Search Results

Search found 33650 results on 1346 pages for 'line break'.

Page 455/1346 | < Previous Page | 451 452 453 454 455 456 457 458 459 460 461 462  | Next Page >

  • How do I do a join in ActiveRecord after records have been returned?

    - by Russ Bradberry
    I am using ActiveRecord in Rails 3 to pull data from two different tables in two different databases. These databases can not join on each other, but I have the need to do a simple join after-the-fact. I would like to preserve the relation so that I can chain it down the line. here is a simplified version of what I am doing browsers = Browser.all # <-- this is fairly small and can reside in memory events = Event.where(:row_date=>Date.today).select(:name, :browser_id) So as you can see, I want to join browsers in on the events relation, where browser_id should equal browsers.name. events is a relation and I can still add clauses to it down the line, so I dont want to run the query on the db just yet. How would I accomplish this?

    Read the article

  • Document.oncontextmenu, component is not available (firefox)

    - by Tom J Nowell
    I have a script for a website, and one of the things ti does right at the end if attempt to disable an anti-right click protection in a website if($("span[class=MembersNameDisplay]").exists()){ var list_row = document.getElementsByTagName('script'); if(list_row != null){ list_row[0].parentNode.removeChild(list_row[0]); } } document.oncontextmenu=new Function("return true"); In google chrome this works, however in firefox with greasemonkey, the last line fails and the protection is not removed. Error: Component is not available Line: 171 How do I fix this, and why does it fail under firefox?

    Read the article

  • KeyError this says that key(partner) is not in dict ?

    - by Ansh Jain
    I am trying to make an chat application using python and django. I almost complete it and its working fine for 8-10 minutes when two persons are chatting after that certain time it shows an error. here is the traceback : - Traceback (most recent call last): File "\Django_chat\django_chat\chat\views.py", line 55, in receive message = chatSession.getMessage(request.session['partner'],request.session['uid'],afterTime) File "C:\Python26\lib\site-packages\django\contrib\sessions\backends\base.py", line 47, in __getitem__ return self._session[key] KeyError: 'partner' here is the receive module :- def receive(request): message received by this user chatSession = chat() data = request.POST afterTime = data['lastMsgTime'] try: message = chatSession.getMessage(request.session['partner'],request.session['uid'],afterTime) except: #partnerId = virtual_users.objects.get(id=request.session['uid']).partner print('there is an error in receive request') traceback.print_exc(file=open("/myapp.log","a")) msg = serializers.serialize("json", message) return HttpResponse(msg) Please Help me :( thanks Ansh J

    Read the article

  • fixed-size tableView cell in iPhone?

    - by SeniorLee
    I want to have all same size(width) cells in tableView no matter what accessory they have. If text in a cell almost fits to a cell, If i click that cell, check mark(accessory at the right) is displayed and some of characters goes to next line. it's annyoing. It's ok to do wordwrap. I can adjust cell's height. But I dont' want a cell displays different number of characters in an line depends on it's clicked or not. How can I do that?? thanks.

    Read the article

  • Postfix + Cpanel compatibility

    - by Mishari
    I am working on a VPS that has cPanel installed and I wanted to install Postfix on it. However I find that cPanel seems to be quite tightly integrated with Exim. I have done a google search but have only found vague statements that says "cPanel does not support postfix" but I haven't found any authoritative sources in this matter. So my question is, what happens if I disable exim entirely and install postfix instead? Will it break cPanel? Will everything run as normal? Update with more questions: Can I leave Exim for cPanel's internal use and use postfix for everything else? If so, what will happen to dovecot?

    Read the article

  • Python Importing object that originates in one module from a different module into a third module

    - by adewinter
    I was reading the sourcode for a python project and came across the following line: from couchexport.export import Format (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/views.py#L1 ) I went over to couchexport/export.py to see what Format was (Class? Dict? something else?). Unfortunately Format isn't in that file. export.py does however import a Format from couchexport.models where there is a Format class (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/models.py#L11). When I open up the original file in my IDE and have it look up the declaration, in line I mentioned at the start of this question, it leads directly to models.py. What's going on? How can an import from one file (export.py) actually be an import from another file (models.py) without being explicitly stated?

    Read the article

  • Loading .sql files from within PHP

    - by Josh Smeaton
    I'm creating an installation script for an application that I'm developing and need to create databases dynamically from within PHP. I've got it to create the database but now I need to load in several .sql files. I had planned to open the file and mysql_query it a line at a time - until I looked at the schema files and realised they aren't just one query per line. So, please.. how do I load an sql file from within PHP? (as phpMyAdmin does with it's import command).

    Read the article

  • How do I set up Scala plugin for NetBeans to copy the Scala runtime library?

    - by Alexey Romanov
    Versions: NetBeans 6.8, Scala Kit 0.16.1 When I compile my project, I get the following output: init: deps-jar: Compiling 2 source files to F:\MyProgramming\NorvigSpellChecker\build\classes compile: Created dir: F:\MyProgramming\NorvigSpellChecker\dist Building jar: F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar Not copying the libraries. To run this application from the command line without Ant, try: java -jar "F:\MyProgramming\NorvigSpellChecker\dist\NorvigSpellChecker.jar" jar: BUILD SUCCESSFUL (total time: 3 seconds) Of course, the libraries should be copied, so I can't actually run it by using this command line. I don't see any options to copy the library in the project configuration. The plugin uses Ant for building, but I don't have any experience with it; presumably it should be easy enough to tell Ant to copy the libraries. Here is build-impl.xml, what should I do in build.xml?

    Read the article

  • Rails 3 beta 1 - Nested layouts - LocalJumpError

    - by Art Shayderov
    Hi Nested layouts do not work in Rails 3. After I hit this I tried Rails Guides Example on a blank project (both ruby 1.9.1 and 1.8.7). LocalJumpError no block given on line <%= yield :stylesheets %. If you remove this line you will get the same error on the next yield statement. Could someone fix(patch) this? It's probably just a matter of calling block_given? in the right place. That would be great. Thanks Added on 4/3: Rails 3 beta 2 released. Problem fixed.

    Read the article

  • How to read tags out of m4a files in .NET?

    - by dkackman
    I've got some heavily modified code that ultimately came from the Windows Media SDK that works great for reading tags out of MP3 and WMV files. Somewhere along the line, Windows Media Player added support for .m4a files (was it in Windows 7?) but the Windows Media API doesn't seem to reflect that addition (or at least IWMMetadataEditor2::OpenEx pukes on an .m4a file). What would be some good C# code or links on how to dig meta data tags out of m4a files? (Google has come up dry on the C# front.) UPDATE AtomicParsley did indeed end being the best approach. Since that code is a command line tool however I ended up having to create a managed wrapper around some of its functionality in order to use in-process. It is posted on google code if anyone else needs such a thing.

    Read the article

  • What is this for an IP in my google app engine log file?

    - by Christian Harms
    I get many normal log lines in my google app engine application. But today I go these instead the 4-part number: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 What is this for an format? ipv6 are 6 numbers, mac address too... Normal logfile line: 187.14.44.208 - - [19/Mar/2010:14:31:35 -0700] "GET /geo_data.js HTTP/1.1" 200 776 "http://www.xxx.com.br/spl19/index.php?refid=gv_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 5.1; pt-BR; rv:1.9.2) Gecko/20100115 Firefox/3.6 (.NET CLR 3.5.30729),gzip(gfe)" This special logfile line: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 - - [18/Mar/2010:17:00:37 -0700] "GET /geo_data.js HTTP/1.1" 500 450 "http://www.xxx.com.br/spl19/index.php?refid=cm_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 6.1; pt-PT; rv:1.9.2) Gecko/20100115 Firefox/3.6,gzip(gfe)"

    Read the article

  • my .jar file won't do anything.

    - by David
    I created a program that more or less holds an array of strings as an object and randomly prints one. so basicaly class Happy { string[] namestrings = new string[#] constructor() { fill with some strings} public static void main (String[]arg) { create instance of class do some junk with it method that prints it } method that prints it {} another method } when i compile and run it on the command line it works fine but when on the comand line i type in jar -cf Happy.jar Fun.class i get a .jar file called Happy and when i click on it i get an error message that reads "the java Jar file happy could not be launched read the consol for possible error messages" I have a mac i'm running lepord if that makes a diference. Whats going on?

    Read the article

  • jQuery each function, getting the data out of it

    - by Ankur
    I am trying to use the jQuery each function (line 5) to display the results of an AJAX call. when I write resultObj.value on line 6 how come I am not getting any data? Am I making a syntax error (I am pretty sure that I must be)? success : function(resultObj) { count = count+1; $(".objHolder").filter("#"+id).append("<table border='1' cellspacing='4' cellpadding='4' class='preTable' id='"+id+"' level='"+count+"'><tr><td class='preItem' id='"+id+"' level='"+count+"'><img src='images/right.jpg' width='16' height='10' /></td><td class='preList'>&nbsp;</td><td class='preHolder' level='"+count+"'>&nbsp;</td></tr></table>"); isClicked[level]="yes"; $.each(resultObj, function(index, value){ $(".preHolder").filter("#"+id).append(resultObj.value); }); } });

    Read the article

  • How to unit test synchronized code

    - by gillJ
    Hi, I am new to Java and junit. I have the following peice of code that I want to test. Would appreciate if you could send your ideas about what's the best way to go about testing it. Basically, the following code is about electing a leader form a Cluster. The leader holds a lock on the shared cache and services of the leader get resumed and disposed if it somehow looses the lock on the cache. How can i make sure that a leader/thread still holds the lock on the cache and that another thread cannot get its services resumed while the first is in execution? public interface ContinuousService { public void resume(); public void pause(); } public abstract class ClusterServiceManager { private volatile boolean leader = false; private volatile boolean electable = true; private List<ContinuousService> services; protected synchronized void onElected() { if (!leader) { for (ContinuousService service : services) { service.resume(); } leader = true; } } protected synchronized void onDeposed() { if (leader) { for (ContinuousService service : services) { service.pause(); } leader = false; } } public void setServices(List<ContinuousService> services) { this.services = services; } @ManagedAttribute public boolean isElectable() { return electable; } @ManagedAttribute public boolean isLeader() { return leader; } public class TangosolLeaderElector extends ClusterServiceManager implements Runnable { private static final Logger log = LoggerFactory.getLogger(TangosolLeaderElector.class); private String election; private long electionWaitTime= 5000L; private NamedCache cache; public void start() { log.info("Starting LeaderElector ({})",election); Thread t = new Thread(this, "LeaderElector ("+election+")"); t.setDaemon(true); t.start(); } public void run() { // Give the connection a chance to start itself up try { Thread.sleep(1000); } catch (InterruptedException e) {} boolean wasElectable = !isElectable(); while (true) { if (isElectable()) { if (!wasElectable) { log.info("Leadership requested on election: {}",election); wasElectable = isElectable(); } boolean elected = false; try { // Try and get the lock on the LeaderElectorCache for the current election if (!cache.lock(election, electionWaitTime)) { // We didn't get the lock. cycle round again. // This code to ensure we check the electable flag every now & then continue; } elected = true; log.info("Leadership taken on election: {}",election); onElected(); // Wait here until the services fail in some way. while (true) { try { Thread.sleep(electionWaitTime); } catch (InterruptedException e) {} if (!cache.lock(election, 0)) { log.warn("Cache lock no longer held for election: {}", election); break; } else if (!isElectable()) { log.warn("Node is no longer electable for election: {}", election); break; } // We're fine - loop round and go back to sleep. } } catch (Exception e) { if (log.isErrorEnabled()) { log.error("Leadership election " + election + " failed (try bfmq logs for details)", e); } } finally { if (elected) { cache.unlock(election); log.info("Leadership resigned on election: {}",election); onDeposed(); } // On deposition, do not try and get re-elected for at least the standard wait time. try { Thread.sleep(electionWaitTime); } catch (InterruptedException e) {} } } else { // Not electable - wait a bit and check again. if (wasElectable) { log.info("Leadership NOT requested on election ({}) - node not electable",election); wasElectable = isElectable(); } try { Thread.sleep(electionWaitTime); } catch (InterruptedException e) {} } } } public void setElection(String election) { this.election = election; } @ManagedAttribute public String getElection() { return election; } public void setNamedCache(NamedCache nc) { this.cache = nc; }

    Read the article

  • Running OpenMPI on Windows XP

    - by iamweird
    Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

    Read the article

  • Given two lines on a plane, how to find integer points closest to their intersection?

    - by Lukasz Lew
    I can't solve it: You are given 8 integers: A, B, C representing a line on a plane with equation A*x + B*y = C a, b, c representing another line x, y representing a point on a plane The two lines are not parallel therefore divide plane into 4 pieces. Point (x, y) lies inside of one these pieces. Problem: Write a fast algorithm that will find a point with integer coordinates in the same piece as (x,y) that is closest to the cross point of the two given lines. Note: This is not a homework, this is old Euler-type task that I have absolutely no idea how to approach. Update: You can assume that the 8 numbers on input are 32-bit signed integers. But you cannot assume that the solution will be 32 bit.

    Read the article

  • update a column in input file by taking value from Database in perl.

    - by Rahul Singh
    input file: 1,a,USA,, 2,b,UK,, 3,c,USA,, i want to update the 4th column in the input file from taking values from one of the table. my code looks like this: my $customer_dbh = DBI-connect("DBI:Oracle:$INST", $USER, $PASS ) or die "Couldn't connect to datbase $INST"; my $cust_smh; print "connected \n "; open FILE , "+$input_file" or die "can't open the input file"; print "echo \n"; while(my $line=) { my @line_a=split(/\,/,$line); my $customer_id=$line_a[3]; print "$customer_id\n"; $cust_smh = $customer_dbh-prepare("SELECT phone_no from book where number = $line_a[0]"); $cust_smh-execute() or die "Couldn't execute stmt, error : $DBI::errstr"; my $number = $cust_smh-fetchrow_array(); $line_a[3]=$number; }

    Read the article

  • Can I test for the end of the content of a text/plain file with Selenium or javascript?

    - by fool4jesus
    I have a page that results in a text/plain file being displayed in the browser that looks like this: ... Admin Site Administration 2010-04-21 22:26:34 [email protected] Test Site Bob Smith 2010-04-21 22:27:09 [email protected] Admin Site Administration 2010-04-21 22:29:26 [email protected] I am trying to write a Selenium test against this that verifies the last line of the file has "[email protected]" at the end. How would you do this? I can't depend on the date/time as this is a login report that is constantly getting updated - all I want is to ensure that the last line ends with that email address. And I can't figure out how to do it using Selenium expressions, DOM, or XPath.

    Read the article

  • Which is more efficient regular expression?

    - by Vagnerr
    I'm parsing some big log files and have some very simple string matches for example if(m/Some String Pattern/o){ #Do something } It seems simple enough but in fact most of the matches I have could be against the start of the line, but the match would be "longer" for example if(m/^Initial static string that matches Some String Pattern/o){ #Do something } Obviously this is a longer regular expression and so more work to match. However I can use the start of line anchor which would allow an expression to be discarded as a failed match sooner. It is my hunch that the latter would be more efficient. Can any one back me up/shoot me down :-)

    Read the article

  • Finding rank of the student -Sql Compact

    - by Jankhana
    I have a table like this : Name Mar1 Mar2 Mar3 Total xxx 80 80 80 240 yyy 60 70 50 180 aaa 85 65 75 225 I wanted to find the rank of the student based on total. I using SQL Compact 3.5 . As we have rank() function in sql server do we have something with which we can find the students rank??? When I used "select Total,rank() over (order by total desc) i1 from stmarks " it's giving error as " Major Error 0x80040E14, Minor Error 25501 select Total,rank() over (order by total desc) i1 from stmarks There was an error parsing the query. [ Token line number = 1,Token line offset = 21,Token in error = over ] " Do Sql Compact support rank() over or is there any another way???

    Read the article

  • Template class implicit copy constructor issues

    - by Nate
    Stepping through my program in gdb, line 108 returns right back to the calling function, and doesn't call the copy constructor in class A, like (I thought) it should: template <class S> class A{ //etc... A( const A & old ){ //do stuff... } //etc... }; template <class T> class B{ //etc... A<T> ReturnsAnA(){ A<T> result; // do some stuff with result return result; //line 108 } //etc... }; Any hints? I've banged my head against the wall about this for 4 hours now, and can't seem to come up with what's happening here.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Kerning problems when drawing text character by character

    - by shekel
    I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

    Read the article

  • zeromq installtion on mac os snow leopard

    - by Ashish
    I have installed zeromq 2.1.11 on mac os x using the steps given on http://www.zeromq.org/area:download Then i installed pyzmq (python bindings ) But i get the following error : import zmq Traceback (most recent call last): File "<pyshell#1>", line 1, in <module> import zmq File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/__init__.py", line 35, in <module> from zmq.utils import initthreads # initialize threads ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so: no matching architecture in universal wrapper

    Read the article

< Previous Page | 451 452 453 454 455 456 457 458 459 460 461 462  | Next Page >