Search Results

Search found 12701 results on 509 pages for 'fulltext index'.

Page 445/509 | < Previous Page | 441 442 443 444 445 446 447 448 449 450 451 452  | Next Page >

  • Find Pythagorean triplet for which a + b + c = 1000

    - by Rahul
    A Pythagorean triplet is a set of three natural numbers, a < b < c, for which, a^(2) + b^(2) = c^(2) For example, 3^(2) + 4^(2) = 9 + 16 = 25 = 5^(2). There exists exactly one Pythagorean triplet for which a + b + c = 1000. Find the product abc. Source: http://projecteuler.net/index.php?section=problems&id=9 I tried but didn't know where my code went wrong. Here's my code in C: #include <stdio.h> void main() { int a, b, c; for (a = 0; a<=1000; a++) { for (b = 0; b<=1000; b++) { for (c = 0; c<=1000; c++) { if (((a^(2) + b^(2) == c^(2)) && ((a+b+c) ==1000))) printf("a=%d, b=%d, c=%d",a,b,c); } } } return 0; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Geohashing - recursively find neighbors of neighbors

    - by itsme
    I am now looking for an elegant algorithm to recursively find neighbors of neighbors with the geohashing algorithm (http://www.geohash.org). Basically take a central geohash, and then get the first 'ring' of same-size hashes around it (8 elements), then, in the next step, get the next ring around the first etc. etc. Have you heard of an elegant way to do so? Brute force could be to take each neighbor and get their neighbors simply ignoring the massive overlap. Neighbors around one central geohash has been solved many times (here e.g. in Ruby: http://github.com/masuidrive/pr_geohash/blob/master/lib/pr_geohash.rb) Edit for clarification: Current solution, with passing in a center key and a direction, like this (with corresponding lookup-tables): def adjacent(geohash, dir) base, lastChr = geohash[0..-2], geohash[-1,1] type = (geohash.length % 2)==1 ? :odd : :even if BORDERS[dir][type].include?(lastChr) base = adjacent(base, dir) end base + BASE32[NEIGHBORS[dir][type].index(lastChr),1] end (extract from Yuichiro MASUI's lib) I say this approach will get ugly soon, because directions gets ugly once we are in ring two or three. The algorithm would ideally simply take two parameters, the center area and the distance from 0 being the center geohash only (["u0m"] and 1 being the first ring made of 8 geohashes of the same size around it (= [["u0t", "u0w"], ["u0q", "u0n"], ["u0j", "u0h"], ["u0k", "u0s"]]). two being the second ring with 16 areas around the first ring etc. Do you see any way to deduce the 'rings' from the bits in an elegant way?

    Read the article

  • php while selecting a node should be highlighted.

    - by shaibi
    I need to highlight the node value when I select it.how can I wrirte code for that in php my code is function generate_menu($parent) { $has_childs = false; global $menu_array; foreach($menu_array as $key = $value) { //print_r($value); if ($value['parentid'] == $parent) { if ($has_childs === false) { $has_childs = true; $menu .= '<ul>'; } $clor = 'black'; if(($_GET['id']>0) &&($key == $_GET['id'])) { $clor = '#990000'; } $chld = generate_menu($key); $cls = ($chld != '')? 'folder' : 'file'; $menu .= '<li><span class="'.$cls.'" color='.$clor.'>&nbsp;' . $value['humanid'].'-'.$value['title'] . ' <a href="index.php?id='.$key.'"><img src="images/edit.png" alt=" Edit" title="Edit"/></a></span>'; $menu .= $chld; $menu .= '</li>'; } } if ($has_childs === true) $menu .= '</ul>'; return $menu ; } ?

    Read the article

  • Any reason why my $.ajax success callback is not executed in Jquery?

    - by arma
    Hello, Today i discovered that my dev version of my website do not execute success callback, but all other javascript and jquery code is running good. Even my ajax request is performed and i can see response in firebug. $('#login').submit(function(){ var email = $('#l_email').val(); var pass = $('#l_pass').val(); if(email && pass != ''){ var str = decodeURIComponent($(this).serialize()); $.ajax({ type: "POST", url: "login.php", data: str, success: function(msg){ if(msg == 'OK'){ window.location = 'index.php' }else if (msg == 'NOT_OK'){ if(lang == 'lv'){ alert(message); }else if(lang == 'ru'){ alert(message); } }else if (msg == 'EMAIL_NOT_VALID'){ if(lang == 'lv'){ alert(message); }else if(lang == 'ru'){ alert(message); } } } }); }else{ alert('That form is empty.'); } return false; }); The thing is $.ajax part executes fine and i can see response in firebug "OK". But redirect is not happening and even if i replace that redirect with something like alert or console.log nothing comes up. What could cause this? It's really hard to track since firebug gives no errors.

    Read the article

  • How do I call +class methods in Objective C without referencing the class?

    - by TimM
    I have a series of "policy" objects which I thought would be convenient to implement as class methods on a set of policy classes. I have specified a protocol for this, and created classes to conform to (just one shown below) @protocol Counter +(NSInteger) countFor: (Model *)model; @end @interface CurrentListCounter : NSObject <Counter> +(NSInteger) countFor: (Model *)model; @end I then have an array of the classes that conform to this protocol (like CurrentListCounter does) +(NSArray *) availableCounters { return [[[NSArray alloc] initWithObjects: [CurrentListCounter class],[AllListsCounter class], nil] autorelease]; } Notice how I am using the classes like objects (and this might be my problem - in Smalltalk classes are objects like everything else - I'm not sure if they are in Objective-C?) My exact problem is when I want to call the method when I take one of the policy objects out of the array: id<Counter> counter = [[MyModel availableCounters] objectAtIndex: self.index]; return [counter countFor: self]; I get a warning on the return statement - it says -countFor: not found in protocol (so its assuming its an instance method where I want to call a class method). However as the objects in my array are instances of class, they are now like instance methods (or conceptually they should be). Is there a magic way to call class methods? Or is this just a bad idea and I should just create instances of my policy objects (and not use class methods)?

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • Error when trying to overwrite an image (it succeeds the first time after iis reset )

    - by Omu
    First time (after iis reset) I succeed to overwrite the image, but if I try again it gives me that GDI error this is my code: [HttpPost] public ActionResult Change() { var file = Request.Files["fileUpload"]; if (file.ContentLength > 0) { var filePath = @ConfigurationManager.AppSettings["storagePath"] + @"\Temp\" + User.Identity.Name + ".jpg"; using (var image = Image.FromStream(file.InputStream)) { var size = ResizeImage(image, filePath, 600, 480, true); return RedirectToAction("Crop", new CropDisplay {ImageWidth = size[0], ImageHeight = size[1]}); } } return RedirectToAction("Index"); } private int[] ResizeImage(Image image, string newFilePath, int newWidth, int maxHeight, bool onlyResizeIfWider) { ... using (var thumbnail = new Bitmap(newWidth, newHeight)) { using (var graphic = Graphics.FromImage(thumbnail)) { graphic.InterpolationMode = InterpolationMode.HighQualityBicubic; graphic.SmoothingMode = SmoothingMode.HighQuality; graphic.PixelOffsetMode = PixelOffsetMode.HighQuality; graphic.CompositingQuality = CompositingQuality.HighQuality; graphic.DrawImage(image, 0, 0, newWidth, newHeight); var info = ImageCodecInfo.GetImageEncoders(); var encoderParameters = new EncoderParameters(1); encoderParameters.Param[0] = new EncoderParameter(Encoder.Quality, 100L); //this is where I get the GDI error thumbnail.Save(newFilePath, info[1], encoderParameters); return new[] { newWidth, newHeight }; } } }

    Read the article

  • "Too many indexes on table" error when creating relationships in Microsoft Access 2010.

    - by avianattackarmada
    I have tblUsers which has a primary key of UserID. UserID is used as a foreign key in many tables. Within a table, it is used as a foreign key for multiple fields (e.g. ObserverID, RecorderID, CheckerID). I have successfully added relationships (with in the the MS Access 'Relationship' view), where I have table aliases to do the multiple relationships per table: *tblUser.UserID - 1 to many - tblResight.ObserverID *tblUser_1.UserID - 1 to many - tblResight.CheckerID After creating about 25 relationships with enforcement of referential integrity, when I try to add an additional one, I get the following error: "The operation failed. There are too many indexes on table 'tblUsers.' Delete some of the indexes on the table and try the operation again." I ran the code I found here and it returned that I have 6 indexes on tblUsers. I know there is a limit of 32 indexes per table. Am I using the relationship GUI wrong? Does access create an index for the enforcement of referential integrity any time I create a relationship (especially indexes that wouldn't turn up when I ran the script)? I'm kind of baffled, any help would be appreciated.

    Read the article

  • Android 2.1 How to get Phone Numbers of contacts.

    - by Brandon Delany
    Hi, I am new to Android and have been working on an app that needs to get all of the user's contact's phone numbers. Apparently the code I have does not work with the 2.1 SDK. So far here is the code I am using: String[] projection = new String[] { Phone.NUMBER }; Cursor c = managedQuery( Phone.CONTENT_URI, projection, null, null, null ); int colIndex = -1; try { colIndex = c.getColumnIndexOrThrow( Phone.NUMBER ); } catch( Exception e ) { print( e.getMessage() ); } print( "Column Index = " + colIndex ); //count is equal to 3 for( int i = 0; i < count; i++ ){ try { print( c.getString( 2 ) ); //the 2 used to be colIndex } catch ( Exception e ) { print( e.getMessage() ); } } It seems that no matter what I pass into c.getString() it keeps telling me that I passed in -1. But I even hardcoded the 2, and it says the same thing. Any help would be much appreciated.

    Read the article

  • structDelete doesn't effect the shallow copy?

    - by Travis
    I was playing around onError so I tried to create an error using a large xml document object. <cfset variables.XMLByRef = variables.parsedXML.XMLRootElement.XMLChildElement> <cfset structDelete(variables.parsedXML, "XMLRootElement")> <cfset variables.startXMLShortLoop = getTickCount()> <cfloop from = "1" to = "#arrayLen(variables.XMLByRef)#" index = "variables.i"> <cfoutput>#variables.XMLByRef[variables.i].id.xmltext#</cfoutput><br /> </cfloop> <cfset variables.stopXMLShortLoop = getTickCount()> I expected to get an error because I deleted the structure I was referencing. From LiveDocs: Variable Assignment - Creates an additional reference, or alias, to the structure. Any change to the data using one variable name changes the structure that you access using the other variable name. This technique is useful when you want to add a local variable to another scope or otherwise change a variable's scope without deleting the variable from the original scope. instead I got 580df1de-3362-ca9b-b287-47795b6cdc17 25a00498-0f68-6f04-a981-56853c0844ed ... ... ... db49ed8a-0ba6-8644-124a-6d6ebda3aa52 57e57e28-e044-6119-afe2-aebffb549342 Looped 12805 times in 297 milliseconds <cfdump var = "#variables#"> Shows there's nothing in the structure, just parsedXML.xmlRoot.xmlName with the value of XMLRootElement. I also tried <cfset structDelete(variables.parsedXML.XMLRootElement, "XMLChildElement")> as well as structClear for both. More information on deleting from the xml document object. http://help.adobe.com/en_US/ColdFusion/9.0/Developing/WSc3ff6d0ea77859461172e0811cbec22c24-78e3.html Can someone please explain my faulty logic? Thanks.

    Read the article

  • Recursive code Sorting in VB

    - by Peter
    Ages old question: You have 2 hypothetical eggs, and a 100 story building to drop them from. The goal is to have the least number of guaranteed drops that will ensure you can find what floor the eggs break from the fall. You can only break 2 eggs. Using a 14 drop minimum method, I need help writing code that will allow me to calculate the following: Start with first drop attempt on 14th floor. If egg breaks then drop floors 1-13 to find the floor that causes break. ElseIf egg does not break then move up 13 floors to floor number 27 and drop again. If egg breaks then drop floors 15-26 starting on 15 working up to find the floor egg breaks on. ElseIf egg does not break then move up 12 floors to floor number 39 and drop again. etc. etc. The way this increases is as follows 14+13+12+11+10+9+8+7+6+5+4+3+2+1 So always adding to the previous value, by one less. I have never written a sorting algorithm before, and was curious how I might go about setting this up in a much more efficient way than a mile long of if then statements. My original idea was to store values for the floors in an array, and pull from that, using the index to move up or down and subtract or add to the variables. The most elegant solution would be a recursive function that handled this for any selected floor, 1-100, and ran the math, with an output that shows how many drops were needed in order to find that floor. Maximum is always 14, but some can be done in less.

    Read the article

  • Codeigniter only loads the default controller

    - by fh47331
    I am very new to CodeIgniter, but have been programming PHP for ages. I'm writing some software at the moment and using CI for the first time with it. The default controller is set to the first controller I want to action call 'login' (the controller is login.php, the view is login.php. When the form is submitted it calls the 'authenticate' controller. This executes fine, process the login data correctly and then does a redirect command (without any output to the screen prior) to the next page in this case 'newspage'. The problem is that the redirect, never reaches 'newspage' but the default controller runs again. It doesn't matter what I put ... ht tp://domain.name/anything ... (yes im using .htaccess to remove the index.php) the anything never gets called, just the default controller. I have left the standard 'welcome.php' controller and 'welcome_message.php' in the folders and even putting ht tp://domain.name/welcome all I get is the login screen! (Obviously there shouldn't be a space between the http - thats just done so it does not show as a hyperlink!) Can anyone tell me what i've done wrong!

    Read the article

  • odp.net SQL query retrieve set of rows from two input arrays.

    - by Karl Trumstedt
    I have a table with a primary key consisting of two columns. I want to retrieve a set of rows based on two input arrays, each corresponding to one primary key column. select pkt1.id, pkt1.id2, ... from PrimaryKeyTable pkt1, table(:1) t1, table(:2) t2 where pkt1.id = t1.column_value and pkt1.id2 = t2.column_value I then bind the values with two int[] in odp.net. This returns all different combinations of my resulting rows. So if I am expecting 13 rows I receive 169 rows (13*13). The problem is that each value in t1 and t2 should be linked. Value t1[4] should be used with t2[4] and not all the different values in t2. Using distinct solves my problem, but I'm wondering if my approach is wrong. Anyone have any pointers on how to solve this the best way? One way might be to use a for-loop accessing each index in t1 and t2 sequentially, but I wonder what will be more efficient. Edit: actually distinct won't solve my problem, it just did it based on my input-values (all values in t2 = 0)

    Read the article

  • jquery with php loading file

    - by Marcus Solv
    I'm trying to use jquery with a simple php code: $('#some').click(function() { <?php require_once('some1.php?name="some' + index + '"'); ?> }); It shows no error, so I don't know what is wrong. In some1 I have: <?php //Start session session_start(); //Include database connection details require_once('../sql/config.php'); //Connect to mysql server $link = mysql_connect(DB_HOST, DB_USER, DB_PASSWORD); if(!$link) { die('Failed to connect to server: ' . mysql_error()); } //Select database $db = mysql_select_db(DB_DATABASE); if(!$db) { die("Unable to select database"); } //Function to sanitize values received from the form. Prevents SQL injection function clean($str) { $str = @trim($str); if(get_magic_quotes_gpc()) { $str = stripslashes($str); } return mysql_real_escape_string($str); } //Sanitize the POST values $name = clean($_GET['name']); ?> It's not complete because I want to make a sql command (insert). I want when I click in #some to execute that file (create a entry in the table that isn't define yet).

    Read the article

  • jQuery / Loading content into div and changing url's (working but buggy)

    - by Bruno
    This is working, but I'm not being able to set an index.html file on my server root where i can specify the first page to go. It also get very buggy in some situations. Basically it's a common site (menu content) but the idea is to load the content without refreshing the page, defining the div to load the content, and make each page accessible by the url. One of the biggest problems here it's dealing with all url situations that may occur. The ideal would be to have a rel="divToLoadOn" and then pass it on my loadContent() function... so I would like or ideas/solutions for this please. Thanks in advance! //if page comes from URL if(window.location.hash != ''){ var url = window.location.hash; url = '..'+url.substr(1, url.length); loadContent(url); } //if page comes from an internal link $("a:not([target])").click(function(e){ e.preventDefault(); var url = $(this).attr("href"); if(url != '#'){ loadContent($(this).attr("href")); } }); //LOAD CONTENT function loadContent(url){ var contentContainer = $("#content"); //set load animation $(contentContainer).ajaxStart(function() { $(this).html('loading...'); }); $.ajax({ url: url, dataType: "html", success: function(data){ //store data globally so it can be used on complete window.data = data; }, complete: function(){ var content = $(data).find("#content").html(); var contentTitle = $(data).find("title").text(); //change url var parsedUrl = url.substr(2,url.length) window.location.hash = parsedUrl; //change title var titleRegex = /(.*)<\/title/.exec(data); contentTitle = titleRegex[1]; document.title = contentTitle; //renew content $(contentContainer).fadeOut(function(){ $(this).html(content).fadeIn(); }); }); }

    Read the article

  • CSS "Cover" - No scroll bars?

    - by Lynda
    I am using the cover property to create a background image that fills the background and resizes with the browser. But I run into one issue, the page has a lot of content and no scroll bars appear for me to scroll down! Here is the code I am using: body{ background: url(path.jpg) no-repeat center center fixed; -webkit-background-size: cover; -moz-background-size: cover; -o-background-size: cover; /* Cover for IE 7/8 */ filter: progid:DXImageTransform.Microsoft.AlphaImageLoader(src='path.jpg', sizingMethod='scale'); -ms-filter: progid:DXImageTransform.Microsoft.AlphaImageLoader(src='path.jpg', sizingMethod='scale'); /* End Cover for IE 7/8 */ background-size: cover; background-color: transparent !important; position:fixed; top: 0; left: 0; width: 100%; height:100%; max-width:2500px; max-height:1500px; z-index:1; } If I remove position:fixed; I get the scroll bars back but the background image disappears. What is the best way to tackle this and have both scroll bars and the background cover image? Note: I am using jQuery and would use a JS answer if it works (though I prefer a CSS only answer.)

    Read the article

  • jQuery - Toggle CSS Background Image Expand/Close

    - by urbanrunic
    I am looking for a way to change the back ground image on toggle as in this questions here: jQuery - Toggle Image Expand/Close My issue is I have this html: <button id="close-menu"></button> <div id="menu-bar"> <div class="wrapper"> <a href="http://www.website.com" target="_blank"> <img src="image.png" alt=""> </a> <div class="options"> <h2>eBlast Tools</h2> <ul> <li class="toggle-images">Images are <span>enabled</span>. Click to disable.</li> <li class="download-zip"><a href="download.zip">Download ZIP File</a></li> </ul> </div> </div> </div> and this is my current jquery: $('#close-menu').click(function() { $('#menu-bar').slideToggle(400); return false; }); and this is the css: #close-menu { background: url(../img/minus-button.png); background-position: top left; width: 25px; height: 25px; position: absolute; top: 10px; right: 20px; z-index: 100; border: none; } #close-menu:hover { background: url(../img/minus-button.png); background-position: bottom left; }

    Read the article

  • Rails routing of a controller's functions query

    - by Jty.tan
    So I've got a Users controller, and it has (amongst others) a function called details. The idea is that a user can go to localhost:3000/user/:user_id/details and be able to view the details of :user_id. For example, I have a user called "tester". When I go to the uri: http://localhost:3000/users/tester/details I'd want the details function to be called up, to render the details view, and to display the information for the user tester. But instead I get an error saying that No action responded to tester. Actions: change_password, create, current_user, details, forgot_password, index, login_required, new, redirect_to_stored, show, and update_attributes And I understand that to basically mean that if I wanted to access details, I should really be using http://localhost:3000/users/details Except that that isn't really working either... .< That is instead bringing me to http://localhost:3000/users/details/registries (which is the default path that I'd stipulated for anybody trying to view users/:user_id, so again, that's working the way I wanted it to) Point is: Can anybody help and tell me how I can go about getting users/:user_id/details to work the way I want it to and display the details of :user_id? Thanks!

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • Passing in extra parameters in a URL

    - by Scott Atkinson
    I have the below column on my table what gets binded on pageload, the parameters in there work fine but i need to add an additional parameter which is the fullname which is the next column along but im having trouble figuring our the syntax, here is my ASP <asp:TemplateField HeaderText="ID"> <ItemTemplate> <asp:HyperLink ID="hyperLeadID" runat="server" NavigateUrl='<%#Eval("ID","/documents/Q-Sheet.aspx?LeadID={0}&isHappyCallReferral=yes&isHappyName={1}") %>' Text='<%#Eval("ID")%>'></asp:HyperLink> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Referral Name"> <ItemTemplate> <asp:Label ID="lblRefName" CssClass="gvItem" runat="server" Text='<%# DataBinder.Eval(Container, "DataItem.Name") %>'></asp:Label> </ItemTemplate> </asp:TemplateField> As you can see at the end of ID column i have added isHappyName={1} which i assumed it would select the next column along as it starts at 0 but it keeps throwing an error which is "Index (zero based) must be greater than or equal to zero and less than the size of the argument list." Can someone help me to pass the usersname through the URL Thanks

    Read the article

  • Simple problem with mod_rewrite in the Fat Free Framework

    - by ian
    I am trying to setup and learn the Fat Free Framework for PHP. http://fatfree.sourceforge.net/ It's is fairly simple to setup and I am running it on my machine using MAMP. I was able to get the 'hello world' example running just fin: require_once 'path/to/F3.php'; F3::route('GET /','home'); function home() { echo 'Hello, world!'; } F3::run(); But when I try to add in the second part, which has two routes: require_once 'F3/F3.php'; F3::route('GET /','home'); function home() { echo 'Hello, world!'; } F3::route('GET /about','about'); function about() { echo 'About Us.'; } F3::run(); I get a 404 error if I try the second URL: /about Not sure why one of the mod_rewrite commands would be working and not the other. Below is my .htaccess file: # Enable rewrite engine and route requests to framework RewriteEngine On RewriteBase / RewriteCond %{REQUEST_FILENAME} !-l RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule .* index.php [L,QSA] # Disable ETags Header Unset ETag FileETag none # Default expires header if none specified (stay in browser cache for 7 days) <IfModule mod_expires.c> ExpiresActive On ExpiresDefault A604800 </IfModule>

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • how to get data from another file?

    - by Ronnie Chester Lynwood
    hey guys i got this jquery codes: jQuery(function ($) { var OSX = { container: null, init: function () { $("input.osx, a.osx").click(function (e) { e.preventDefault(); $("#osx-modal-content").modal({ overlayId: 'osx-overlay', containerId: 'osx-container', closeHTML: null, minHeight: 80, opacity: 65, position: ['0',], overlayClose: true, onOpen: OSX.open, onClose: OSX.close }); }); }, open: function (d) { var self = this; self.container = d.container[0]; d.overlay.fadeIn('slow', function () { $("#osx-modal-content", self.container).show(); var title = $("#osx-modal-title", self.container); title.show(); d.container.slideDown('slow', function () { setTimeout(function () { var h = $("#osx-modal-data", self.container).height() + title.height() + 20; // padding d.container.animate( {height: h}, 200, function () { $("div.close", self.container).show(); $("#osx-modal-data", self.container).show(); } ); }, 300); }); }) }, close: function (d) { var self = this; // this = SimpleModal object d.container.animate( {top:"-" + (d.container.height() + 20)}, 500, function () { self.close(); // or $.modal.close(); } ); } }; OSX.init(); }); this js is gets #osx-modal-content,#osx-modal-title,#osx-modal-data from index.php. how can i get divs from another page? thanks

    Read the article

< Previous Page | 441 442 443 444 445 446 447 448 449 450 451 452  | Next Page >