Search Results

Search found 33650 results on 1346 pages for 'line break'.

Page 455/1346 | < Previous Page | 451 452 453 454 455 456 457 458 459 460 461 462  | Next Page >

• Nice way to show Powerpoints and Video

  - by kamikatze

  I'm looking for a sleek way to display Powerpoint presentations and video footage in sequence. Embedding video in .ppsx is not something i want to do, reasons are plenty (video footage being VC-1 1080p would be the first). Is there a media player (needs to run on win32) capable of playing both formats? My hackish way of doing this would be a .cmd with powerpnt.exe bobloblaw.ppsx mplayer.exe -fs video.wmv pwoerpnt.exe whitepowerbill.ppsx and so on Of course, this has a lots an lots of drawbacks, including begin really hard to break out of the chain :) Thanks a lot.

  Read the article

• passing parameters to javacsript using php

  - by ayush

  i have the following line of code - <a href="javascript:;" onClick="tweeet('myid')">My Tweets!</a> Now while this is working perfectly fine the following line is not - <a href="javascript:;" onClick="tweeet(<?php echo 'myid'; ?>)">My Tweets!</a> Can anyone help me out why it is not working and suggest any changes. The variable i want to pass to the javascript function is a php variable. also i have tried the php with single quotes and double quotes but it is not working.

  Read the article

• Powershell equivilent of python's if __name__ == '__main__':

  - by Mark Mascolino

  I am really fond of python's capability to do things like this: if __name__ == '__main__': #setup testing code here #or setup a call a function with parameters and human format the output #etc... This is nice because I can treat a Python script file as something that can be called from the command line but it remains available for me to import its functions and classes into a separate python script file easily without triggering the default "run from the command line behavior". Does Powershell have a similar facility that I could exploit? And if it doesn't how should I be organizing my library of function files so that i can easily execute some of them while I am developing them?

  Read the article

• how to merge file lines having the same first word in python?

  - by user1377135

  I have written a program to merge lines in a file containing the same first word in python. However I am unable to get the desired output. Can anyone please suggest me the mistake in my program? input "file.txt" line1: a b c line2: a b1 c1 line3: d e f line4: i j k line5: i s t line6: i m n ` output a b c a b1 c1 d e f i j k i s t i m n my code a = [line.split() for line in open('file.txt')] L=[] for i in range(0,len(a)): j=i while True: if a[j][0] == a[j+1][0]: L.append(a[j]) L.append(a[j+1]) j=j+2 else: print a[i] print L break

  Read the article

• What Kind of Knowledge is Necessary For a Permon Who Does Not Have IT Background? [closed]

  - by skyflyer

  One of my colleagues joined our company, which by the way is a internet company, months ago as an on-line marketing specialist. He majored English in his college and has never deeply touched IT before. He says that to be a good on-line marketing specialist he needs to lean some basic IT skills in order to deliver superb work. According to him, things like Search Engine Optimization, monitoring competitors' web sites, design some functionality on web site and so on require IT entree-level knowledge. And he asks me what kind knowledge is helpful for him to do his job. I am stunted by his question. It is easy enough to answer, things like HTML, CSS, even Photo-shop are required in some job descriptions. Also, I believe some basic understanding of dynamic web site, static web site is helpful to him. On the other hand, as a techie I still feel my answer is awkward. What is your opinion on this? Always lot of thanks to you guys on SO.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Access or import an Outlook 2003 .pst file without Outlook

  - by Nobler

  I have a 450 meg .pst file (MS Outlook 2003 backup file) saved from a PC before it crashed. I would like to break it up into its components i.e. Save attachments to folders on my PC Paste text-emails into a word processor, etc. But I don't want to buy MS Office Professional 2003 or later solely for importing the .pst into MS Outlook 2003+. Outlook Express cannot import .pst files, only Outlook “proper” can. Is there some free email client out there, e.g. Thunderbird, that can import .pst files? Or is there some other way to access the 450meg file?

  Read the article

• How to set maxLines and ellipsesize of a TextView at the same time.

  - by michael

  I want to limit my text view to have maximum of 6 lines, so I did: <TextView android:id="@+id/toptext" android:layout_width="fill_parent" android:layout_height="wrap_content" android:maxLines="6"/> But when I try to configure it to add '...' when the text is truncated, I add android:ellipsize="end". I do see the ... but then my TextView only has a max line of 2, instead of 6. Can you please how can I make the text view of maximum line of 6 and add '...' when it get truncated? Thank you.

  Read the article

• How to unit test synchronized code

  - by gillJ

  Hi, I am new to Java and junit. I have the following peice of code that I want to test. Would appreciate if you could send your ideas about what's the best way to go about testing it. Basically, the following code is about electing a leader form a Cluster. The leader holds a lock on the shared cache and services of the leader get resumed and disposed if it somehow looses the lock on the cache. How can i make sure that a leader/thread still holds the lock on the cache and that another thread cannot get its services resumed while the first is in execution? public interface ContinuousService { public void resume(); public void pause(); } public abstract class ClusterServiceManager { private volatile boolean leader = false; private volatile boolean electable = true; private List<ContinuousService> services; protected synchronized void onElected() { if (!leader) { for (ContinuousService service : services) { service.resume(); } leader = true; } } protected synchronized void onDeposed() { if (leader) { for (ContinuousService service : services) { service.pause(); } leader = false; } } public void setServices(List<ContinuousService> services) { this.services = services; } @ManagedAttribute public boolean isElectable() { return electable; } @ManagedAttribute public boolean isLeader() { return leader; } public class TangosolLeaderElector extends ClusterServiceManager implements Runnable { private static final Logger log = LoggerFactory.getLogger(TangosolLeaderElector.class); private String election; private long electionWaitTime= 5000L; private NamedCache cache; public void start() { log.info("Starting LeaderElector ({})",election); Thread t = new Thread(this, "LeaderElector ("+election+")"); t.setDaemon(true); t.start(); } public void run() { // Give the connection a chance to start itself up try { Thread.sleep(1000); } catch (InterruptedException e) {} boolean wasElectable = !isElectable(); while (true) { if (isElectable()) { if (!wasElectable) { log.info("Leadership requested on election: {}",election); wasElectable = isElectable(); } boolean elected = false; try { // Try and get the lock on the LeaderElectorCache for the current election if (!cache.lock(election, electionWaitTime)) { // We didn't get the lock. cycle round again. // This code to ensure we check the electable flag every now & then continue; } elected = true; log.info("Leadership taken on election: {}",election); onElected(); // Wait here until the services fail in some way. while (true) { try { Thread.sleep(electionWaitTime); } catch (InterruptedException e) {} if (!cache.lock(election, 0)) { log.warn("Cache lock no longer held for election: {}", election); break; } else if (!isElectable()) { log.warn("Node is no longer electable for election: {}", election); break; } // We're fine - loop round and go back to sleep. } } catch (Exception e) { if (log.isErrorEnabled()) { log.error("Leadership election " + election + " failed (try bfmq logs for details)", e); } } finally { if (elected) { cache.unlock(election); log.info("Leadership resigned on election: {}",election); onDeposed(); } // On deposition, do not try and get re-elected for at least the standard wait time. try { Thread.sleep(electionWaitTime); } catch (InterruptedException e) {} } } else { // Not electable - wait a bit and check again. if (wasElectable) { log.info("Leadership NOT requested on election ({}) - node not electable",election); wasElectable = isElectable(); } try { Thread.sleep(electionWaitTime); } catch (InterruptedException e) {} } } } public void setElection(String election) { this.election = election; } @ManagedAttribute public String getElection() { return election; } public void setNamedCache(NamedCache nc) { this.cache = nc; }

  Read the article

• unsetting application role in classic ASP

  - by user303526

  Hi, I'm trying to unset an application role but have been failing miserably. I was able to get the cookie value after setting (sp_setapprole) the application role. But I haven't been able to use that cookie (type varbinary / byte array) in my query to unset using sp_unsetapprole. If it was any other stored procedure it wouldn't have been a problem. I was able to use Command object and create a parameter which takes data type input of adVarBinary (204) and execute the command line.. but to the Server the query goes as below. exec sp_executesql N'sp_unsetapprole @P1 ',N'@P1 varbinary(36)',0x01000000CD11697F8F0ED3627BC1DAD25FB9CEB3A2EC5B289C658235E510CD9F29230000 Since sp_setapprole and sp_unsetapprole have to be run ad hoc, the sql server is failing to run this line. And I'm finding it hard to append varbinary cookie value to a simple query such as 'sp_unsetapprole ' & varKookie so it runs "directly" on to the server. Any kind of suggestions are welcome. Thanks, Nandagopal

  Read the article

• jquery dialog problem

  - by user403295

  Hi guys, i know this is a very easy thing to implement but when I add a line to add a dialog my actual page disappears. Can anyone tell me what I am doing wrong? $(function(){ //when I open this line, my page disapperars? $("#dialog").dialog({ autoOpen: false, modal: true }); }); /*FUNCTION CLOSED/ <div id="dialog" title="Delete Record" style="display: none"> <p><span style="float:left; margin:0 7px 20px 0;"></span>Are You Sure?</p> </div>

  Read the article

• I have my best computer ideas while sitting in church. You? [closed]

  - by Rolnik

  At the risk of posing a subjective question... Where/when are you when you come up with your best ideas? How do you enter that 'zen' state? Yes... necessarily these have to be computer ideas and not new ideas how to make waffles (unless it involves a CPU). Some kinds of ideas include: New software project; better way to organize data; What would look slick on the internet; How to break into the Coka-Cola mainframe and steal the Coke formula (just kidding) How about it. How/when do you get a load of inspiration/insight?

  Read the article

• ASP.Net Checkbox Doesn't Allow Setting Visible to True

  - by Shawn Steward

  I'm working on an old web application in Visual Studio .Net 2003 (yeeich) and I'm having an issue with a Checkbox that will not set the Visibility to True. It's declared as such: Protected WithEvents chkTraining As System.Web.UI.WebControls.CheckBox and <asp:CheckBox id="chkTraining" runat="server" Visible="False"></asp:CheckBox> When I am debugging through the line that has: chkTraining.Visible = True it goes past it fine, but as I check this value on the very next line, chkTraining.Visible = False. What could possibly be going on here? There's no events firing off or anything else going on... this really is throwing me for a loop. Thanks for your help.

  Read the article

• The type or namespace cannot be found (are you missing a using directive or an assembly reference?)

  - by Kumu

  I get the following error when I try to compile my C# program: The type or namespace name 'Login' could not be found (are you missing a using directive or an assembly reference?) using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Windows.Forms; namespace FootballLeague { public partial class MainMenu : Form { FootballLeagueDatabase footballLeagueDatabase; Game game; Team team; Login login; //Error here public MainMenu() { InitializeComponent(); changePanel(1); } public MainMenu(FootballLeagueDatabase footballLeagueDatabaseIn) { InitializeComponent(); footballLeagueDatabase = footballLeagueDatabaseIn; } private void Form_Loaded(object sender, EventArgs e) { } private void gameButton_Click(object sender, EventArgs e) { int option = 0; changePanel(option); } private void scoreboardButton_Click(object sender, EventArgs e) { int option = 1; changePanel(option); } private void changePanel(int optionIn) { gamePanel.Hide(); scoreboardPanel.Hide(); string title = "Football League System"; switch (optionIn) { case 0: gamePanel.Show(); this.Text = title + " - Game Menu"; break; case 1: scoreboardPanel.Show(); this.Text = title + " - Display Menu"; break; } } private void logoutButton_Click(object sender, EventArgs e) { login = new Login(); login.Show(); this.Hide(); } Login.cs class: using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Windows.Forms; namespace FootballLeagueSystem { public partial class Login : Form { MainMenu menu; public Login() { InitializeComponent(); } private void administratorLoginButton_Click(object sender, EventArgs e) { string username1 = "08247739"; string password1 = "08247739"; if ((userNameTxt.Text.Length) == 0) MessageBox.Show("Please enter your username!"); else if ((passwordTxt.Text.Length) == 0) MessageBox.Show("Please enter your password!"); else if (userNameTxt.Text.Equals("") || passwordTxt.Text.Equals("")) MessageBox.Show("Invalid Username or Password!"); else { if (this.userNameTxt.Text == username1 && this.passwordTxt.Text == password1) MessageBox.Show("Welcome Administrator!", "Administrator Login"); menu = new MainMenu(); menu.Show(); this.Hide(); } } private void managerLoginButton_Click(object sender, EventArgs e) { { string username2 = "1111"; string password2 = "1111"; if ((userNameTxt.Text.Length) == 0) MessageBox.Show("Please enter your username!"); else if ((passwordTxt.Text.Length) == 0) MessageBox.Show("Please enter your password!"); else if (userNameTxt.Text.Equals("") && passwordTxt.Text.Equals("")) MessageBox.Show("Invalid Username or Password!"); else { if (this.userNameTxt.Text == username2 && this.passwordTxt.Text == password2) MessageBox.Show("Welcome Manager!", "Manager Login"); menu = new MainMenu(); menu.Show(); this.Hide(); } } } private void cancelButton_Click(object sender, EventArgs e) { this.Close(); } } } Where is the error? What am I doing wrong?

  Read the article

• PowerShell script halts execution when Windows XP PC is locked

  - by jshin47

  I have the following script that does a continuous ping and reports failures. It works fine, except the loop apparently "suspends" when the computer is locked. I have confirmed this by starting the script, immediately locking the PC, waiting 10 minutes, and seeing how many pings have occurred. It is nowhere near the expected number. What could be the culprit? Write-Host "Entering monitoring loop..." -Background DarkRed $ping = new-object System.Net.NetworkInformation.Ping $count_up = 0 $count_dn = 0 $count_dd = 0 while ($true) { $result = $ping.send("10.1.1.1") if ($result.Status -eq "Success") { $count_up++ $count_dd = 0 } else { $count_dn++ $count_dd++ $this_date = Get-Date Write-Host "VPN ping failed at time " $this_date -Background Magenta if ($count_dd -gt 3) { Write-Host "***VPN is Down***" `a send_mail_notification("VPN is Down", "") } } if ($Host.UI.RawUI.KeyAvailable -and ("q" -eq $Host.UI.RawUI.ReadKey("IncludeKeyUp,NoEcho").Character)) { Write-Host "Exiting monitoring loop..." -Background DarkRed break; } Start-Sleep -m 250 } $total = $count_up + $count_dn $uptime = 100 * $count_up / $total Write-Host $count_up " out of " $total " pings for a " $uptime "% uptime."

  Read the article

• SVN Merge returns nothing...

  - by Mike

  Here is the scenario: Windows Vista environment. SVN version 1.6.11. I'm on my branch directory. I want to update my branch with a particular change from my trunk. Using command line (using SlikSVN) I enter the following and it returns nothing (returns a blank line and no merge occurs): svn merge -r 11846:11891 http://trunk//AppConstants.java When I do the equivalent using Tortoise SVN, it says "Completed" but nothing gets merged either. When I do a svn diff I clearly see the differences I want to merge in from the trunk to my branch. The diff command I am using is svn diff -r 11846:11891 http://trunk//AppConstants.java. Can anyone figure why no merge occurs? Thanks!!!

  Read the article

• Why the different coarse threaded screws?

  - by Luke

  I'm seeing more and more of these screws (pictured below), which are almost triangular. I find I can only put them into Power Supplies and PCI(e) cards in cases, but they will break/strip away if I put them into a hard drive or a standoff for a motherboard Notice the triangular shape on it? On the Root Access chat, I started asking, but no concrete answer yet. I don't assume it's a production flaw, as I've seen hundreds and replaced them with the "proper" round screws. It is coarse-threaded, not fine-threaded (i.e. for a DVD drive or floppy drive). What are they for, and why do we need them instead of the regular round ones?

  Read the article

• How to extract a Sub-Matrix from a Matrix ?

  - by ZaZu

  Hello, I have a matrix in a txt file and I want to load the matrix based on my input of number of rows and columns For example, I have a 5 by 5 matrix in the file. I want to extract a 3 by 3 matrix, how can I do that ? I created a nested loop using : FILE *sample sample=fopen("randomfile.txt","r"); for(i=0;i<rows;i++){ for(j=0;j<cols;j++){ fscanf(sample,"%f",&matrix[i][j]); } fscanf(sample,"\n",&matrix[i][j]); } fclose(sample); Sadly the code does not work .. If I have this matrix : 5.00 4.00 5.00 6.00 5.00 4.00 3.00 25.00 5.00 3.00 4.00 23.00 5.00 2.00 352.00 6.00 And inputting 3 for rows and 3 for columns, I get : 5.00 4.00 5.00 6.00 5.00 4.00 3.00 25.00 5.00 Which is obviously wrong , its reading line by line rather than skipping the unmentioned column ... What am I doing wrong ? Thanks !

  Read the article

• DataGridView: how to focus the whole row instead of a single cell?

  - by Tomas Sedovic

  I'd like to use the DataGridView control as a list with columns. Sort of like ListView in Details mode but I want to keep the DataGridView flexibility. ListView (with Details view and FullRowSelect enabled) highlights the whole line and shows the focus mark around the whole line: DataGridView (with SelectionMode = FullRowSelect) displays focus mark only around a single cell: So, does anyone know of some (ideally) easy way to make the DataGridView row selection look like the ListView one? I'm not looking for a changed behaviour of the control - I only want it to look the same. Ideally, without messing up with the methods that do the actual painting.

  Read the article

• Same Activity called twice... Issue with Multiple AsyncTasks?

  - by stormin986

  I have three simultaneous instances of an AsyncTask for download three files. When two particular ones finish, at the end of onPostExecute() I check a flag set by each, and if both are true, I call startActivity() for the next Activity. I am currently seeing the activity called twice, or something that resembles this type of behavior. Since the screen does that 'swipe left' kind of transition to the next activity, it sometimes does it twice (and when I hit back, it goes back to the same activity). It's obvious two versions of the activity that SHOULD only get called once are being put on the Activity stack. Could this be from both onPostExecute()s executing simultaneously and both checking the flags each other set at the exact same time? This seems extremely unlikely since two processes would have to be running line-by-line in parallel... *EDIT* A lot removed from this question since I was way off in what I thought was wrong. Nonetheless I found the answer here quite useful, so I have edited the question to reflect the useful parts.

  Read the article

• How do I set a variable inside a bash for loop?

  - by Isaac Moore

  I need to set a variable inside of a bash for loop, which for some reason, is not working for me. Here is an excerpt of my script: function unlockBoxAll { appdir=$(grep -i "CutTheRope.app" /tmp/App_list.tmp) for lvl in {0..24} key="UNLOCKED_$box_$lvl" plutil -key "$key" -value "1" "$appdir/../Library/Preferences/com.chillingo.cuttherope.plist" 2>&1> /dev/null successCheck=$(plutil -key "$key" "$appdir/../Library/Preferences/com.chillingo.cuttherope.plist") if [ "$successCheck" -eq "1" ]; then echo "Success! " else echo "Failed: Key is $successCheck " fi done } As you can see, I try to write to a variable inside the loop with: key="UNLOCKED_$box_$lvl" But when I do that, I get this: /usr/bin/cutTheRope.sh: line 23: syntax error near unexpected token `key="UNLOCKED_$box_$lvl"' /usr/bin/cutTheRope.sh: line 23: `key="UNLOCKED_$box_$lvl"' What am I not doing right? Is there another way to do this? Please help, thanks.

  Read the article

• fixed-size tableView cell in iPhone?

  - by SeniorLee

  I want to have all same size(width) cells in tableView no matter what accessory they have. If text in a cell almost fits to a cell, If i click that cell, check mark(accessory at the right) is displayed and some of characters goes to next line. it's annyoing. It's ok to do wordwrap. I can adjust cell's height. But I dont' want a cell displays different number of characters in an line depends on it's clicked or not. How can I do that?? thanks.

  Read the article

• Given two lines on a plane, how to find integer points closest to their interseciton?

  - by Lukasz Lew

  I can't solve it: You are given 8 integers: A, B, C representing a line on a plane with equation A*x + B*y = C a, b, c representing another line x, y representing a point on a plane The two lines are not parallel therefore divide plane into 4 pieces. Point (x, y) lies inside of one these pieces. Problem: Write a fast algorithm that will find a point with integer coordinates in the same piece as (x,y) that is closest to the cross point of the two given lines. Note: This is not a homework, this is old Euler-type task that I have absolutely no idea how to approach.

  Read the article

• Same-directory includes failing on a Fedora server with PHP.

  - by JimmySawczuk

  I have a couple files that look like this: index.php: <?php include('includes/header.php'); ... includes/header.php: <?php include('config.php'); ... The error I get is Warning: require(config.php) [function.require]: failed to open stream: No such file or directory in [dir]/includes/header.php on line 2 Fatal error: require() [function.require]: Failed opening required 'config.php' (include_path='.:/usr/share/pear:/usr/share/php') in [dir]/includes/header.php on line 2 I did some further debugging: when I add the call system('pwd'); to includes/header.php, it shows [dir], where it should say [dir]/includes. Adding the 'includes/' to the include path works, but isn't desirable because that would fail on the production server. The above code works on a production server, and worked fine on my development Fedora server, until I tried to change my development environment so that the Fedora server's document root is a mounted CIFS share. Any ideas? Thanks.

  Read the article

• In python writing from XML to CSV, encoding error

  - by user574435

  Hi, I am trying to convert an XML file to CSV, but the encoding of the XML ("ISO-8859-1") apparently contains characters that are not in the ascii codec which Python uses to write rows. I get the error: Traceback (most recent call last): File "convert_folder_to_csv_PLAYER.py", line 139, in <module> xml2csv_PLAYER(filename) File "convert_folder_to_csv_PLAYER.py", line 121, in xml2csv_PLAYER fout.writerow(row) UnicodeEncodeError: 'ascii' codec can't encode character u'\xe1' in position 4: ordinal not in range(128) I have tried opening the file as follows: dom1 = parse(input_filename.encode( "utf-8" ) ) and I have tried replacing the \xe1 character in each row before it is written. Any suggestions?

  Read the article

< Previous Page | 451 452 453 454 455 456 457 458 459 460 461 462  | Next Page >