Search Results

Search found 11748 results on 470 pages for 'webclient download'.

Page 443/470 | < Previous Page | 439 440 441 442 443 444 445 446 447 448 449 450  | Next Page >

  • usercontrol hosted in IE renders as a textbox

    - by coxymla
    On my ongoing saga to mirror the hosting of a legacy app on a clean box, I've hit my next snag. One page relies on a big .NET UserControl that on the new machine renders only as a big, greyed out textarea (greyed out vertical scrollbar on the right hand edge. Inspecting the source shows the expected object tag.) This is particularly tricky because nobody seems to know much about hosted UserControls and all the discussions data back to 2002-2004. The page is quite simple: <%@ Page language="c#" Codebehind="DataExport.aspx.cs" AutoEventWireup="false" Inherits="yyyyy.Web.DataExport" %> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN" > <html> <head> <title>DataExport</title> <link rel="Configuration" href="/xxxxx/yyyyy/DataExport.config"> </head> <body style="margin:0px;padding:0px;overflow:hidden"> <OBJECT id="DataExport" style="WIDTH: 100%; HEIGHT: 100%; position:absolute; left: 0px; top:0px" classid="yyyyy.Common.dll#yyyyy.Controls.DataExport" VIEWASTEXT> </OBJECT> </body> </html> The config file referenced: <?xml version="1.0" encoding="utf-8" ?> <configuration> <configSections> <sectionGroup name="yyyyy"> <section name="dataExport" type="yyyyy.Controls.DataExportSectionHandler,yyyyy.Common" /> </sectionGroup> </configSections> <yyyyy> <dataExport> <layoutFile>http://vm2/xxxxx/yyyyy/layout.xml</layoutFile> <webServiceUrl>http://vm2/xxxxx/yyyyy/services/yyyyy.asmx</webServiceUrl> </dataExport> </yyyyy> </configuration> What I've checked: Security permissions should be OK, the site is trusted and adding a URL exception to grant FullTrust doesn't change anything. Config file is acessible over the web, layout.xml is accessible, ASMX shows the expected command list Machine.config grants GET permission for the usercontrol.config file. What perhaps looks fishy to me: The DataExport UserControl references Aspose.Excel to generate the spreadsheets it exports. When I navigate to the page and get a blank textbox, then run gacutil /ldl, nothing is in the local download cache. On the working machine, running the same command after viewing the page shows a laundry list of DLLs including the control DLL and the Aspose DLL.

    Read the article

  • How to remove music/videos DRM protection and convert to Mobile Devices such as iPod, iPhone, PSP, Z

    - by tonywesley
    The music/video files you purchased from online music stores like iTunes, Yahoo Music or Wal-Mart are under DRM protection. So you can't convert them to the formats supported by your own mobile devices such as Nokia phone, Creative Zen palyer, iPod, PSP, Walkman, Zune… You also can't share your purchased music/videos with your friends. The following step by step tutorial is dedicated to instructing music lovers to how to convert your DRM protected music/videos to mobile devices. Method 1: If you only want to remove DRM protection from your protected music, this method will not spend your money. Step 1: Burn your protected music files to CD-R/RW disc to make an audio CD Step 2: Find a free CD Ripper software to convert the audio CD track back to MP3, WAV, WMA, M4A, AAC, RA… Method 2: This guide will show you how to crack drm from protected wmv, wma, m4p, m4v, m4a, aac files and convert to unprotected WMV, MP4, MP3, WMA or any video and audio formats you like, such as AVI, MP4, Flv, MPEG, MOV, 3GP, m4a, aac, wmv, ogg, wav... I have been using Media Converter software, it is the quickest and easiest solution to remove drm from WMV, M4V, M4P, WMA, M4A, AAC, M4B, AA files by quick recording. It gets audio and video stream at the bottom of operating system, so the output quality is lossless and the conversion speed is fast . The process is as follows. Step 1: Download and install the software Step 2: Run the software and click "Add…" button to load WMA or M4A, M4B, AAC, WMV, M4P, M4V, ASF files Step 3: Choose output formats. If you want to convert protected audio files, please select "Convert audio to" list; If you want to convert protected video files, please select "Convert video to" list. Step 4: You can click "Settings" button to custom preference for output files. Click "Settings" button bellow "Convert audio to" list for protected audio files Click "Settings" button bellow "Convert video to" list for protected video files Step 5: Start remove DRM and convert your DRM protected music and videos by click on "Start" button. What is DRM? DRM, which is most commonly found in movies and music files, doesn't mean just basic copy-protection of video, audio and ebooks, but it basically means full protection for digital content, ranging from delivery to end user's ways to use the content. We can remove the Drm from video and audio files legally by quick recording.

    Read the article

  • How to use Crtl in a Delphi unit in a C++Builder project? (or link to C++Builder C runtime library)

    - by Craig Peterson
    I have a Delphi unit that is statically linking a C .obj file using the {$L xxx} directive. The C file is compiled with C++Builder's command line compiler. To satisfy the C file's runtime library dependencies (_assert, memmove, etc), I'm including the crtl unit Allen Bauer mentioned here. unit FooWrapper; interface implementation uses Crtl; // Part of the Delphi RTL {$L FooLib.obj} // Compiled with "bcc32 -q -c foolib.c" procedure Foo; cdecl; external; end. If I compile that unit in a Delphi project (.dproj) everthing works correctly. If I compile that unit in a C++Builder project (.cbproj) it fails with the error: [ILINK32 Error] Fatal: Unable to open file 'CRTL.OBJ' And indeed, there isn't a crtl.obj file in the RAD Studio install folder. There is a .dcu, but no .pas. Trying to add crtdbg to the uses clause (the C header where _assert is defined) gives an error that it can't find crtdbg.dcu. If I remove the uses clause, it instead fails with errors that __assert and _memmove aren't found. So, in a Delphi unit in a C++Builder project, how can I export functions from the C runtime library so they're available for linking? I'm already aware of Rudy Velthuis's article. I'd like to avoid manually writing Delphi wrappers if possible, since I don't need them in Delphi, and C++Builder must already include the necessary functions. Edit For anyone who wants to play along at home, the code is available in Abbrevia's Subversion repository at https://tpabbrevia.svn.sourceforge.net/svnroot/tpabbrevia/trunk. I've taken David Heffernan's advice and added a "AbCrtl.pas" unit that mimics crtl.dcu when compiled in C++Builder. That got the PPMd support working, but the Lzma and WavPack libraries both fail with link errors: [ILINK32 Error] Error: Unresolved external '_beginthreadex' referenced from ABLZMA.OBJ [ILINK32 Error] Error: Unresolved external 'sprintf' referenced from ABWAVPACK.OBJ [ILINK32 Error] Error: Unresolved external 'strncmp' referenced from ABWAVPACK.OBJ [ILINK32 Error] Error: Unresolved external '_ftol' referenced from ABWAVPACK.OBJ AFAICT, all of them are declared correctly, and the _beginthreadex one is actually declared in AbLzma.pas, so it's used by the pure Delphi compile as well. To see it yourself, just download the trunk (or just the "source" and "packages" directories), disable the {$IFDEF BCB} block at the bottom of AbDefine.inc, and try to compile the C++Builder "Abbrevia.cbproj" project.

    Read the article

  • SQLite bulk insert on iPhone not working

    - by App_beginner
    Hi. I have been struggling with this seeminly easy problem for 48 hours, and I am no closer to a solution. So I was hoping that someone might be able to help me. I am building a app, that use a combination of a local (SQLite) database and an online database (PHP/MYSQL). The app is nearly finished. Checked for leaks and work like a charm. However the very last part is the part I have struggled with. On launch, I want the app to check for changes to the online databse, and if there is. I want it to download and parse a xml file containing the changes. Everything is working fine this far. But when I try to bulk insert my parsed data to my database, the app crashes, giving a NSInternalInconsistency error. Due to the database returning SQLITE_MISUSE. I have done a lot of googling, but am still unable to solve my problem. So I am putting the code here, hoping that someone can help me fix this. And I know that I should have used core data for this. But this is the very last part I am struggling with, and I am very reluctant to changing my entire code now. Core data will have to come in the update. Here is the error I recieve: Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: 'Error while inserting data. 'library routine called out of sequence'' Here is my code: -(void)UpdateDatabase:(const char *)_query NewValues:(NSMutableArray *)_odb dbn:(NSString *)_dbn dbp:(NSString *)_dbp { sqlite3 *database; NSMutableArray *NewValues = _odb; int i; const char *query = _query; sqlite3_stmt *addStmt; for (i = 1; i < [NewValues count]; i++) { if(sqlite3_prepare_v2(database, query, -1, &addStmt, NULL) == SQLITE_OK) { sqlite3_bind_text(addStmt, 1, [[[NewValues objectAtIndex:i] name] UTF8String], -1, SQLITE_TRANSIENT); sqlite3_bind_text(addStmt, 2, [[[NewValues objectAtIndex:i] city]UTF8String], -1, SQLITE_TRANSIENT); sqlite3_bind_double(addStmt, 3, [[[NewValues objectAtIndex:i] lat] doubleValue]); sqlite3_bind_int(addStmt, 4, [[[NewValues objectAtIndex:i] long] doubleValue]); sqlite3_bind_int(addStmt, 5, [[[NewValues objectAtIndex:i] code] intValue]); } if(SQLITE_DONE != sqlite3_step(addStmt)) { NSAssert1(0, @"Error while inserting data. '%s'", sqlite3_errmsg(database)); } //Reset the add statement. sqlite3_reset(addStmt); } }

    Read the article

  • Instagram API and Zend/Loader.php

    - by Jaemin Kim
    I want to use Instagram API and I found this code. <html> <head></head> <body> <h1>Popular on Instagram</h1> <?php // load Zend classes require_once 'Zend/Loader.php'; Zend_Loader::loadClass('Zend_Http_Client'); // define consumer key and secret // available from Instagram API console $CLIENT_ID = 'YOUR-CLIENT-ID'; $CLIENT_SECRET = 'YOUR-CLIENT-SECRET'; try { // initialize client $client = new Zend_Http_Client('https://api.instagram.com/v1/media/popular'); $client->setParameterGet('client_id', $CLIENT_ID); // get popular images // transmit request and decode response $response = $client->request(); $result = json_decode($response->getBody()); // display images $data = $result->data; if (count($data) > 0) { echo '<ul>'; foreach ($data as $item) { echo '<li style="display: inline-block; padding: 25px"><a href="' . $item->link . '"><img src="' . $item->images->thumbnail->url . '" /></a> <br/>'; echo 'By: <em>' . $item->user->username . '</em> <br/>'; echo 'Date: ' . date ('d M Y h:i:s', $item->created_time) . '<br/>'; echo $item->comments->count . ' comment(s). ' . $item->likes->count . ' likes. </li>'; } echo '</ul>'; } } catch (Exception $e) { echo 'ERROR: ' . $e->getMessage() . print_r($client); exit; } ?> </body> </html> In here, I found Zender/Load.php, and I've never heard about that. Is it okay to go http://www.zend.com/en/products/guard/downloads here, and download Zend for linux?? And for another question, is this code available to use Instagram API?? For last, could you let me know that is there any simple code to use Instagram API? Thank you.

    Read the article

  • Best practices managing JavaScript on a single-page app

    - by seanmonstar
    With a single page app, where I change the hash and load and change only the content of the page, I'm trying to decide on how to manage the JavaScript that each "page" might need. I've already got a History module monitoring the location hash which could look like domain.com/#/company/about, and a Page class that will use XHR to get the content and insert it into the content area. function onHashChange(hash) { var skipCache = false; if(hash in noCacheList) { skipCache = true; } new Page(hash, skipCache).insert(); } // Page.js var _pageCache = {}; function Page(url, skipCache) { if(!skipCache && (url in _pageCache)) { return _pageCache[url]; } this.url = url; this.load(); } The cache should let pages that have already been loaded skip the XHR. I also am storing the content into a documentFragment, and then pulling the current content out of the document when I insert the new Page, so I the browser will only have to build the DOM for the fragment once. Skipping the cache could be desired if the page has time sensitive data. Here's what I need help deciding on: It's very likely that any of the pages that get loaded will have some of their own JavaScript to control the page. Like if the page will use Tabs, needs a slide show, has some sort of animation, has an ajax form, or what-have-you. What exactly is the best way to go around loading that JavaScript into the page? Include the script tags in the documentFragment I get back from the XHR? What if I need to skip the cache, and re-download the fragment. I feel the exact same JavaScript being called a second time might cause conflicts, like redeclaring the same variables. Would the better way be to attach the scripts to the head when grabbing the new Page? That would require the original page know all the assets that every other page might need. And besides knowing the best way to include everything, won't I need to worry about memory management, and possible leaks of loading so many different JavaScript bits into a single page instance?

    Read the article

  • ASP.NET MVC CRUD PartialView Popup Issue

    - by Smiley Face
    I am creating an MVC website which makes use of Partial Views on Popups to handle all my CRUD transactions. Please note that my application can already handle these CRUD operations perfectly (LINQ-To-Entity). However, I have a problem with my popup forms. Below is the code from my _Add.cshtml: @model MyStore.Models.MyModels.ProductsModel @{ Layout = null; } @using (Ajax.BeginForm("_Add", "Products", new AjaxOptions { InsertionMode = InsertionMode.Replace, HttpMethod = "POST", OnSuccess = "addSuccess" }, new { @id = "addForm" })) { @Html.ValidationSummary(true) <div id="add-message" class="error invisible"></div> <fieldset> <legend>Products</legend> @Html.HiddenFor(m => Model.ProductCode) <div class="editor-label"> @Html.LabelFor(model => model.ProductName) </div> <div class="editor-field"> @Html.EditorFor(model => model.ProductName) @Html.ValidationMessageFor(model => model.ProductName) </div> <div class="editor-label"> @Html.LabelFor(model => model.Price) </div> <div class="editor-field"> @Html.TextBoxFor(model => model.Price) @Html.ValidationMessageFor(model => model.Price) </div> </fieldset> } Below is the code from my Controller: [HttpGet] public ActionResult _Add(string productCode) { ProductsModel model = newProductsModel(); model.ProductCode = ProductCode ; return PartialView(model); } [HttpPost] public JsonResult _Add(ProductsModel model) { if (ModelState.IsValid) { ProductsManager prod = new ProductsManager(); Products pa = new Products(); pa.ProductCode = model.ProductCode; pa.ProductName = model.ProductName; pa.Price = model.Price; prod.AddProduct(pa); return Json(HelperClass.SuccessResponse(pa), JsonRequestBehavior.AllowGet); } else { return Json(HelperClass.ErrorResponse("Please review your form"), JsonRequestBehavior.DenyGet); } } Please note that the _Add.cshtml is a partial view which is being rendered through a Popup.js which I found on the internet. It is rendered through this code: @Html.ActionLink("[Add Product]", "_Add", new { ProductCode = @ViewData["ProductCode"] }, new { @class = "editLink" }) This works okay. I mean it adds product to my database. But my problem is upon clicking the Proceed button, I get this pop-up download dialog from the page: Can somebody please help me with this? I have a hunch it's because of the HttpMethod i'm using (POST, PUT, GET, DELETE) but i'm not really sure which one is right to use or if it really is the problem in the first place. Any help would be greatly appreciated! PS. Sorry for the long post.

    Read the article

  • Smoke testing a .NET web application

    - by pdr
    I cannot believe I'm the first person to go through this thought process, so I'm wondering if anyone can help me out with it. Current situation: developers write a web site, operations deploy it. Once deployed, a developer Smoke Tests it, to make sure the deployment went smoothly. To me this feels wrong, it essentially means it takes two people to deploy an application; in our case those two people are on opposite sides of the planet and timezones come into play, causing havoc. But the fact remains that developers know what the minimum set of tests is and that may change over time (particularly for the web service portion of our app). Operations, with all due respect to them (and they would say this themselves), are button-pushers who need a set of instructions to follow. The manual solution is that we document the test cases and operations follow that document each time they deploy. That sounds painful, plus they may be deploying different versions to different environments (specifically UAT and Production) and may need a different set of instructions for each. On top of this, one of our near-future plans is to have an automated daily deploy environment, so then we'll have to instruct a computer as to how to deploy a given version of our app. I would dearly like to add to that instructions for how to smoke test the app. Now developers are better at documenting instructions for computers than they are for people, so the obvious solution seems to be to use a combination of nUnit (I know these aren't unit tests per se, but it is a built-for-purpose test runner) and either the Watin or Selenium APIs to run through the obvious browser steps and call to the web service and explain to the Operations guys how to run those unit tests. I can do that; I have mostly done it already. But wouldn't it be nice if I could make that process simpler still? At this point, the Operations guys and the computer are going to have to know which set of tests relate to which version of the app and tell the nUnit runner which base URL it should point to (say, www.example.com = v3.2 or test.example.com = v3.3). Wouldn't it be nicer if the test runner itself had a way of giving it a base URL and letting it download say a zip file, unpack it and edit a configuration file automatically before running any test fixtures it found in there? Is there an open source app that would do that? Is there a need for one? Is there a solution using something other than nUnit, maybe Fitnesse? For the record, I'm looking at .NET-based tools first because most of the developers are primarily .NET developers, but we're not married to it. If such a tool exists using other languages to write the tests, we'll happily adapt, as long as there is a test runner that works on Windows.

    Read the article

  • Question about Architecture for Viewing Images in ASP.NET MVC App

    - by Charlie Flowers
    I have an approach in mind for an image viewer in a web app, and want to get a sanity check and any thoughts you stackoverflowers might have. Here's the whirlwind nutshell summary: I'm working on an ASP.NET MVC application that will run in my company's retail stores. Even though it is a web application, we own the store machines and have control over them. We have a "windows agent" running on the store machine which we can talk to from the browser via javascript (it is a WCF service, and our web app has permission to talk to it from the browser). One of the web pages needs to be an "image viewer" page with some common things like Rotate & Zoom. Now, there are some WebForms controls that offer Rotate and Zoom. However, they take up server resources and generate a good bit of traffic between the server and the browser. For example, the Rotate function would cause an ajax call to the server, which would then generate a new image written to a .NET Canvas object, which would then be written to a file on the server, which would then be returned from the ajax call and refreshed inside the browser. Normally, that's a pretty good way of doing things. But in our case, we have code running on the store machine that we can communicate with. This leads me to consider the following approach: When the user asks to view an image, we tell our "windows agent" to download it from our image server to the store machine. We then redirect our browser to our image viewer page, which will pull the image from the local file we just wrote to the store machine. When the user clicks "Rotate", we cause JavaScript code in the browser to call our "windows agent" software, asking it to perform the "Rotate" function. The "windows agent" does the rotation using the same kind of imaging control that would formerly have been used on the server, but it does so now on the store machine. Javascript in the browser then refreshes the image on the page to show the newly rotated image. Zoom and similar features would be implemented the same way. This seems to be much more efficient, scalable, and responsive for the end-users. However, I've never heard of anything like it being done, mostly because it's rare to have this combination of a web app plus a "windows agent" on the client machine. What do you think? Feasible? Reasonable? Any pitfalls I overlooked or improvements / suggestions you can see? Has anyone done anything like this who would like to offer the wisdom of experience? Thanks!

    Read the article

  • iPhone Image Resources, ICO vs PNG, app bundle filesize

    - by Jasarien
    My application has a collection of around 1940 icons that are used throughout. They're currently in ICO and new images provided to me come in ICO format too. I have noticed that they contain a 16x16 and 32x32 representation of each icon in one file. Each file is roughly 4KB in filesize (as reported by finder, but ls reports that they vary from being ~1000 bytes to 5000 bytes) A very small number of these icons only contain the 32x32 representation, and as a result are only around 700 bytes in size. Currently I am bundling these icons with my application and they are inflating the size of the app a bit more than I would like. Altogether, the images total just about 25.5MB. Xcode must do some kind of compression because the resulting app bundle is about 12.4MB. Compressing this further into a ZIP (as it would be when submitted to the App Store), results in a final file of 5.8MB. I'm aware that the maximum limit for over the air App Store downloads has been raised to 20MB since the introduction of the iPad (I'm not sure if that extends to iPhone apps as well as iPad apps though, if not the limit would be 10MB). My worry is that new icons are going to be added (sometimes up to 10 icons per week), and will continue to inflate the app bundle over time. What is the best way to distribute these icons with my app? Things I've tried and not had much success with: Converting the icons from ICO to PNG: I tried this in the hopes that the pngcrush utility would help out with the filesize. But it appears that it doesn't make much of a difference between a normal PNG and a crushed png (I believe it just optimises the image for display on the iPhone's GPU rather than compress it's size). Also in going from ICO to PNG actually increased the size of the icon file... Zipping the images, and then uncompressing them on first run. While this did reduce the overall image sizes, I found that the effort needed to unzip them, copy them to the documents folder and ensure that duplication doesn't happen on upgrades was too much hassle to be worth the benefit. Also, on original and 3G iPhones unzipping and copying around 25MB of images takes too long and creates a bad experience... Things I've considered but not yet tried: Instead of distributing the icons within the app bundle, host them online, and download each icon on demand (it depends on the user's data as to which icons will actually be displayed and when). Issues with this is that bandwidth costs money, and image downloads will be bandwidth intensive. However, my app currently has a small userbase of around 5,500 users (of which I estimate around 1500 to be active based on Flurry stats), and I have a huge unused bandwidth allowance with my current hosting package. So I'm open to thoughts on how to solve this tricky issue.

    Read the article

  • JQuery Menu plugins under ASP.NET MVC seem to only work in Chrome, but not in IE & FireFox

    - by Antony
    Recently, I was trying to prototype some jQuery-based menu into ASP.NET MVC. Just to name two examples here: plugins.jquery.com/project/columnview www.filamentgroup.com/lab/jquery_ipod_style_and_flyout_menus/ Their demo page looks great, but when I integrate their sample code into MVC, the script no longer works in IE and FireFox, but it seems to work just fine under Google Chrome. Can someone kindly enough to point out what I missed? I will be honest here. I am still new to JavaScript, so it is still a learning phase to me, so any help is highly appreciated. I have placed a copy of my VS2010 solution zip file @ http://db.tt/0UNDkN Here is what I did. In the Site.Master, I have something like <body> <div class="page">{truncated...}</div> <script src="http://code.jquery.com/jquery-1.4.2.min.js" type="text/javascript" charset="utf-8"></script> <asp:ContentPlaceHolder ID="ScriptContent" runat="server" /> </body> And inside View file, I have the following <asp:Content ID="Content2" ContentPlaceHolderID="MainContent" runat="server"> <div id="original"> {some demo block, copied from javascript demo} </div> </asp:Content> <asp:Content ID="Content3" ContentPlaceHolderID="ScriptContent" runat="server"> <script type="text/javascript" src="<%= Url.Content("~/Scripts/jquery.columnview.js") %>" /> <script type="text/javascript"> $(document).ready(function () { $('#original').columnview(); }); </script> </asp:Content> Compiled the code and ran it under IE. Ideally, it should work like the demo in www.christianyates.com/blog/jquery/finder-column-view-hierarchical-lists-jquery, but in reality, it only displays unordered list in plain view. (If you download the solution file and run it, you should be able to repro this as well). Next, tried with FireFox, not working either, same result as IE. Finally, when I try it under Google Chrome 4.1 (lastest version), and the script displays just fine. Really puzzling here :-/ Thank you for reading :D

    Read the article

  • IPHONE DEVELOPMENT PROFILE EXPIRED - I TRIED EVERYTHING AND YES, I READ THE DOCS

    - by theiphoneguy
    I really combed this site and others. I read and re-read the related links here and the Apple docs. I'm sorry, but either I am obviously missing something right under my nose, or this Apple profile/certificate stuff is a bit convoluted. Here it is: I have a product in the App Store. I have updated it several times and users like it. My development profile recently expired just when I was improving the app for its next release. I can run the app in the simulator. I can compile and put the distribution build on my iPhone just fine. I went to the Apple portal and renewed the development profile. I downloaded it and installed it in Xcode. I see it in the Organize window. I see it on my iPhone. I CANNOT put the debug build on my iPhone to debug or run with Instruments. The message is that either there is not a valid signed profile or it is untrusted. I subsequently tried to download and install the certificate to my Mac's keychain. Still no success. I checked the code signing section of Project settings and also for the target and the root. All appears to indicate that it is using the expected development profile for debug. Yes, I had deleted the old profile from my iPhone, from the Organizer. I cleaned the Xcode cache and all targets. I have done all of this several times and in varying sequences to try to cover every possibility. I am ready to do anything to be able to debug with Instruments in order to check for leaks or high memory usage. Even though the distribution compile runs fine on my iPhone and plays well with other running processes, I will not release anything without a leaks/memory test. Any ideas will be appreciated. If I missed something obvious, please forgive me - it was not due to just posting a question without searching for similar postings. Thanks!

    Read the article

  • Best way to run remote VBScript in ASP.net? WMI or PsExec?

    - by envinyater
    I am doing some research to find out the best and most efficient method for this. I will need to execute remote scripts on a number of Window Servers/Computers (while we are building them). I have a web application that is going to automate this task, I currently have my prototype working to use PsExec to execute remote scripts. This requires PsExec to be installed on the system. A colleague suggested I should use WMI for this. I did some research in WMI and I couldn't find what I'm looking for. I want to either upload the script to the server and execute it and read the results, or already have the script on the server and execute it and read the results. I would prefer the first option though! Which is more ideal, PsExec or WMI? For reference, this is my prototype PsExec code. This script is only executing a small script to get the Windows OS and Service Pack Info. Protected Sub windowsScript(ByVal COMPUTERNAME As String) ' Create an array to store VBScript results Dim winVariables(2) As String nameLabel.Text = Name.Text ' Use PsExec to execute remote scripts Dim Proc As New System.Diagnostics.Process ' Run PsExec locally Proc.StartInfo = New ProcessStartInfo("C:\Windows\psexec.exe") ' Pass in following arguments to PsExec Proc.StartInfo.Arguments = COMPUTERNAME & " -s cmd /C c:\systemInfo.vbs" Proc.StartInfo.RedirectStandardInput = True Proc.StartInfo.RedirectStandardOutput = True Proc.StartInfo.UseShellExecute = False Proc.Start() ' Pause for script to run System.Threading.Thread.Sleep(1500) Proc.Close() System.Threading.Thread.Sleep(2500) 'Allows the system a chance to finish with the process. Dim filePath As String = COMPUTERNAME & "\TTO\somefile.txt" 'Download file created by script on Remote system to local system My.Computer.Network.DownloadFile(filePath, "C:\somefile.txt") System.Threading.Thread.Sleep(1000) ' Pause so file gets downloaded ''Import data from text file into variables textRead("C:\somefile.txt", winVariables) WindowsOSLbl.Text = winVariables(0).ToString() SvcPckLbl.Text = winVariables(1).ToString() System.Threading.Thread.Sleep(1000) ' ''Delete the file on server - we don't need it anymore Dim Proc2 As New System.Diagnostics.Process Proc2.StartInfo = New ProcessStartInfo("C:\Windows\psexec.exe") Proc2.StartInfo.Arguments = COMPUTERNAME & " -s cmd /C del c:\somefile.txt" Proc2.StartInfo.RedirectStandardInput = True Proc2.StartInfo.RedirectStandardOutput = True Proc2.StartInfo.UseShellExecute = False Proc2.Start() System.Threading.Thread.Sleep(500) Proc2.Close() ' Delete file locally File.Delete("C:\somefile.txt") End Sub

    Read the article

  • Best of both worlds: browser and desktop game?

    - by Ricket
    When considering a platform for a game, I've decided on multi-platform (Win/Lin/Mac) but can't make up my mind as far as browser vs. desktop. As I'm not all too far in development, and now having second thoughts, I'd like your opinion! Browser-based games using Java applets: market penetration is reasonably high (for version 6, it's somewhere around 60% I believe?) using JOGL, 3D performance/quality is decent; certainly good enough to render the crappy 3D graphics that I make there's the (small?) possibility of porting something to Android great for an audience of gamers who switch computers often; can sit down at any computer, load a webpage and play it also great for casual gamers or less knowledgeable gamers who are quite happy with playing games in a browser but don't want to install more things to their computer written in a high-level language which I am more familiar with than C++ - but at the same time, I would like to improve my skills with C++ as it is probably where I am headed in the game industry once I get out of school... easier update process: reload the page. Desktop games using good ol' C++ and OpenGL 100% market penetration, assuming complete cross-platform; however, that number reduces when you consider how many people will go through downloading and installing an executable compared to just browsing to a webpage and hitting "yes" to a security warning. more trouble to maintain the cross-platform; but again, for learning purposes I would embrace the challenge and the knowledge I would gain better performance all around true full screen, whereas browser games often struggle with smooth full screen graphics (especially on Linux, in my experience) can take advantage of distribution platforms such as Steam more likely to be considered a "real" game, whereas browser and Java games are often dismissed as not being real games and therefore not played by "hardcore gamers" installer can be large; don't have to worry so much about download times Is there a way to have the best of both worlds? I love Java applets, but I also really like the reasons to write a desktop game. I don't want to constantly port everything between a Java applet project and a C++ project; that would be twice the work! Unity chose to write their own web player plugin. I don't like this, because I am one of the people that will not install their web player for anything, and I don't see myself being able to convince my audience to install a browser plugin. What are my options? Are there other examples out there besides Unity, of games that have browser and desktop versions? Did I leave out anything in the pro/con lists above?

    Read the article

  • JQuery - Pass variables to PHP script via AJAX call and then display file

    - by hfidgen
    Hiya, I'm trying to generate Outlook event files for my events, doing so on the fly as and when someone requests it by pressing a link on the page. Here's what i've got so far, but I can't find out how to get the browser to download the content which is returned. I know how I could do this if I sent everything via _GET, but I'd prefer to do it via _POST, hence I'm going down this route.. Any thoughts? Thanks! HTML / Javascript <script> $(function() { $(".button").click(function() { // validate and process form // first hide any error messages var start = $("input#start").val(); var end = $("input#end").val(); var dataString = 'start='+ start + '&end=' + end; $.ajax({ type: "POST", url: "/calendar.php", data: dataString, success: function(data) { //Need to return the file contents somehow! } }); return false; }); }); </script> <form name="calendar" method="post" action=""> <input type="hidden" name="start" id="start" value="<?php echo $start; ?>" /> <input type="hidden" name="end" id="end" value="<?php echo $end; ?>" /> <input type="submit" name="submit" class="button" id="submit_btn" value="Outlook" /> </fieldset> </form> PHP File <?php if (isset($_POST['start'])) { $start = $_POST['start']; $end = $_POST['end']; $c = header("Content-Type: text/Calendar"); $c .= header("Content-Disposition: inline; filename=calendar.ics"); $c .= "BEGIN:VCALENDAR\n"; $c .= "VERSION:2.0\n"; $c .= "PRODID:-//xxxyyyy//NONSGML //EN\n"; $c .= "METHOD:REQUEST\n"; // requied by Outlook $c .= "BEGIN:VEVENT\n"; $c .= "UID:". $start . $end ."-" . "-xxxxyyyy.com\n"; // required by Outlook $c .= "DTSTAMP:".date('Ymd').'T'.date('His')."\n"; // required by Outlook $c .= "DTSTART:20080413T000000\n"; $c .= "SUMMARY:" . "\n"; $c .= "DESCRIPTION:" . "\n"; $c .= "END:VEVENT\n"; $c .= "END:VCALENDAR\n"; echo $c; } else { echo "Sorry you can't access this page directly"; } ?>

    Read the article

  • IPhone Development Profile Expired

    - by theiphoneguy
    I really combed this site and others. I read and re-read the related links here and the Apple docs. I'm sorry, but either I am obviously missing something right under my nose, or this Apple profile/certificate stuff is a bit convoluted. Here it is: I have a product in the App Store. I have updated it several times and users like it. My development profile recently expired just when I was improving the app for its next release. I can run the app in the simulator. I can compile and put the distribution build on my iPhone just fine. I went to the Apple portal and renewed the development profile. I downloaded it and installed it in Xcode. I see it in the Organize window. I see it on my iPhone. I CANNOT put the debug build on my iPhone to debug or run with Instruments. The message is that either there is not a valid signed profile or it is untrusted. I subsequently tried to download and install the certificate to my Mac's keychain. Still no success. I checked the code signing section of Project settings and also for the target and the root. All appears to indicate that it is using the expected development profile for debug. Yes, I had deleted the old profile from my iPhone, from the Organizer. I cleaned the Xcode cache and all targets. I have done all of this several times and in varying sequences to try to cover every possibility. I am ready to do anything to be able to debug with Instruments in order to check for leaks or high memory usage. Even though the distribution compile runs fine on my iPhone and plays well with other running processes, I will not release anything without a leaks/memory test. Any ideas will be appreciated. If I missed something obvious, please forgive me - it was not due to just posting a question without searching for similar postings. Thanks!

    Read the article

  • deallocated memory in tableview: message sent to deallocated instance

    - by Kirn
    I tried looking up other issues but couldn't find anything to match so here goes: I'm trying to display text in the table view so I use this bit of code: // StockData is an object I created and it pulls information from Yahoo APIs based on // a stock ticker stored in NSString *heading NSArray* tickerValues = [heading componentsSeparatedByString:@" "]; StockData *chosenStock = [[StockData alloc] initWithContents:[tickerValues objectAtIndex:0]]; [chosenStock getData]; // Set up the cell... NSDictionary *tempDict = [chosenStock values]; NSArray *tempArr = [tempDict allValues]; cell.textLabel.text = [tempArr objectAtIndex:indexPath.row]; return cell; This is all under cellForRowAtIndexPath When I try to release the chosenStock object though I get this error: [CFDictionary release]: message sent to deallocated instance 0x434d3d0 Ive tried using NSZombieEnabled and Build and Analyze to detect problems but no luck thus far. Ive even gone so far as to comment bits and pieces of the code with NSLog but no luck. I'll post the code for StockData below this. As far as I can figure something is getting deallocated before I do the release but I'm not sure how. The only place I've got release in my code is under dealloc method call. Here's the StockData code: // StockData contains all stock information pulled in through Yahoo! to be displayed @implementation StockData @synthesize ticker, values; - (id) initWithContents: (NSString *)newName { if(self = [super init]){ ticker = newName; } return self; } - (void) getData { NSURL *url = [NSURL URLWithString: [NSString stringWithFormat:@"http://download.finance.yahoo.com/d/quotes.csv?s=%@&f=%@&e=.csv", ticker, @"chgvj1"]]; NSError *error; NSURLResponse *response; NSURLRequest *request = [NSURLRequest requestWithURL:url]; NSData *stockData = [NSURLConnection sendSynchronousRequest:request returningResponse:&response error:&error]; if(stockData) { NSString *tempStr = [[NSString alloc] initWithData:stockData encoding:NSASCIIStringEncoding]; NSArray *receivedValuesArr = [tempStr componentsSeparatedByString:@","]; [tempStr release]; values = [NSDictionary dictionaryWithObjects:receivedValuesArr forKeys:[@"change, high, low, volume, market" componentsSeparatedByString:@", "]]; } else { NSLog(@"Connection failed: %@", error); } } - (void)dealloc { [ticker release]; [values release]; [super dealloc]; NSLog(@"Release took place fine"); } @end

    Read the article

  • Drill down rss reader iphone

    - by bing
    Hi everyone, I have made a simple rss reader. The app loads an xml atom file in an array. Now I have added categories to my atom feed, which are first loaded in the array What is the best way to add drill down functionality programmatically. Now only the categories are loaded into the array and displayed. This is the implementation code ..... loading xml file <snip> ..... - (void)parserDidStartDocument:(NSXMLParser *)parser { NSLog(@"found file and started parsing"); } - (void)parser:(NSXMLParser *)parser parseErrorOccurred:(NSError *)parseError { NSString * errorString = [NSString stringWithFormat:@"Unable to download story feed from web site (Error code %i )", [parseError code]]; NSLog(@"error parsing XML: %@", errorString); UIAlertView * errorAlert = [[UIAlertView alloc] initWithTitle:@"Error loading content" message:errorString delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [errorAlert show]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); currentElement = [elementName copy]; if ([elementName isEqualToString:@"entry"]) { // clear out our story item caches... Categoryentry = [[NSMutableDictionary alloc] init]; currentID = [[NSMutableString alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentContent = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"entry"]) { // save values to an entry, then store that item into the array... [Categoryentry setObject:currentTitle forKey:@"title"]; [Categoryentry setObject:currentID forKey:@"id"]; [Categoryentry setObject:currentSummary forKey:@"summary"]; [Categoryentry setObject:currentContent forKey:@"content"]; [categories addObject:[Categoryentry copy]]; NSLog(@"adding category: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"id"]) { [currentID appendString:string]; } else if ([currentElement isEqualToString:@"summary"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"content"]) { [currentContent appendString:string]; } } - (void)parserDidEndDocument:(NSXMLParser *)parser { [activityIndicator stopAnimating]; [activityIndicator removeFromSuperview]; NSLog(@"all done!"); NSLog(@"categories array has %d entries", [categories count]); [newsTable reloadData]; }

    Read the article

  • chrome renders js different depending on the extension of the file to render [testcase included]

    - by pakore
    I was trying to implement an image panner I found here Chrome renders the same document differently depending on the extension of the file requested. I have created a test case, where it works when the file it's not named as test.xhtml You can download the test case from here Does anybody know why or how to solve it? I want my files to be .xhtml In IE and FF it works fine. Code: test.html / test.xhtml (change the name to see that works with one but not with the other). <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"> <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"/> <style type="text/css"> /*Default CSS for pan containers*/ .pancontainer { position: relative; /*keep this intact*/ overflow: hidden; /*keep this intact*/ width: 300px; height: 300px; border: 1px solid black; } </style> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript" src="http://www.dynamicdrive.com/dynamicindex4/imagepanner.js"></script> </head> <body> <div class="pancontainer" data-orient="center" data-canzoom="yes" style="width: 350px; height: 200px; float: left; position: relative; overflow-x: hidden; overflow-y: hidden; cursor: move; "><img src="./test_files/image.jpg" style="position: absolute; width: 700px; height: 525px; left: -175px; top: -163px; display: block;" /> </div> </body> </html>

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • iPhone: Create a single UIView from multiple clicks

    - by Cuzog
    I'm making a partial overlay modal in my app with the code from “Semi-Modal (Transparent) Dialogs on the iPhone” at ramin.firoozye.com. In doing so, the button that calls the modal is still visible and clickable. I will hide this button when the modal spawns, but I want to be sure if the user clicks very quickly twice, a new modal doesn't come up for each click. What is the best way to check that the modal doesn't already exist when calling it from the button click? You can download the test project here. For those that don't have xcode, the relevant functions are below: I call forth the modal on button click with this: - (IBAction)displayModal:(id)sender { ModalViewController *modalController = [[ModalViewController alloc] initWithNibName:@"ModalViewController" bundle:nil]; modalController.view.frame = CGRectOffset(modalController.view.frame, 0, 230); [self showModal:modalController.view]; } Then use this function to animate the custom modal over the current view: - (void)showModal:(UIView*) modalView { UIWindow* mainWindow = (((TestAppDelegate*) [UIApplication sharedApplication].delegate).window); CGPoint middleCenter = modalView.center; CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); modalView.center = offScreenCenter; // we start off-screen [mainWindow addSubview:modalView]; // Show it with a transition effect [UIView beginAnimations:nil context:nil]; [UIView setAnimationDuration:0.4]; // animation duration in seconds modalView.center = middleCenter; [UIView commitAnimations]; } Then I dismiss the modal on button click with this: - (IBAction)dismissModal:(id)sender { [self hideModal:self.view]; } And then use these functions to animate the modal offscreen and clean itself up: - (void)hideModal:(UIView*) modalView { CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); [UIView beginAnimations:nil context:modalView]; [UIView setAnimationDuration:0.7]; [UIView setAnimationDelegate:self]; [UIView setAnimationDidStopSelector:@selector(hideModalEnded:finished:context:)]; modalView.center = offScreenCenter; [UIView commitAnimations]; } - (void)hideModalEnded:(NSString *)animationID finished:(NSNumber *)finished context:(void *)context { UIView* modalView = (UIView *)context; [modalView removeFromSuperview]; [self release]; } Any help is greatly appreciated!

    Read the article

  • BULK INSERT from one table to another all on the server

    - by steve_d
    I have to copy a bunch of data from one database table into another. I can't use SELECT ... INTO because one of the columns is an identity column. Also, I have some changes to make to the schema. I was able to use the export data wizard to create an SSIS package, which I then edited in Visual Studio 2005 to make the changes desired and whatnot. It's certainly faster than an INSERT INTO, but it seems silly to me to download the data to a different computer just to upload it back again. (Assuming that I am correct that that's what the SSIS package is doing). Is there an equivalent to BULK INSERT that runs directly on the server, allows keeping identity values, and pulls data from a table? (as far as I can tell, BULK INSERT can only pull data from a file) Edit: I do know about IDENTITY_INSERT, but because there is a fair amount of data involved, INSERT INTO ... SELECT is kinda of slow. SSIS/BULK INSERT dumps the data into the table without regards to indexes and logging and whatnot, so it's faster. (Of course creating the clustered index on the table once it's populated is not fast, but it's still faster than the INSERT INTO...SELECT that I tried in my first attempt) Edit 2: The schema changes include (but are not limited to) the following: 1. Splitting one table into two new tables. In the future each will have its own IDENTITY column, but for the migration I think it will be simplest to use the identity from the original table as the identity for the both new tables. Once the migration is over one of the tables will have a one-to-many relationship to the other. 2. Moving columns from one table to another. 3. Deleting some cross reference tables that only cross referenced 1-to-1. Instead the reference will be a foreign key in one of the two tables. 4. Some new columns will be created with default values. 5. Some tables aren’t changing at all, but I have to copy them over due to the "put it all in a new DB" request.

    Read the article

  • Wordpress installed in root folder, subdomain now not working, GoDaddy host

    - by Kristin
    Hi, please forgive me for being a complete beginner at this, I'd rather not have to try to deal with this myself but as GoDaddy support have not replied after 2 days I'm going to have to. I think my problem is the same as the one above, but I'm not 100% sure, so I'm reposting it, I'm not really confident enough to attempt to try the fixes I've seen here so I need someone to give me baby instructions? Our original website (www.mwpics.com.au) was built in Dreamweaver etc, recently we created a new website in Wordpress, in a subdomain, then migrated it over to the root folder where it is now operating fine. I also moved the files for the old website into another directory which I called 'old', so they're all still there. The problem is that I have a subdomain set up - which is still showing as set up in the control panel on godaddy the url is www.mwpics.com.au/clients and it is at www.clients.mwpics.com.au. This directory contains loads of other directories, each of which is password protected by .htaccess files and which our clients access directly (not through the site) to download their finished work. The test one and the one for random clients is www.mwpics.com.au/clients/temp - username and password both temp (the usernames are all the same as the directory names). Since the WP install to the root directory the /clients extension no longer works (it should bring up an information page which is an .html index page in the directory) and the /clients/name extensions no longer works - it goes back to the wp site with a 'not found' error message. Strangely it does bring up the box for the username and password, but when you enter it it just goes back to the 'not found' message. Someone told me it was the .htaccess file - so as an experiment, I renamed the .htaccess file in the root directory and then copied the .htaccess file from the old root files into the root directory, eureka! It worked - and also the WP site opened to the home page... but bummer - the /pages in the WP site now no longer worked! But at least I know the source of the problem. So I switched it back and this is the status quo - I have no idea how to fix this, and with everyone back at work tomorrow, clients are going to want to start downloading their stuff... Can anyone help me? I'm starting to panic a bit

    Read the article

  • Haskell data serialization of some data implementing a common type class

    - by Evan
    Let's start with the following data A = A String deriving Show data B = B String deriving Show class X a where spooge :: a -> Q [ Some implementations of X for A and B ] Now let's say we have custom implementations of show and read, named show' and read' respectively which utilize Show as a serialization mechanism. I want show' and read' to have types show' :: X a => a -> String read' :: X a => String -> a So I can do things like f :: String -> [Q] f d = map (\x -> spooge $ read' x) d Where data could have been [show' (A "foo"), show' (B "bar")] In summary, I wanna serialize stuff of various types which share a common typeclass so I can call their separate implementations on the deserialized stuff automatically. Now, I realize you could write some template haskell which would generate a wrapper type, like data XWrap = AWrap A | BWrap B deriving (Show) and serialize the wrapped type which would guarantee that the type info would be stored with it, and that we'd be able to get ourselves back at least an XWrap... but is there a better way using haskell ninja-ery? EDIT Okay I need to be more application specific. This is an API. Users will define their As, and Bs and fs as they see fit. I don't ever want them hacking through the rest of the code updating their XWraps, or switches or anything. The most i'm willing to compromise is one list somewhere of all the A, B, etc. in some format. Why? Here's the application. A is "Download a file from an FTP server." B is "convert from flac to mp3". A contains username, password, port, etc. information. B contains file path information. A and B are Xs, and Xs shall be called "Tickets." Q is IO (). Spooge is runTicket. I want to read the tickets off into their relevant data types and then write generic code that will runTicket on the stuff read' from the stuff on disk. At some point I have to jam type information into the serialized data.

    Read the article

< Previous Page | 439 440 441 442 443 444 445 446 447 448 449 450  | Next Page >