rendering), but can't seem to make it go away. Is this a setting in PhantomJS? in the underlying webkit? or somewhere else? Many thanks!

    Read the article

  • Javascript/CSS rollover menus are patented and subject to licensing?

    - by Scott B
    Very interesting finding that a client brought to my attention today regarding javascript style rollover menus. They got a call from their legal dept that they need to change the manner in which their rollover menu is activated (at the risk of having to pay license to continue using the navigation technique). Its no April fools joke, apparently this is really happening. Apparently a company named Webvention LLC has obtained enforcement rights to a patent, U.S. Patent No. 5,251,294 - "Accessing, assembling, and using bodies of Information." A menu link, that when rolled over, expands to show a list of categorized, related links. Dropdown menus and slide-out menus are examples of this patented navigational methodology. A key component of this patent is that the dropdown/slide-out action must be initiated by a rollover or mouseover event. If the dropdown/slide-out action is initiated by any other event, such as a mouse-click event, then this behavior is not in violation of the patent. Anyone ever heard of this or know of the validity of its claims? Website is here: http://www.webventionllc.com/

    Read the article

  • Understanding try..catch in Javascript

    - by user295189
    I have this try and catch problem. I am trying to redirect to a different page. But sometimes it does and some times it doesnt. I think the problem is in try and catch . can someone help me understand this. Thanks var pg = new Object(); var da = document.all; var wo = window.opener; pg.changeHideReasonID = function(){ if(pg.hideReasonID.value == 0 && pg.hideReasonID.selectedIndex > 0){ pg.otherReason.style.backgroundColor = "ffffff"; pg.otherReason.disabled = 0; pg.otherReason.focus(); } else { pg.otherReason.style.backgroundColor = "f5f5f5"; pg.otherReason.disabled = 1; } } pg.exit = function(pid){ try { if(window.opener.hideRecordReload){ window.opener.hideRecordReload(pg.recordID, pg.recordTypeID); } else { window.opener.pg.hideRecord(pg.recordID, pg.recordTypeID); } } catch(e) {} try { window.opener.pg.hideEncounter(pg.recordID); } catch(e) {} try { window.opener.pg.hideRecordResponse(pg.hideReasonID.value == 0 ? pg.otherReason.value : pg.hideReasonID.options[pg.hideReasonID.selectedIndex].text); } catch(e) {} try { window.opener.pg.hideRecord_Response(pg.recordID, pg.recordTypeID); } catch(e) {} try { window.opener.pg.hideRecord_Response(pg.recordID, pg.recordTypeID); } catch(e) {} try { window.opener.window.parent.frames[1].pg.loadQualityMeasureRequest(); } catch(e) {} try { window.opener.pg.closeWindow(); } catch(e) {} parent.loadCenter2({reportName:'redirectedpage',patientID:pid}); parent.$.fancybox.close(); } pg.hideRecord = function(){ var pid = this.pid; pg.otherReason.value = pg.otherReason.value.trim(); if(pg.hideReasonID.selectedIndex == 0){ alert("You have not indicated your reason for hiding this record."); pg.hideReasonID.focus(); } else if(pg.hideReasonID.value == 0 && pg.hideReasonID.selectedIndex > 0 && pg.otherReason.value.length < 2){ alert("You have indicated that you wish to enter a reason\nnot on the list, but you have not entered a reason."); pg.otherReason.focus(); } else { pg.workin(1); var n = new Object(); n.noheaders = 1; n.recordID = pg.recordID; n.recordType = pg.recordType; n.recordTypeID = pg.recordTypeID; n.encounterID = request.encounterID; n.hideReasonID = pg.hideReasonID.value; n.hideReason = pg.hideReasonID.value == 0 ? pg.otherReason.value : pg.hideReasonID.options[pg.hideReasonID.selectedIndex].text; Connect.Ajax.Post("/emr/hideRecord/act_hideRecord.php", n, pg.exit(pid)); } } pg.init = function(){ pg.blocker = da.blocker; pg.hourglass = da.hourglass; pg.content = da.pageContent; pg.recordType = da.recordType.value; pg.recordID = parseInt(da.recordID.value); pg.recordTypeID = parseInt(da.recordTypeID.value); pg.information = da.information; pg.hideReasonID = da.hideReasonID; pg.hideReasonID.onchange = pg.changeHideReasonID; pg.hideReasonID.tabIndex = 1; pg.otherReason = da.otherReason; pg.otherReason.tabIndex = 2; pg.otherReason.onblur = function(){ this.value = this.value.trim(); } pg.otherReason.onfocus = function(){ this.select(); } pg.btnCancel = da.btnCancel; pg.btnCancel.tabIndex = 4; pg.btnCancel.title = "Close this window"; pg.btnCancel.onclick = function(){ //window.close(); parent.$.fancybox.close(); } pg.btnHide = da.btnHide; pg.btnHide.tabIndex = 3; pg.btnHide.onclick = pg.hideRecord; pg.btnHide.title = "Hide " + pg.recordType.toLowerCase() + " record"; document.body.onselectstart = function(){ if(event.srcElement.tagName.search(/INPUT|TEXT/i)){ return false; } } pg.workin(0); } pg.workin = function(){ var n = arguments.length ? arguments[0] : 1; pg.content.disabled = pg.hideReasonID.disabled = n; pg.blocker.style.display = pg.hourglass.style.display = n ? "block" : "none"; if(n){ pg.otherReason.disabled = 1; pg.otherReason.style.backgroundColor = "f5f5f5"; } else { pg.otherReason.disabled = !(pg.hideReasonID.value == 0 && pg.hideReasonID.selectedIndex > 0); pg.otherReason.style.backgroundColor = pg.otherReason.disabled ? "f5f5f5" : "ffffff"; pg.hideReasonID.focus(); } }

    Read the article

  • How do I position an element so that it acts like both 'absolutely' & 'relatively' positioned at the same time? - CSS

    - by marcamillion
    You can see the implementation here: http://jsfiddle.net/BMWZd/25/ When you click on one of the names in Box#1, you will see the circle in the top left corner of the box move up and down. How do I stop that? While also, making sure that it shows in the top left corner of each of the boxes on all browser sizes? So position:absolute will keep it in one place regardless of what happens around it. But it won't put it in the exact same position (relatively) on diff browser sizes. But position:relative will. How do I get the best of both worlds?

    Read the article

  • Prevent Jquery Accordion tab from expanding

    - by Edwin
    I'm trying to use JQuery UI Accordion as a menu, but I can't figure out how to prevent some tabs from expanding. My JS: $("#sidebar").accordion({ collapsible: true, changestart: function(event, ui) { switch ($(ui.newHeader).attr("id")) { case "sidebar_grades": return false; break; } } }); the HTML: <div id="sidebar"> <h3 id="sidebar_home"> <a href="/blah">Home</a> </h3> <div> <a href="/child">Settings</a> </div> <h3 id="sidebar_grades"> <a href="/grades">Grades</a> </h3> <div></div> <h3 id="sidebar_calendar"> <a href="/calendar">Calendar</a> </h3> <div></div> </div> In the above example, since #sidebar_grades doesn't have any child, it should not be expandable, but user can click on the link. I tried using "changestart" event and return false when #sidebar_grades is clicked, but it doesn't work. I also tried attaching onClick event to #sidebar_grades to return false, but that didn't work either. Any idea how to do this? Thank you!

    Read the article

  • Accessing XUL anonymous content using C++

    - by Vaibhav Gade
    Hi All, I am writing Firefox extension using C++. I am trying to access XUL:tabox element in "TabOpen" event handler, but I am unable access any XUL element. I am putting here pseudocode of my extension for reference: HandleEvent() { if (event type is TabOpen) { nsCOMPtr<nsIDOMNode> OriginalNode = do_QueryInterface(event->GetTarget); nsCOMPtr<nsIDOMNodeList> childlist; // // Note here that I got OriginalNode's local name as "tabbrowser" // OriginalNode->GetChildNodes(getter_AddRefs(childlist)); PRUint32 len; childlist->GetLength(&len); // Return 1; consider only "popup" child element. nsString localName; nsCOMPtr<nsIDOMNode> node1; childlist->Item(0, getter_AddRefs(node1)); node1->GetLocalName(localName); // Returns "popup" as the local name. } } By traversing the DOM tree through DOM Inspector, I came to know that XUL elements are anonymous content. How do I access these XUL elements? Very Thanks in advance, Vaibhav.

    Read the article

  • How to Convert using of SqlLit to Simple SQL command in C#

    - by Nasser Hajloo
    I want to get start with DayPilot control I do not use SQLLite and this control documented based on SQLLite. I want to use SQL instead of SQL Lite so if you can, please do this for me. main site with samples http://www.daypilot.org/calendar-tutorial.html The database contains a single table with the following structure CREATE TABLE event ( id VARCHAR(50), name VARCHAR(50), eventstart DATETIME, eventend DATETIME); Loading Events private DataTable dbGetEvents(DateTime start, int days) { SQLiteDataAdapter da = new SQLiteDataAdapter("SELECT [id], [name], [eventstart], [eventend] FROM [event] WHERE NOT (([eventend] <= @start) OR ([eventstart] >= @end))", ConfigurationManager.ConnectionStrings["db"].ConnectionString); da.SelectCommand.Parameters.AddWithValue("start", start); da.SelectCommand.Parameters.AddWithValue("end", start.AddDays(days)); DataTable dt = new DataTable(); da.Fill(dt); return dt; } Update private void dbUpdateEvent(string id, DateTime start, DateTime end) { using (SQLiteConnection con = new SQLiteConnection(ConfigurationManager.ConnectionStrings["db"].ConnectionString)) { con.Open(); SQLiteCommand cmd = new SQLiteCommand("UPDATE [event] SET [eventstart] = @start, [eventend] = @end WHERE [id] = @id", con); cmd.Parameters.AddWithValue("id", id); cmd.Parameters.AddWithValue("start", start); cmd.Parameters.AddWithValue("end", end); cmd.ExecuteNonQuery(); } }

    Read the article

  • System.IO.IOException: file used by another process

    - by Srodriguez
    Dear all, I've been working in this small piece of code that seems trivial but still i cannot really see where is the problem. My functions does a pretty simple thing. Opens a file, copy its contents, replace a string inside and copy it back to the original file (a simple search and replace inside a text file then). I didn't really know how to do that as I'm adding lines to the original file, so i just create a copy of the file, (file.temp) copy also a backup (file.temp) then delete the original file(file) and copy the file.temp to file. I get an exception while doing the delete of the file. Here is the sample code: private static bool modifyFile(FileInfo file, string extractedMethod, string modifiedMethod) { Boolean result = false; FileStream fs = new FileStream(file.FullName + ".tmp", FileMode.Create, FileAccess.Write); StreamWriter sw = new StreamWriter(fs); StreamReader streamreader = file.OpenText(); String originalPath = file.FullName; string input = streamreader.ReadToEnd(); Console.WriteLine("input : {0}", input); String tempString = input.Replace(extractedMethod, modifiedMethod); Console.WriteLine("replaced String {0}", tempString); try { sw.Write(tempString); sw.Flush(); sw.Close(); sw.Dispose(); fs.Close(); fs.Dispose(); streamreader.Close(); streamreader.Dispose(); File.Copy(originalPath, originalPath + ".old", true); FileInfo newFile = new FileInfo(originalPath + ".tmp"); File.Delete(originalPath); File.Copy(fs., originalPath, true); result = true; } catch (Exception ex) { Console.WriteLine(ex); } return result; }` And the related exception System.IO.IOException: The process cannot access the file 'E:\mypath\myFile.cs' because it is being used by another process. at System.IO.__Error.WinIOError(Int32 errorCode, String maybeFullPath) at System.IO.File.Delete(String path) at callingMethod.modifyFile(FileInfo file, String extractedMethod, String modifiedMethod) Normally these errors come from unclosed file streams, but I've taken care of that. I guess I've forgotten an important step but cannot figure out where. Thank you very much for your help,

    Read the article

  • jQueryUI Ajax.NET Postback Bug

    - by nigative
    Hi, I have this ASP.NET page with ASP.NET UpdatePanel and jQueryUI droppable and sortable components. The page works fine in all browsers, but doesn't in Internet Explorer (IE8 tested). After I try to call ASP.NET AJAX event (by pressing my asp.net button inside the UpdatePanel) my sortable list stops working properly inside IE browser and the browser throws the following error: Message: Unspecified error. Line: 145 Char: 186 Code: 0 URI: http://code.jquery.com/jquery-1.4.2.min.js I found out that the problem is caused by the code on line 66: $("#droppable").droppable(); If I comment it out, the sortable list works fine after ajax postbacks. But it doesn't make sense. Does anyone know what could be wrong? Thanks. P.S. I am using jQueryUI 1.8.1 and jQuery 1.4.2

    Read the article

  • Incremental hot deployment on Tomcat with Maven and NetBeans

    - by deamon
    I'm using NetBeans 6.8, Tomcat 6, and Maven 2.2 and want to see changes in my code immediately in the browser (showing http://localhost:8080) after saving the file. The tomcat-maven-plugin has the following configuration: <plugin> <groupId>org.codehaus.mojo</groupId> <artifactId>tomcat-maven-plugin</artifactId> <version>1.0-beta-1</version> </plugin> Following to the output it should perform in-place deployment. What can I do to see changes in my Java code immediately in the browser?

    Read the article

  • python MySQLdb got invalid syntax when trying to INSERT INTO table

    - by Michelle Jun Lee
    ## COMMENT OUT below just for reference "" cursor.execute (""" CREATE TABLE yellowpages ( business_id BIGINT(20) NOT NULL AUTO_INCREMENT, categories_name VARCHAR(255), business_name VARCHAR(500) NOT NULL, business_address1 VARCHAR(500), business_city VARCHAR(255), business_state VARCHAR(255), business_zipcode VARCHAR(255), phone_number1 VARCHAR(255), website1 VARCHAR(1000), website2 VARCHAR(1000), created_date datetime, modified_date datetime, PRIMARY KEY(business_id) ) """) "" ## TOP COMMENT OUT (just for reference) ## code website1g = "http://www.triman.com" business_nameg = "Triman Sales Inc" business_address1g = "510 E Airline Way" business_cityg = "Gardena" business_stateg = "CA" business_zipcodeg = "90248" phone_number1g = "(310) 323-5410" phone_number2g = "" website2g = "" cursor.execute (""" INSERT INTO yellowpages(categories_name, business_name, business_address1, business_city, business_state, business_zipcode, phone_number1, website1, website2) VALUES ('%s','%s','%s','%s','%s','%s','%s','%s','%s') """, (''gas-stations'', business_nameg, business_address1g, business_cityg, business_stateg, business_zipcodeg, phone_number1g, website1g, website2g)) cursor.close() conn.close() I keep getting this error File "testdb.py", line 51 """, (''gas-stations'', business_nameg, business_address1g, business_cityg, business_stateg, business_zipcodeg, phone_number1g, website1g, website2g)) ^ SyntaxError: invalid syntax any idea why? By the way, the up arrow is pointing to website1g (the b character) . Thanks for the help in advance

    Read the article

  • Back button loop with IFRAMES

    - by Tim Jackson
    In my (school) website we use Iframes to display class blogs (on blogger). This works well EXCEPT if the user then clicks on (say) a photo inside the iframe. Blogger (in this case) then displays the photo in the whole browser window and the back button loops; that is if the back button is hit, the browser (IE, FF, Chrome) stays on the same page. The only way out is for the user to jump back two pages (which many of our users don't know how to do). I've read a lot of posts on back buttons and iframes and there doesn't appear to be a simple solution. Bear in mind that I don't have control over the iframe content (so no embedded back buttons in the frame are possible). Ideas anyone?

    Read the article

  • IXmlSerializable Dictionary problem

    - by Shimmy
    I was trying to create a generic Dictionary that implements IXmlSerializable. Here is my trial: Sub Main() Dim z As New SerializableDictionary(Of String, String) z.Add("asdf", "asd") Console.WriteLine(z.Serialize) End Sub Result: <?xml version="1.0" encoding="utf-16"?><Entry key="asdf" value="asd" /> I placed a breakpoint on top of the WriteXml method and I see that when it stops, the writer contains no data at all, and IMHO it should contain the root element and the xml declaration. <Serializable()> _ Public Class SerializableDictionary(Of TKey, TValue) : Inherits Dictionary(Of TKey, TValue) : Implements IXmlSerializable Private Const EntryString As String = "Entry" Private Const KeyString As String = "key" Private Const ValueString As String = "value" Private Shared ReadOnly AttributableTypes As Type() = New Type() {GetType(Boolean), GetType(Byte), GetType(Char), GetType(DateTime), GetType(Decimal), GetType(Double), GetType([Enum]), GetType(Guid), GetType(Int16), GetType(Int32), GetType(Int64), GetType(SByte), GetType(Single), GetType(String), GetType(TimeSpan), GetType(UInt16), GetType(UInt32), GetType(UInt64)} Private Shared ReadOnly GetIsAttributable As Predicate(Of Type) = Function(t) AttributableTypes.Contains(t) Private Shared ReadOnly IsKeyAttributable As Boolean = GetIsAttributable(GetType(TKey)) Private Shared ReadOnly IsValueAttributable As Boolean = GetIsAttributable(GetType(TValue)) Private Shared ReadOnly GetElementName As Func(Of Boolean, String) = Function(isKey) If(isKey, KeyString, ValueString) Public Function GetSchema() As System.Xml.Schema.XmlSchema Implements System.Xml.Serialization.IXmlSerializable.GetSchema Return Nothing End Function Public Sub WriteXml(ByVal writer As XmlWriter) Implements IXmlSerializable.WriteXml For Each entry In Me writer.WriteStartElement(EntryString) WriteData(IsKeyAttributable, writer, True, entry.Key) WriteData(IsValueAttributable, writer, False, entry.Value) writer.WriteEndElement() Next End Sub Private Sub WriteData(Of T)(ByVal attributable As Boolean, ByVal writer As XmlWriter, ByVal isKey As Boolean, ByVal value As T) Dim name = GetElementName(isKey) If attributable Then writer.WriteAttributeString(name, value.ToString) Else Dim serializer As New XmlSerializer(GetType(T)) writer.WriteStartElement(name) serializer.Serialize(writer, value) writer.WriteEndElement() End If End Sub Public Sub ReadXml(ByVal reader As XmlReader) Implements IXmlSerializable.ReadXml Dim empty = reader.IsEmptyElement reader.Read() If empty Then Exit Sub Clear() While reader.NodeType <> XmlNodeType.EndElement While reader.NodeType = XmlNodeType.Whitespace reader.Read() Dim key = ReadData(Of TKey)(IsKeyAttributable, reader, True) Dim value = ReadData(Of TValue)(IsValueAttributable, reader, False) Add(key, value) If Not IsKeyAttributable AndAlso Not IsValueAttributable Then reader.ReadEndElement() Else reader.Read() While reader.NodeType = XmlNodeType.Whitespace reader.Read() End While End While reader.ReadEndElement() End While End Sub Private Function ReadData(Of T)(ByVal attributable As Boolean, ByVal reader As XmlReader, ByVal isKey As Boolean) As T Dim name = GetElementName(isKey) Dim type = GetType(T) If attributable Then Return Convert.ChangeType(reader.GetAttribute(name), type) Else Dim serializer As New XmlSerializer(type) While reader.Name <> name reader.Read() End While reader.ReadStartElement(name) Dim value = serializer.Deserialize(reader) reader.ReadEndElement() Return value End If End Function Public Shared Function Serialize(ByVal dictionary As SerializableDictionary(Of TKey, TValue)) As String Dim sb As New StringBuilder(1024) Dim sw As New StringWriter(sb) Dim xs As New XmlSerializer(GetType(SerializableDictionary(Of TKey, TValue))) xs.Serialize(sw, dictionary) sw.Dispose() Return sb.ToString End Function Public Shared Function Deserialize(ByVal xml As String) As SerializableDictionary(Of TKey, TValue) Dim xs As New XmlSerializer(GetType(SerializableDictionary(Of TKey, TValue))) Dim xr As New XmlTextReader(xml, XmlNodeType.Document, Nothing) Return xs.Deserialize(xr) xr.Close() End Function Public Function Serialize() As String Dim sb As New StringBuilder Dim xw = XmlWriter.Create(sb) WriteXml(xw) xw.Close() Return sb.ToString End Function Public Sub Parse(ByVal xml As String) Dim xr As New XmlTextReader(xml, XmlNodeType.Document, Nothing) ReadXml(xr) xr.Close() End Sub End Class

    Read the article

  • silverlight 3.0 communication with winforms

    - by abusemind
    I would like to create a winform on the client side for interaction with Silverlight 3.0. The basic idea is using the winform browser. I definitely need both the directions of communication. Would it be impossible by using JavaScript as a midware for the interaction or some better ways? Or is there any new features of Silverlight 3.0 supported for this kind of winform application communication? The original one is one the client's browser to run but now I would like to migrate it to the winform application. For the sake of time-saving, please don't mention about the WPF because of the gap between WPF and the Silverlight.

    Read the article

  • Javascript Onclick Problem with Table Rows

    - by Shane Larson
    Hello. I am having problems with my JScript code. I am trying to loop through all of the rows in a table and add an onclick event. I can get the onclick event to add but have a couple of problems. The first problem is that all rows end up getting set up with the wrong parameter for the onclick event. The second problem is that it only works in IE. Here is the code excerpt... shanesObj.addTableEvents = function(){ table = document.getElementById("trackerTable"); for(i=1; i<table.getElementsByTagName("tr").length; i++){ row = table.getElementsByTagName("tr")[i]; orderID = row.getAttributeNode("id").value; alert("before onclick: " + orderID); row.onclick=function(){shanesObj.tableRowEvent(orderID);}; }} shanesObj.tableRowEvent = function(orderID){ alert(orderID);} The table is located at the following location... http://www.blackcanyonsoftware.com/OrderTracker/testAJAX.html The id's of each row in sequence are... 95, 96, 94... For some reason, when shanesObj.tableRowEvent is called, the onclick is set up for all rows with the last value id that went through iteration on the loop (94). I added some alerts to the page to illustrate the problem. Thanks. Shane

    Read the article

  • PreparedStatement

    - by Steel Plume
    Hello, in the case of using PreparedStatement with a single common connection without any pool, can I recreate an instance for every dml/sql operation mantaining the power of prepared statements? I mean: for (int i=0; i<1000; i++) { PreparedStatement preparedStatement = connection.prepareStatement(sql); preparedStatement.setObject(1, someValue); preparedStatement.executeQuery(); preparedStatement.close(); } instead of: PreparedStatement preparedStatement = connection.prepareStatement(sql); for (int i=0; i<1000; i++) { preparedStatement.clearParameters(); preparedStatement.setObject(1, someValue); preparedStatement.executeQuery(); } preparedStatement.close(); my question arises by the fact that I want to put this code into a multithreaded environment, can you give me some advice? thanks

    Read the article

< Previous Page | 438 439 440 441 442 443 444 445 446 447 448 449  | Next Page >