Search Results

Search found 44517 results on 1781 pages for 'google desktop search'.

Page 457/1781 | < Previous Page | 453 454 455 456 457 458 459 460 461 462 463 464  | Next Page >

  • Example of testing a RPC call using GWT-TestCase with GAE

    - by Stephen Cagle
    How is that for a lot of acronyms! I am having trouble testing GWT's RPC mechanism using GWT's GWTTestCase. I created a class for testing using the junitCreator tool included with GWT. I am attempting to test using the built in Google App Engine using the created "hosted mode" testing profile created by junitCreator. When I run the test, I keep getting errors saying things like Starting HTTP on port 0 HTTP listening on port 49569 The development shell servlet received a request for 'greet' in module 'com.google.gwt.sample.stockwatcher.StockWatcher.JUnit.gwt.xml' [WARN] Resource not found: greet; (could a file be missing from the public path or a <servlet> tag misconfigured in module com.google.gwt.sample.stockwatcher.StockWatcher.JUnit.gwt.xml ?) com.google.gwt.user.client.rpc.StatusCodeException: Cannot find resource 'greet' in the public path of module 'com.google.gwt.sample.stockwatcher.StockWatcher.JUnit' I hope that someone somewhere has successfully run junit test (using GWTTestCase or just plain TestCase) that will allow for the testing of gwt RPC. If this is the case, could you please mention the steps you took, or better yet, just post code that works. Thanks.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • GAE formpreview

    - by Niklas R
    I'm trying to enable form preview with Google App Engine. Getting the following error message I suspect being mistaken somewhere: ... handler = handler_class() TypeError: __call__() takes at least 2 arguments (1 given) Can you tell what's wrong with my attempt? Here is some of the code. from django.contrib.formtools.preview import FormPreview class AFormPreview(FormPreview): def done(self, request, cleaned_data): # Do something with the cleaned_data, then redirect # to a "success" page. self.response.out.write('Done!') class AForm(djangoforms.ModelForm): text = forms.CharField(widget=forms.Textarea(attrs={'rows':'11','cols':'70','class':'foo'}),label=_("content").capitalize()) def clean(self): cleaned_data = self.clean_data name = cleaned_data.get("name") if not name: raise forms.ValidationError("No name.") # Always return the full collection of cleaned data. return cleaned_data class Meta: model = A fields = ['category','currency','price','title','phonenumber','postaladress','name','text','email'] #change the order ... ('/aformpreview/([^/]*)', AFormPreview(AForm)), UPDATE: Here's a complete app where the preview is not working. Any ideas are most welcome: import cgi from google.appengine.api import users from google.appengine.ext import db from google.appengine.ext import webapp from google.appengine.ext.webapp import template from google.appengine.ext.webapp.util import run_wsgi_app from google.appengine.ext.db import djangoforms class Item(db.Model): name = db.StringProperty() quantity = db.IntegerProperty(default=1) target_price = db.FloatProperty() priority = db.StringProperty(default='Medium',choices=[ 'High', 'Medium', 'Low']) entry_time = db.DateTimeProperty(auto_now_add=True) added_by = db.UserProperty() class ItemForm(djangoforms.ModelForm): class Meta: model = Item exclude = ['added_by'] from django.contrib.formtools.preview import FormPreview class ItemFormPreview(FormPreview): def done(self, request, cleaned_data): # Do something with the cleaned_data, then redirect # to a "success" page. return HttpResponseRedirect('/') class MainPage(webapp.RequestHandler): def get(self): self.response.out.write('<html><body>' '<form method="POST" ' 'action="/">' '<table>') # This generates our shopping list form and writes it in the response self.response.out.write(ItemForm()) self.response.out.write('</table>' '<input type="submit">' '</form></body></html>') def post(self): data = ItemForm(data=self.request.POST) if data.is_valid(): # Save the data, and redirect to the view page entity = data.save(commit=False) entity.added_by = users.get_current_user() entity.put() self.redirect('/items.html') else: # Reprint the form self.response.out.write('<html><body>' '<form method="POST" ' 'action="/">' '<table>') self.response.out.write(data) self.response.out.write('</table>' '<input type="submit">' '</form></body></html>') class ItemPage(webapp.RequestHandler): def get(self): query = db.GqlQuery("SELECT * FROM Item ORDER BY name") for item in query: self.response.out.write('<a href="/edit?id=%d">Edit</a> - ' % item.key().id()) self.response.out.write("%s - Need to buy %d, cost $%0.2f each<br>" % (item.name, item.quantity, item.target_price)) class EditPage(webapp.RequestHandler): def get(self): id = int(self.request.get('id')) item = Item.get(db.Key.from_path('Item', id)) self.response.out.write('<html><body>' '<form method="POST" ' 'action="/edit">' '<table>') self.response.out.write(ItemForm(instance=item)) self.response.out.write('</table>' '<input type="hidden" name="_id" value="%s">' '<input type="submit">' '</form></body></html>' % id) def post(self): id = int(self.request.get('_id')) item = Item.get(db.Key.from_path('Item', id)) data = ItemForm(data=self.request.POST, instance=item) if data.is_valid(): # Save the data, and redirect to the view page entity = data.save(commit=False) entity.added_by = users.get_current_user() entity.put() self.redirect('/items.html') else: # Reprint the form self.response.out.write('<html><body>' '<form method="POST" ' 'action="/edit">' '<table>') self.response.out.write(data) self.response.out.write('</table>' '<input type="hidden" name="_id" value="%s">' '<input type="submit">' '</form></body></html>' % id) def main(): application = webapp.WSGIApplication( [('/', MainPage), ('/edit', EditPage), ('/items.html', ItemPage), ('/itemformpreview', ItemFormPreview(ItemForm)), ], debug=True) run_wsgi_app(application)

    Read the article

  • A bug in grpah while using google visualization API on IE

    - by gili
    Hi, i'm using google visulization API to build a line chart grapgh. it works fine on FF and Chrome but i'm having problems on IE7: the problem is that the scailing of the x-axis (string) and y-axis (integer) is all wrong. both axis have the same values for some reason, but naturally those valuse are wrong. my code is the following one: var data = new google.visualization.DataTable(); data.addColumn('string', 'Date'); data.addColumn('number', '??????? ???? ??????'); data.addColumn('number', '??????? ??????'); data.addColumn('number', '??????'); data.addColumn('number', '???????'); data.addColumn('number', '???????'); var n = userRightGuessArray.length; data.addRows(userRightGuessArray.length); data.setCell(0, 0, '?? ?????? ??'); data.setCell(0, 1, 0); data.setCell(0, 2, 0); data.setCell(0, 3, 0); data.setCell(0, 4, 0); data.setCell(0, 5, 0); for(var t = 1 ; t // Create and draw the visualization. var chart = new google.visualization.ImageLineChart(document.getElementById('line_div')); chart.draw(data, {width: 400,legend: 'top'/showValueLabels:false/}); thank you for your help, Gili

    Read the article

  • Open Source Mozilla Prism Alternative

    - by Patrick Klingemann
    Here is what I want to do, very simply: I want to put a URL into a Mozilla Prism (or some alternative), then be provided with an icon on my desktop that when I click it a window opens and the page is displayed. The process for this instance of Prism should be completely independent of any other Prism "applications" that are running. Prism looks like it does this exactly, but I'm running Fedora 12 x86_64 and I can't get it to work, so I'm wondering if there are any alternatives to Prism.

    Read the article

  • geocode webservice address parameter written in another language

    - by nicholas
    Dear fellow Programmers, I try to use the following google map webservice in order to locate greek addresses: http://maps.google.com/maps/api/geocode/json?address=??ad?µ?a? 16&sensor=false and it does not work. If I hit the same exactly address but written with latin alphabet characters: maps.google.com/maps/api/geocode/json?address=akadimias 16&sensor=false, it works and returns the right result. Could somebody help with this? (To use this service with greek letters as language parameter) Thank you in advance, Nicholas

    Read the article

  • How to sort linq result by most similarity/equality

    - by aNui
    I want to do a search for Music instruments which has its informations Name, Category and Origin as I asked in my post. But now I want to sort/group the result by similarity/equality to the keyword such as. If I have the list { Drum, Grand Piano, Guitar, Guitarrón, Harp, Piano} << sorted by name and if I queried "p" the result should be { Piano, Grand Piano, Harp } but it shows Harp first because of the source list's sequence and if I add {Grand Piano} to the list and query "piano" the result shoud be like { Piano, Grand Piano } or query "guitar" it should be { Guitar, Guitarrón } here's my code static IEnumerable<MInstrument> InstrumentsSearch(IEnumerable<MInstrument> InstrumentsList, string query, MInstrument.Category[] SelectedCategories, MInstrument.Origin[] SelectedOrigins) { var result = InstrumentsList .Where(item => SelectedCategories.Contains(item.category)) .Where(item => SelectedOrigins.Contains(item.origin)) .Where(item => { if ( (" " + item.Name.ToLower()).Contains(" " + query.ToLower()) || item.Name.IndexOf(query) != -1 ) { return true; } return false; } ) .Take(30); return result.ToList<MInstrument>(); } Or the result may be like my old self-invented algorithm that I called "by order of occurence", that is just OK to me. And the further things to do is I need to search the Name, Category or Origin such as. If i type "Italy" it should found Piano or something from Italy. Or if I type "string" it should found Guitar. Is there any way to do those things, please tell me. Thanks in advance.

    Read the article

  • GWT Query fails second time -only.

    - by Koran
    HI, I have a visualization function in GWT which calls for two instances of the same panels - two queries. Now, suppose one url is A and the other url is B. Here, I am facing an issue in that if A is called first, then both A and B works. If B is called first, then only B works, A - times out. If I call both times A, only the first time A works, second time it times out. If I call B twice, it works both times without a hitch. Even though the error comes at timed out, it actually is not timing out - in FF status bar, it shows till - transferring data from A, and then it gets stuck. This doesnt even show up in the first time query. The only difference between A and B is that B returns very fast, while A returns comparitively slow. The sample code is given below: public Panel(){ Runnable onLoadCallback = new Runnable() { public void run() { Query query = Query.create(dataUrl); query.setTimeout(60); query.send(new Callback() { public void onResponse(QueryResponse response) { if (response.isError()){ Window.alert(response.getMessage()); } } } } VisualizationUtils.loadVisualizationApi(onLoadCallback, PieChart.PACKAGE); } What could be the reason for this? I cannot think of any reason why this should happen? Why is this happening only for A and not for B? EDIT: More research. The query which works all the time (i.e. B is the example URL given in GWT visualization site: see comment [1]). So, I tried in my app engine to reproduce it - the following way s = "google.visualization.Query.setResponse({version:'0.6',status:'ok',sig:'106459472',table:{cols:[{id:'A',label:'Source',type:'string',pattern:''},{id:'B',label:'Percent',type:'number',pattern:'#0.01%'}],rows:[{c:[{v:'Oil'},{v:0.37,f:'37.00%'}]},{c:[{v:'Coal'},{v:0.25,f:'25.00%'}]},{c:[{v:'Natural Gas'},{v:0.23,f:'23.00%'}]},{c:[{v:'Nuclear'},{v:0.06,f:'6.00%'}]},{c:[{v:'Biomass'},{v:0.04,f:'4.00%'}]},{c:[{v:'Hydro'},{v:0.03,f:'3.00%'}]},{c:[{v:'Solar Heat'},{v:0.005,f:'0.50%'}]},{c:[{v:'Wind'},{v:0.003,f:'0.30%'}]},{c:[{v:'Geothermal'},{v:0.002,f:'0.20%'}]},{c:[{v:'Biofuels'},{v:0.002,f:'0.20%'}]},{c:[{v:'Solar photovoltaic'},{v:4.0E-4,f:'0.04%'}]}]}});"; response = HttpResponse(s, content_type="text/plain; charset=utf-8") response['Expires'] = time.strftime('%a, %d %b %Y %H:%M:%S GMT', time.gmtime()) return response Where s is the data when we run the query for B. I tried to add Expires etc too, since that seems to be the only header which has the difference, but now, the query fails all the time. For more info - I am now sending the difference between my server response vs the working server response. They seems to be pretty similar. HTTP/1.0 200 OK Content-Type: text/plain Date: Wed, 16 Jun 2010 11:07:12 GMT Server: Google Frontend Cache-Control: private, x-gzip-ok="" google.visualization.Query.setResponse({version:'0.6',status:'ok',sig:'106459472',table:{cols:[{id:'A',label:'Source',type:'string',pattern:''},{id:'B',label:'Percent',type:'number',pattern:'#0.01%'}],rows:[{c:[{v:'Oil'},{v:0.37,f:'37.00%'}]},{c:[{v:'Coal'},{v:0.25,f:'25.00%'}]},{c:[{v:'Natural Gas'},{v:0.23,f:'23.00%'}]},{c:[{v:'Nuclear'},{v:0.06,f:'6.00%'}]},{c:[{v:'Biomass'},{v:0.04,f:'4.00%'}]},{c:[{v:'Hydro'},{v:0.03,f:'3.00%'}]},{c:[{v:'Solar Heat'},{v:0.005,f:'0.50%'}]},{c:[{v:'Wind'},{v:0.003,f:'0.30%'}]},{c:[{v:'Geothermal'},{v:0.002,f:'0.20%'}]},{c:[{v:'Biofuels'},{v:0.002,f:'0.20%'}]},{c:[{v:'Solar photovoltaic'},{v:4.0E-4,f:'0.04%'}]}]}});Connection closed by foreign host. Mac$ telnet spreadsheets.google.com 80 Trying 209.85.231.100... Connected to spreadsheets.l.google.com. Escape character is '^]'. GET http://spreadsheets.google.com/tq?key=pWiorx-0l9mwIuwX5CbEALA&range=A1:B12&gid=0&headers=-1 HTTP/1.0 200 OK Content-Type: text/plain; charset=UTF-8 Date: Wed, 16 Jun 2010 11:07:58 GMT Expires: Wed, 16 Jun 2010 11:07:58 GMT Cache-Control: private, max-age=0 X-Content-Type-Options: nosniff X-XSS-Protection: 1; mode=block Server: GSE google.visualization.Query.setResponse({version:'0.6',status:'ok',sig:'106459472',table:{cols:[{id:'A',label:'Source',type:'string',pattern:''},{id:'B',label:'Percent',type:'number',pattern:'#0.01%'}],rows:[{c:[{v:'Oil'},{v:0.37,f:'37.00%'}]},{c:[{v:'Coal'},{v:0.25,f:'25.00%'}]},{c:[{v:'Natural Gas'},{v:0.23,f:'23.00%'}]},{c:[{v:'Nuclear'},{v:0.06,f:'6.00%'}]},{c:[{v:'Biomass'},{v:0.04,f:'4.00%'}]},{c:[{v:'Hydro'},{v:0.03,f:'3.00%'}]},{c:[{v:'Solar Heat'},{v:0.005,f:'0.50%'}]},{c:[{v:'Wind'},{v:0.003,f:'0.30%'}]},{c:[{v:'Geothermal'},{v:0.002,f:'0.20%'}]},{c:[{v:'Biofuels'},{v:0.002,f:'0.20%'}]},{c:[{v:'Solar photovoltaic'},{v:4.0E-4,f:'0.04%'}]}]}});Connection closed by foreign host. Also, please note that App engine did not allow the Expires header to go through - can that be the reason? But if that is the reason, then it should not fail if B is sent first and then A. Comment [1] : http://spreadsheets.google.com/tq?key=pWiorx-0l9mwIuwX5CbEALA&range=A1:B12&gid=0&headers=-1

    Read the article

  • geocoder.getFromLocationName returns only null

    - by test
    Hello, I am going out of my mind for the last 2 days with an IllegalArgumentException error i receive in android code when trying to get a coordinates out of an address, or even reverse, get address out of longitude and latitude. this is the code, but i cannot see an error. is a standard code snippet that is easily found on a google search. public GeoPoint determineLatLngFromAddress(Context appContext, String strAddress) { Geocoder geocoder = new Geocoder(appContext, Locale.getDefault()); GeoPoint g = null; try { System.out.println("str addres: " + strAddress); List<Address> addresses = geocoder.getFromLocationName(strAddress, 5); if (addresses.size() > 0) { g = new GeoPoint((int) (addresses.get(0).getLatitude() * 1E6), (int) (addresses.get(0).getLongitude() * 1E6)); } } catch (Exception e) { throw new IllegalArgumentException("locationName == null"); } return g; } These are the permissions from manifest.xml file: <uses-permission android:name="android.permission.INTERNET" /> <uses-permission android:name="android.permission.ACCESS_FINE_LOCATION" /> <uses-permission android:name="android.permission.ACCESS_COARSE_LOCATION" /> <uses-permission android:name="android.permission.ACCESS_MOCK_LOCATION" /> I do have the Google Api key declared too: <uses-library android:name="com.google.android.maps" /> From the code snippet above, geo coder is not null, neither is the address or appContext, and i stumble here: geocoder.getFromLocationName(strAddress, 5); I did a lot of google searching and found nothing that worked, and the most important info i found is this: ""The Geocoder class requires a backend service that is not included in the core android framework." Sooo, i am confuzed now. What do I have to call, import, add, use in code.... to make this work? I am using Google Api2.2, Api level 8. If somebody has found a solution for this, or a pointer for documentation, something that i didn't discover, please let us know. Thank you for your time.

    Read the article

  • Timeout reading verity collection - CF8

    - by Gary
    For a long time now I've been having a problem with using the verity search service bundled with ColdFusion 8. The issue is with timeout errors occurring when perfoming any operation on a collection. It's intermittent, and usually occurs after a few operations have been successfully performed. For instance: If I'm adding records to a collection the first, say 15 records, will go through with no problems, but all subsequent records will timeout until the service is rebooted. I'm on a shared server, Windows 2008, 64bit as far as I know. The error I receive is: "An error occurred while performing an operation in the Search Engine library. Error reading collection information.: com.verity.api.administration.ConfigurationException: java.io.IOException: Read timed out" Having spoken to my hosting company, and after doing some research, it's been suggested that the number of collections on a server may cause this issue. I've reduced the amount of collections I use, and there are currently 39 collections on the server. As I'm on a shared server, I have no control over how many collections other customers use, however I've read that the limit is 128 collections, so I don't see why 39 should cause it to become unusable. The collections aren't big, there's maybe around 5,000 records between all of them. Any ideas?

    Read the article

  • scripting a google docs form submission

    - by justSteve
    I'm trying to create a bookmarklet that parses a page and sends the results to a googledocs spreadsheet via a form that I've defined. The relevent bit of the script is: var form = document.createElement("form"); form.action = "http://spreadsheets.google.com/formResponse?formkey=Fd0SHgwQ3YwSFd5UHZpM1QxMlNOdlE6MA&ifq"; form.method = "POST"; form.id="ss-form"; form.innerHTML = ["<input id='entry_0' name = 'entry.0.single' value = '" + orderDate + "'/>", "<input name = 'entry.2.single' value = '" + email + "'/>", "<input name = 'entry.3.single' value = '" + customerID + "'/>", ].join(""); form.submit(); alert(form.innerHTML); // returns: Nothing is being saved to the form via the bookmarklet - any way to capture google's response in my bookmarklet's code? (fwiw, i've injected jQuery via jQueryify) EDIT: Firebug's Net panel isn't hearing any of the activity triggered by the bookmarklet - How about i approach this from goolgle's viewform method instead of formresponse. The form i'm trying to submit is located at: http://spreadsheets.google.com/viewform?hl=en&formkey=dFd0SHgwQ3YwSFd5UHZpM1QxMlNOdlE6MA How can I go about injecting the script values into that form and then submitting that - again...via script within the bookmarklet that would have been triggered while on the page being parsed?

    Read the article

  • Creating an AJAX Searchable Database.

    - by Austin
    Currently I am using MySQLi to parse a CSV file into a Database, that step has been accomplished. However, My next step would be to make this Database searchable and automatically updated via jQuery.ajax(). Some people suggest that I print out the Database in another page and access it externally. I'm quite new to jquery + ajax so if anyone could point me in the right direction that would be greatly appreciated. I understand that the documentation on ajax should be enough to tell me what I'm looking for but it appears to talk only about retrieving data from an external file, what about from a mysql database? The code so far stands: <head> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script> </head> <body> <input type="text" id="search" name="search" /> <input type="submit" value="submit"> <?php show_source(__FILE__); error_reporting(E_ALL);ini_set('display_errors', '1'); $category = NULL; $mc = new Memcache; $mc->addServer('localhost','11211'); $sql = new mysqli('localhost', 'user', 'pword', 'db'); $cache = $mc->get("updated_DB"); $query = 'SELECT cat,name,web,kw FROM infoDB WHERE cat LIKE ? OR name LIKE ? OR web LIKE ? OR kw LIKE ?'; $results = $sql->prepare($query); $results->bind_param('ssss', $query, $query, $query, $query); $results->execute(); $results->store_result(); ?> </body> </html>

    Read the article

  • Showing each step geocode of directions

    - by Puru puru rin..
    Hello, Google Maps API can build a Direction from a source to a destination. In the following Google's example, each step are published into the HTML code: http://code.google.com/apis/maps/documentation/examples/directions-simple.html I would like to get the Geocoding of each step of this direction, and store them in a array. I believe it's possible, but I don't see how to process. Many Thanks for any answer. Regards

    Read the article

  • OutOfMemoryError trying to upload to Blobstore locally

    - by jeanh
    Hi all, I am trying to set up a basic file upload to blobstore, but I get this OutOfMemoryError: WARNING: Error for /_ah/upload/ aghvbWdkcmVzc3IcCxIVX19CbG9iVXBsb2FkU2Vzc2lvbl9fGMACDA java.lang.OutOfMemoryError: Java heap space at java.util.Arrays.copyOf(Arrays.java:2786) at java.io.ByteArrayOutputStream.write(ByteArrayOutputStream.java:71) at javax.mail.internet.MimeMultipart.readTillFirstBoundary(MimeMultipart.java: 316) at javax.mail.internet.MimeMultipart.parse(MimeMultipart.java:186) at javax.mail.internet.MimeMultipart.getCount(MimeMultipart.java:109) at com.google.appengine.api.blobstore.dev.UploadBlobServlet.handleUpload(UploadBlobServlet.java: 135) at com.google.appengine.api.blobstore.dev.UploadBlobServlet.access $000(UploadBlobServlet.java:72) at com.google.appengine.api.blobstore.dev.UploadBlobServlet $1.run(UploadBlobServlet.java:100) at java.security.AccessController.doPrivileged(Native Method) at com.google.appengine.api.blobstore.dev.UploadBlobServlet.doPost(UploadBlobServlet.java: 98) at javax.servlet.http.HttpServlet.service(HttpServlet.java:713) at javax.servlet.http.HttpServlet.service(HttpServlet.java:806) at org.mortbay.jetty.servlet.ServletHolder.handle(ServletHolder.java: 511); I used the Memory Analyzer on Eclipse and it said that the memory leak suspect is QueuedThreadPool. I found this information about a memory leak bug: http://jira.codehaus.org/browse/JETTY-1188 Has anyone else had this issue? Thanks, Jean

    Read the article

  • Is it possible to search locally in jqGrid with treeGrid installed

    - by Nehu
    I am using jqGrid with treeGrid. I have added a filterToolbar. I would like to search locally instead of having a server call. The treegrid docs say that, "When we initialize the grid and the data is read, the datatype is automatically set to local." So, is it possible to implement local search with treeGrid. I tried the below configuration, but it is resulting in server calls. My Configuration is var grid = $("#grid").jqGrid({ treeGrid: true, treeGridModel: 'adjacency', ExpandColumn: 'businessAreaName', ExpandColClick : true, url:'agileProgramme/records.do', datatype: 'json', mtype: 'GET', colNames:['Id' , 'Business Area' , 'Investment' , 'Org' , 'Goal' ], colModel:[ /*00*/ {name:'agileProgrammeId',index:'agileProgrammeId', width:0, editable:false,hidden:true}, /*01*/ {name:'businessAreaName',index:'businessAreaName', width:160, editable:false}, /*02*/ {name:'programmeName',index:'programmeName', width:150, editable:false, classes:'link'}, /*03*/ {name:'org',index:'org', width:50, editable:false, classes:'orgHierarchy', sortable : false}, /*04*/ {name:'goal',index:'goal', width:70, editable:false} ], treeReader : { level_field: "level", parent_id_field: "parent", leaf_field: "leaf", expanded_field: "expanded" }, autowidth: true, height: 240, pager: '#pager', sortname: 'id', sortorder: "asc", toolbar:[true,"top"], caption:"TableGridDemo", emptyrecords: "Empty records", jsonReader : { root: "rows", page: "page", total: "total", records: "records", repeatitems: false, cell: "cell", id: "agileProgrammeId" } }); And to implement the search toolbar $('#grid').jqGrid('filterToolbar', {stringResult: true,searchOnEnter : true}); Would appreciate any help or any pointer on even if it is possible?

    Read the article

  • How do I set default search conditions with Searchlogic?

    - by Danger Angell
    I've got a search form on this page: http://staging-checkpointtracker.aptanacloud.com/events If you select a State from the dropdown you get zero results because you didn't select one or more Event Division (checkboxes). What I want is to default the checkboxes to "checked" when the page first loads...to display Events in all Divisions...but I want changes made by the user to be reflected when they filter. Here's the index method in my Events controller: def index @search = Event.search(params[:search]) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @events } end end Here's my search form: <% form_for @search do |f| %> <div> <%= f.label :state_is, "State" %> <%= f.select :state_is, ['AK','AL','AR','AZ','CA','CO','CT','DC','DE','FL','GA','HI','IA','ID','IL','IN','KS','KY','LA','MA','MD','ME','MI','MN','MO','MS','MT','NC','ND','NE','NH','NJ','NM','NV','NY','OH','OK','OR','PA','RI','SC','SD','TN','TX','UT','VA','VT','WA','WI','WV','WY'], :include_blank => true %> </div> <div> <%= f.check_box :division_like_any, {:name => "search[:division_like_any][]"}, "Sprint", :checked => true %> Sprint (2+ hours)<br/> <%= f.check_box :division_like_any, {:name => "search[:division_like_any][]"}, "Sport" %> Sport (12+ hours)<br/> <%= f.check_box :division_like_any, {:name => "search[:division_like_any][]"}, "Adventure" %> Adventure (18+ hours)<br/> <%= f.check_box :division_like_any, {:name => "search[:division_like_any][]"}, "Expedition" %> Expedition (48+ hours)<br/> </div> <%= f.submit "Find Events" %> <%= link_to 'Clear', '/events' %> <% end %>

    Read the article

  • What is TombstonedTaskError from App Engine's Task Queue?

    - by dbr
    That does the TombstonedTaskError mean? It is being raised while trying to add a task to the queue, from a cron-job: Traceback (most recent call last): File "/base/python_lib/versions/1/google/appengine/ext/webapp/__init__.py", line 501, in __call__ handler.get(*groups) File "/base/data/home/apps/.../tasks.py", line 132, in get ).add(queue_name = 'userfeedcheck') File "/base/python_lib/versions/1/google/appengine/api/labs/taskqueue/taskqueue.py", line 495, in add return Queue(queue_name).add(self) File "/base/python_lib/versions/1/google/appengine/api/labs/taskqueue/taskqueue.py", line 563, in add self.__TranslateError(e) File "/base/python_lib/versions/1/google/appengine/api/labs/taskqueue/taskqueue.py", line 619, in __TranslateError raise TombstonedTaskError(error.error_detail) TombstonedTaskError Searching the documentation only has the following to say: exception TombstonedTaskError(InvalidTaskError) Task has been tombstoned. ..which isn't particularly helpful. I couldn't find anything useful in the App Engine code either..

    Read the article

  • jquery anchor to html extract

    - by Benjamin Ortuzar
    I would like to implement something similar to the Google quick scroll extension with jquery for the extracts of a search result, so when the full document is opened (within the same website) it gives the user the opportunity to go straight to the extract location. Here is a sample of what I get returned from the search engine when I search for 'food'. <doc> <docid>129305</docid> <title><span class='highlighted'>Food</span></title> <summary> <summarytext>Papers subject to Negative Resolution: 4 <span class='highlighted'>Food</span> <span class='highlighted'>Food</span> Irradiation (England) Regulations 2009 (S.I., 2009, No. 1584), dated 24 June 2009 (by Act), </summarytext> </summary> <paras> <paraitemcount>2</paraitemcount> <para> <paraitem>1</paraitem> <paraid>42</paraid> <pararelevance>100</pararelevance> <paraweights>50</paraweights> <paratext>4 <span class='highlighted'>Food</span></paratext> </para> <para> <paraitem>2</paraitem> <paraid>54</paraid> <pararelevance>100</pararelevance> <paraweights>50</paraweights> <paratext><span class='highlighted'>Food</span> Irradiation (England) Regulations 2009 (S.I., 2009, No. 1584), dated 24 June 2009 (by Act), with an Explanatory Memorandum and an Impact Assessment (</paratext> </para> </paras> </doc> As you see the search engine has returned a document that contains one summary and two extracts. So let's say the user clicks on the second extract in the search resutls page, the browser would open the detailed document in the same website, and would offer the user the possibility to go to the extract as the Google quick scroll extension does. Is there an existing jquery script for this? If not, can you suggest any jquery/javascript code that would simplify my task to implement this. Notes: I can access the extracts from the document details page. I'm aware that the HTML in some cases could be slightly different in the extract than in the details page, finding no match. The search engine does not return where the extract was located. At the moment I'm trying to understand the JS code that the extension uses.

    Read the article

  • Integrate openid4java to GWT Project

    - by Slyker
    Hi, I created an GWT project in eclipse. Now I tried to implement openId with using the openid4java library. I imported the .jar files via properties--java build path: openid4java-0.9.5.jar lib/*.jar In addition I copied the .jar files into the war/WEB-INF/lib directory. The problem at hand comes up when I call the authenticate() method. Then I get a: HTTP ERROR 500 Problem accessing /openid/openid. Reason: access denied (java.lang.RuntimePermission modifyThreadGroup)Caused by:java.security.AccessControlException: access denied (java.lang.RuntimePermission modifyThreadGroup) at java.security.AccessControlContext.checkPermission(Unknown Source) at java.security.AccessController.checkPermission(Unknown Source) at java.lang.SecurityManager.checkPermission(Unknown Source) at com.google.appengine.tools.development.DevAppServerFactory$CustomSecurityManager.checkPermission(DevAppServerFactory.java:166) at com.google.appengine.tools.development.DevAppServerFactory$CustomSecurityManager.checkAccess(DevAppServerFactory.java:191) at java.lang.ThreadGroup.checkAccess(Unknown Source) at java.lang.Thread.init(Unknown Source) at java.lang.Thread.<init>(Unknown Source) at org.apache.commons.httpclient.MultiThreadedHttpConnectionManager$ReferenceQueueThread.<init>(MultiThreadedHttpConnectionManager.java:1039) at org.apache.commons.httpclient.MultiThreadedHttpConnectionManager.storeReferenceToConnection(MultiThreadedHttpConnectionManager.java:164) at org.apache.commons.httpclient.MultiThreadedHttpConnectionManager.access$900(MultiThreadedHttpConnectionManager.java:64) at org.apache.commons.httpclient.MultiThreadedHttpConnectionManager$ConnectionPool.createConnection(MultiThreadedHttpConnectionManager.java:750) at org.apache.commons.httpclient.MultiThreadedHttpConnectionManager.doGetConnection(MultiThreadedHttpConnectionManager.java:469) at org.apache.commons.httpclient.MultiThreadedHttpConnectionManager.getConnectionWithTimeout(MultiThreadedHttpConnectionManager.java:394) at org.apache.commons.httpclient.HttpMethodDirector.executeMethod(HttpMethodDirector.java:152) at org.apache.commons.httpclient.HttpClient.executeMethod(HttpClient.java:396) at org.apache.commons.httpclient.HttpClient.executeMethod(HttpClient.java:324) at org.openid4java.util.HttpCache.head(HttpCache.java:296) at org.openid4java.discovery.yadis.YadisResolver.retrieveXrdsLocation(YadisResolver.java:360) at org.openid4java.discovery.yadis.YadisResolver.discover(YadisResolver.java:229) at org.openid4java.discovery.yadis.YadisResolver.discover(YadisResolver.java:221) at org.openid4java.discovery.yadis.YadisResolver.discover(YadisResolver.java:179) at org.openid4java.discovery.Discovery.discover(Discovery.java:134) at org.openid4java.discovery.Discovery.discover(Discovery.java:114) at org.openid4java.consumer.ConsumerManager.discover(ConsumerManager.java:527) at auth.openid.server.OpenIDServlet.authenticate(OpenIDServlet.java:138) at auth.openid.server.OpenIDServlet.doGet(OpenIDServlet.java:101) at javax.servlet.http.HttpServlet.service(HttpServlet.java:693) at javax.servlet.http.HttpServlet.service(HttpServlet.java:806) at org.mortbay.jetty.servlet.ServletHolder.handle(ServletHolder.java:511) at org.mortbay.jetty.servlet.ServletHandler$CachedChain.doFilter(ServletHandler.java:1166) at com.google.appengine.api.blobstore.dev.ServeBlobFilter.doFilter(ServeBlobFilter.java:51) at org.mortbay.jetty.servlet.ServletHandler$CachedChain.doFilter(ServletHandler.java:1157) at com.google.apphosting.utils.servlet.TransactionCleanupFilter.doFilter(TransactionCleanupFilter.java:43) at org.mortbay.jetty.servlet.ServletHandler$CachedChain.doFilter(ServletHandler.java:1157) at com.google.appengine.tools.development.StaticFileFilter.doFilter(StaticFileFilter.java:122) at org.mortbay.jetty.servlet.ServletHandler$CachedChain.doFilter(ServletHandler.java:1157) at org.mortbay.jetty.servlet.ServletHandler.handle(ServletHandler.java:388) at org.mortbay.jetty.security.SecurityHandler.handle(SecurityHandler.java:216) at org.mortbay.jetty.servlet.SessionHandler.handle(SessionHandler.java:182) at org.mortbay.jetty.handler.ContextHandler.handle(ContextHandler.java:765) at org.mortbay.jetty.webapp.WebAppContext.handle(WebAppContext.java:418) at com.google.apphosting.utils.jetty.DevAppEngineWebAppContext.handle(DevAppEngineWebAppContext.java:70) at org.mortbay.jetty.handler.HandlerWrapper.handle(HandlerWrapper.java:152) at com.google.appengine.tools.development.JettyContainerService$ApiProxyHandler.handle(JettyContainerService.java:349) at org.mortbay.jetty.handler.HandlerWrapper.handle(HandlerWrapper.java:152) at org.mortbay.jetty.Server.handle(Server.java:326) at org.mortbay.jetty.HttpConnection.handleRequest(HttpConnection.java:542) at org.mortbay.jetty.HttpConnection$RequestHandler.headerComplete(HttpConnection.java:923) at org.mortbay.jetty.HttpParser.parseNext(HttpParser.java:547) at org.mortbay.jetty.HttpParser.parseAvailable(HttpParser.java:212) at org.mortbay.jetty.HttpConnection.handle(HttpConnection.java:404) at org.mortbay.io.nio.SelectChannelEndPoint.run(SelectChannelEndPoint.java:409) at org.mortbay.thread.QueuedThreadPool$PoolThread.run(QueuedThreadPool.java:582) Here my servlet source: import com.google.gwt.user.client.rpc.RemoteService; import org.openid4java.OpenIDException; import org.openid4java.consumer.ConsumerException; import org.openid4java.consumer.ConsumerManager; import org.openid4java.consumer.VerificationResult; import org.openid4java.discovery.DiscoveryInformation; import org.openid4java.discovery.Identifier; import org.openid4java.message.AuthRequest; import org.openid4java.message.ParameterList; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import java.io.IOException; import java.text.MessageFormat; import java.util.List; public final class OpenIDServlet extends HttpServlet implements RemoteService { private final ConsumerManager manager; public OpenIDServlet() { try { manager = new ConsumerManager(); } catch (ConsumerException e) { throw new RuntimeException("Error creating consumer manager", e); } } ... private void authenticate(HttpServletRequest request, HttpServletResponse response) throws IOException, ServletException { final String loginString = request.getParameter(nameParameter); try { // perform discovery on the user-supplied identifier List discoveries = manager.discover(loginString); // attempt to associate with the OpenID provider // and retrieve one service endpoint for authentication DiscoveryInformation discovered = manager.associate(discoveries); // obtain a AuthRequest message to be sent to the OpenID provider AuthRequest authReq = manager.authenticate(discovered, "openid", null); // redirect to OpenID for authentication response.sendRedirect(authReq.getDestinationUrl(true)); } catch (OpenIDException e) { throw new ServletException("Login string probably caused an error. loginString = " + loginString, e); } } My question now is: What could be my fault? Did I make any mistakes in importing the openid4java library? (which?) All other methods in the servlet which do not use the openid4java implementation work fine. Thanks, Andreas

    Read the article

  • Solr associations

    - by Tom
    Hi all, The last couple of days we are thinking of using Solr as our search engine of choice. Most of the features we need are out of the box or can be easily configured. There is however one feature that we absolutely need that seems to be well hidden (or missing) in Solr. I'll try to explain with an example. We have lots of documents that are actually businesses: <document> <name>Apache</name> <cat>1</cat> ... </document> <document> <name>McDonalds</name> <cat>2</cat> ... </document> In addition we have another xml file with all the categories and synonyms: <cat id=1> <name>software</name> <synonym>IT<synonym> </cat> <cat id=2> <name>fast food</name> <synonym>restaurant<synonym> </cat> We want to associate both businesses and categories so we can search using the name and/or synonyms of the category. But we do not want to merge these files at indexing time because we should update the categories (adding.remioving synonyms...) without indexing all the businesses again. Is there anything in Solr that does this kind of associations or do we need to develop some specific pieces? All feedback and suggestions are welcome. Thanks in advance, Tom

    Read the article

  • JavaScript multithreading

    - by Krzysztof Hasinski
    I'm working on comparison for several different methods of implementing (real or fake) multithreading in JavaScript. As far as I know only webworkers and Google Gears WorkerPool can give you real threads (ie. spread across multiple processors with real parallel execution). I've found the following methods: switch between tasks using yield() use setInterval() (or other non-blocking function) with threads waiting one for another use Google Gears WorkerPool threads (with plugin) use html5 web workers I read related questions and found several variations of the above methods, but most of those questions are old, so there might be a few new ideas. I'm wondering - how else can you achieve multithreading in JavaScript? Any other important methods? UPDATE: As pointed out in comments what I really meant was concurrency. UPDATE 2: I found information that Silverlight + JScript supports multithreading, but I'm unable to verify this. UPDATE 3: Google deprecated Gears: http://code.google.com/apis/gears/api_workerpool.html

    Read the article

  • Will rel=canonical break site: queries ?

    - by Justin Grant
    Our company publishes our software product's documentation using a custom-built content management system using a dynamic URL namespace like this: http://ourproduct.com/documentation/version/pageid Where "version" is the version number to which the documentation applies, and "pageid" is a unique string which identifies that page in our back-end content management system. For example, if content (e.g. a page about configuration best practices) is unchanged from version 3.0 and 4.0 of our product, it'd be reachable by two different URLs: http://ourproduct.com/documentation/3.0/configuration-best-practices http://ourproduct.com/documentation/4.0/configuration-best-practices This URL scheme allows us to scope Google search results to see only documentaiton for a particular product version, like this: configuration site:ourproduct.com/documentation/4.0 But when the user is searching across all versions, we don't want Google to arbitrarily choose one of the URLs to show in results. Instead, we always want the latest version to show up. Hence our planned use of rel=canonical so we can proscriptively tell Google which URL we want to show up if multiple versions are being searched. (Users who do oddball things like searching 2 versions but not all of them are a corner case, so we don't care which version(s) show up in that case-- the primary use-cases we care about is searching one version or searching all versions) But what will happen to scoped searches if we do this? If my rel=canonical URL points to version 4.0, but my search is scoped to 3.0, will Google return a result? Even if you don't know the answer offhand, do you know a site which uses rel=canonical to redirect across folders in a URL namespace. If so, I could run a few Google searches and figure out the answer.

    Read the article

  • What is a great tool for remote pair development?

    - by Haim Bender
    I'm looking for something like VNC, but with some extra features: The server should send only the part of the screen the client is looking at. It would be great if we could have 2 mice on the client's desktop. Or at least if the client could point to somthing without interrupting the server's mouse. A shared whiteboard would be great. Some extra notes: My friend lives far away, and we are using WinXP.

    Read the article

< Previous Page | 453 454 455 456 457 458 459 460 461 462 463 464  | Next Page >