Search Results

Search found 36102 results on 1445 pages for 'text replacement'.

Page 46/1445 | < Previous Page | 42 43 44 45 46 47 48 49 50 51 52 53  | Next Page >

  • After Adding "readonly" attribute on text box not able to remove it in one event

    - by Sreedhar K
    Steps to repro USE Internet Explorer Check unlimited check box Click on text box (It will remove tick/check from check box) Try to enter text in text box We cannot enter in the text box 4. Click again on the text box. Now we will be able to enter text in the text box We tried by 1. Making attribute readOnly to flase i.e. $('#myinput').attr('readOnly', false); 2. Calling $('#myinput').click(); Below is the HTML code <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Make input read only</title> <script type="text/javascript" src="http://ajax.microsoft.com/ajax/jquery/jquery-1.4.4.min.js"></script> </head> <body> <input id="myinput" type="text" /> <input id="mycheck" type="checkbox" /> <script type="text/javascript"> /*oncheck box click*/ $('#mycheck').click(function () { if ($(this).attr('checked')) { $('#myinput').attr('readOnly', 'readOnly'); } else { $('#myinput').removeAttr('readOnly'); /* also tried * $('#myinput').attr('readOnly', false); * $('#myinput').attr('readOnly', ''); */ } }); /*on text box click*/ $('#myinput').click(function () { $('#mycheck').removeAttr('checked'); $('#myinput').removeAttr('readOnly'); /* also tried * $('#myinput').attr('readOnly', false); * $('#myinput').attr('readOnly', ''); */ }); </script> </body> </html> Live copy

    Read the article

  • MS Query Analizer/Management Studio replacement?

    - by kprobst
    I've been using SQL Server since version 6.5 and I've always been a bit amazed at the fact that the tools seem to be targeted to DBAs rather than developers. I liked the simplicity and speed of the Query Analizer for example, but hated the built-in editor, which was really no better than a syntax coloring-capable Notepad. Now that we have Management Studio the management part seems a bit better but from a developer standpoint the tools is even worse. Visual Studio's excellent text editor... without a way to customize keyboard bindings!? Don't get me started on how unusable is the tree-based management hierarchy. Why can't I re-root the tree on a list of stored procs for example the way the Enterprise Manager used to allow? Now I have a treeview that needs to be scrolled horizontally, which makes it eminently useless. The SQL server support in Visual Studio is fantastic for working with stored procedures and functions, but it's terrible as a general ad hoc data query tool. I've tried various tools over the years but invariably they seem to focus on the management side and shortchange the developer in me. I just want something with basic admin capabilities, good keyboard support and requisite DDL functionality (ideally something like the Query Analyzer). At this point I'm seriously thinking of using vim+sqlcmd and a console... I'm that desperate :) Those of you who work day in and day out with SQL Server and Visual Studio... do you find the tools to be adequate? Have you ever wished they were better and if you have found something better, could you share please? Thanks!

    Read the article

  • jQuery replacement for javascript confirm

    - by dcp
    Let's say I want to prompt the user before allowing them to save a record. So let's assume I have the following button defined in the markup: <asp:Button ID="btnSave" runat="server" OnClick="btnSave_Click"></asp:Button> To force a prompt with normal javascript, I could wire the OnClick event for my save button to be something like this (I could do this in Page_Load): btnSave.Attributes.Add("onclick", "return confirm('are you sure you want to save?');"); The confirm call will block until the user actually presses on of the Yes/No buttons, which is the behavior I want. For the jquery dialog that is the equivalent, I tried something like this (see below). But the problem is that unlike javascript confirm(), it's going to get all the way through this function (displayYesNoAlert) and then proceed into my btnSave_OnClick method on the C# side. I need a way to make it "block", until the user presses the Yes or No button, and then return true or false so the btnSave_OnClick will be called or not called depending on the user's answer. Currently, I just gave up and went with javascript's confirm, I just wondered if there was a way to do it. function displayYesNoAlert(msg, closeFunction) { dialogResult = false; // create the dialog if it hasn't been instantiated if (!$("#dialog-modal").dialog('isOpen') !== true) { // add a div to the DOM that will store our message $("<div id=\"dialog-modal\" style='text-align: left;' title='Alert!'>").appendTo("body"); $("#dialog-modal").html(msg).dialog({ resizable: true, modal: true, position: [300, 200], buttons: { 'Yes': function () { dialogResult = true; $(this).dialog("close"); }, 'No': function () { dialogResult = false; $(this).dialog("close"); } }, close: function () { if (closeFunction !== undefined) { closeFunction(); } } }); } $("#dialog-modal").html(msg).dialog('open'); }

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • c# warn if text box is empty or contains a non-whole number

    - by Jamaul Smith
    In my specific case, I need the value in propertyPriceTextBox to be numeric only, and a whole number. A value also has to be entered, and I can just Messagebox.Show() a warning and that's all I'd need to do. This is what I have so far. private void computeButton_Click(object sender, EventArgs e) { decimal propertyPrice; if ((decimal.TryParse(propertyPriceTextBox.Text, out propertyPrice))) decimal.Parse(propertyPriceTextBox.Text); { if (residentialRadioButton.Checked == true) commisionLabel.Text = (residentialCom * propertyPrice).ToString("c"); if (commercialRadioButton.Checked == true) commisionLabel.Text = (commercialCom * propertyPrice).ToString("c"); if (hillsRadioButton.Checked == true) countySalesTaxTextBox.Text = ( hilssTax * propertyPrice).ToString("c"); if (pascoRadioButton.Checked == true) countySalesTaxTextBox.Text = (pascoTax * propertyPrice).ToString("c"); if (polkRadioButton.Checked == true) countySalesTaxTextBox.Text = (polkTax * propertyPrice).ToString("c"); decimal result; result = (countySalesTaxTextBox.Text + stateSalesTaxTextBox.Text + propertyPriceTextBox.Text + comissionTextBox.Text).ToString("c"); } else (.) MessageBox.Show("Property Price must be a whole number."); }

    Read the article

  • Is C# development effectively inseparable from the IDE you use?

    - by Ghopper21
    I'm a Python programmer learning C# who is trying to stop worrying and just love C# for what it is, rather than constantly comparing it back to Python. I'm really get caught up on one point: the lack of explicitness about where things are defined, as detailed in this Stack Overflow question. In short: in C#, using foo doesn't tell you what names from foo are being made available, which is analogous to from foo import * in Python -- a form that is discouraged within Python coding culture for being implicit rather than the more explicit approach of from foo import bar. I was rather struck by the Stack Overflow answers to this point from C# programmers, which was that in practice this lack of explicitness doesn't really matter because in your IDE (presumably Visual Studio) you can just hover over a name and be told by the system where the name is coming from. E.g.: Now, in theory I realise this means when you're looking with a text editor, you can't tell where the types come from in C#... but in practice, I don't find that to be a problem. How often are you actually looking at code and can't use Visual Studio? This is revelatory to me. Many Python programmers prefer a text editor approach to coding, using something like Sublime Text 2 or vim, where it's all about the code, plus command line tools and direct access and manipulation of folders and files. The idea of being dependent on an IDE to understand code at such a basic level seems anathema. It seems C# culture is radically different on this point. And I wonder if I just need to accept and embrace that as part of my learning of C#. Which leads me to my question here: is C# development effectively inseparable from the IDE you use?

    Read the article

  • SQL 05 full-text query fails "Specified module could not be found."

    - by Dan Bailiff
    I'm running SQL 2005 on Windows XP. I have a database table that has full text searching enabled. I was able to build and even re-build the index. However, when I try to query it like this: Select * from fulltext_english WHERE CONTAINS(page_data, 'causes') I get this error: Msg 7619, Level 16, State 1, Line 1 The execution of a full-text query failed. "The specified module could not be found." Did I miss something on the install? Is this a dll issue? I've googled and binged for days and can't find anything similar to this message. Thanks!

    Read the article

  • Changing the Settings item description text color in Android?

    - by Cori
    I use a Samsung Vibrant, and one of the annoying bits that Samsung tossed on their TouchWiz skin was changing the color of the Settings menu item description text from white (AOSP) to light blue. This looks okay as long as the skin is bluey-themed, but most ROMs seem to be leaning toward Gingerbread clones... doesn't look good with the green. How can I change that settings description font color back to white, or even the orange it is in actual Android 2.3? Which xml file is the color property located in? It seems to also spread to all apps you install, too... the blue text.

    Read the article

  • what is a fast way to output h5py dataset to text?

    - by user362761
    I am using the h5py python package to read files in HDF5 format. (e.g. somefile.h5) I would like to write the contents of a dataset to a text file. For example, I would like to create a text file with the following contents: 1,20,31,75,142,324,78,12,3,90,8,21,1 I am able to access the dataset in python using this code: import h5py f = h5py.File('/Users/Me/Desktop/thefile.h5', 'r') group = f['/level1/level2/level3'] dset = group['dsetname'] My naive approach is too slow, because my dataset has over 20000 entries: # write all values to file for index in range(len(dset)): # do not add comma after last value if index == len(dset)-1: txtfile.write(repr(dset[index])) else: txtfile.write(repr(dset[index])+',') txtfile.close() return None Is there a faster way to write this to a file? Perhaps I could convert the dataset into a NumPy array or even a Python list, and then use some file-writing tool? (I could experiment with concatenating the values into a larger string before writing to file, but I'm hoping there's something entirely more elegant)

    Read the article

  • Bash: any command to replace strings in text files?

    - by mikez302
    I have a hierarchy of directories containing many text files. I would like to search for a particular text string every time it comes up in one of the files, and replace it with another string. For example, I may want to replace every occurrence of the string "Coke" with "Pepsi". Does anyone know how to do this? I am wondering if there is some sort of Bash command that can do this without having to load all these files in an editor, or come up with a more complex script to do it. I found this page explaining a trick using sed, but it doesn't seem to work in files in subdirectories.

    Read the article

  • Is there a Windows utility that will let me do multiple programmatic find/replaces on text that I cu

    - by billmaya
    I've inherited some C# code that contains about a thousand lines of source that I need to modify, transforming it from this: newDataRow["to_dir"] = comboBox108.Text; To this: assetAttributes.Add("to_dir", comboBox108.Text); The lines occur in various places throughout the application in groups of 40 or 50. Modifying each line by hand in Visual Studio 2008 can be done but it's labor intensive and prone to errors. Is there a Windows utility out there that will let me cut and paste groups of code into it and then run some sort of reg-ex expression to transform the individual lines one-by-one? I'd also be willing to use some sort of VS 2008 add-in that performed the same set of reg-ex operations against a selection of code. Thanks in advance.

    Read the article

  • How to stop jQuery from returning tabs and spaces from formated code on .html() .val() .text() etc.

    - by brandonjp
    I've got an html table: <table><tr> <td>M1</td> <td>M2</td> <td>M3</td> <td>M4</td> </tr></table> and a simple jQ script: $('td').click(function(){ alert( $(this).html() ); }); That works just fine.... but in the real world, I've got several hundred table cells and the code is formatted improperly in places because of several people editing the page. So if the html is: <td> M1 </td> then the alert() is giving me all the tabs and returns and spaces: What can I do to get ONLY the text without the tabs and spaces? I've tried .html(), .val(), .text() to no avail. Thanks!

    Read the article

  • Replace umlaute (äüö) for SEO link in rails - best way

    - by ole_berlin
    Hi, I'm using the permalink_fu plugin to create permalinks from titles. My problem is: If the title contains german characters, they are just replaced with '_'. What I need is something that replaces ä with ae ü with ue ö with oe I fount String.tr but the problem here is that it replaces 1 character with 1 replacement, so it would work for replacing é with e ø with o etc. Does anyone have a nice and clean solution for that? Thanks

    Read the article

  • Mediawiki authenication replacement showing "Login Required" instead of signing user into wiki

    - by arcdegree
    I'm fairly to MediaWiki and needed a way to automatically log users in after they authenticated to a central server (which creates a session and cookie for applications to use). I wrote a custom authentication extension based off of the LDAP Authentication extension and a few others. The extension simply needs to read some session data to create or update a user and then log them in automatically. All the authentication is handled externally. A user would not be able to even access the wiki website without logging in externally. This extension was placed into production which replaced the old standard MediaWiki authentication system. I also merged user accounts to prepare for the change. By default, a user must be logged in to view, edit, or otherwise do anything in the wiki. My problem is that I found if a user had previously used the built-in MediaWiki authentication system and returned to the wiki, my extension would attempt to auto-login the user, however, they would see a "Login Required" page instead of the page they requested like they were an anonymous user. If the user then refreshed the page, they would be able to navigate, edit, etc. From what I can tell, this issue resolves itself after the UserID cookie is reset or created fresh (but has been known to strangely come up sometimes). To replicate, if there is an older User ID in the "USERID" cookie, the user is shown the "Login Required" page which is a poor user experience. Another way of showing this page is by removing the user account from the database and refreshing the wiki page. As a result, the user will again see the "Login Required" page. Does anyone know how I can use debugging to find out why MediaWiki thinks the user is not signed in when the cookies are set properly and all it takes is a page refresh? Here is my extension (simplified a little for this post): <?php $wgExtensionCredits['parserhook'][] = array ( 'name' => 'MyExtension', 'author' => '', ); if (!class_exists('AuthPlugin')) { require_once ( 'AuthPlugin.php' ); } class MyExtensionPlugin extends AuthPlugin { function userExists($username) { return true; } function authenticate($username, $password) { $id = $_SESSION['id']; if($username = $id) { return true; } else { return false; } } function updateUser(& $user) { $name = $user->getName(); $user->load(); $user->mPassword = ''; $user->mNewpassword = ''; $user->mNewpassTime = null; $user->setRealName($_SESSION['name']); $user->setEmail($_SESSION['email']); $user->mEmailAuthenticated = wfTimestampNow(); $user->saveSettings(); return true; } function modifyUITemplate(& $template) { $template->set('useemail', false); $template->set('remember', false); $template->set('create', false); $template->set('domain', false); $template->set('usedomain', false); } function autoCreate() { return true; } function disallowPrefsEditByUser() { return array ( 'wpRealName' => true, 'wpUserEmail' => true, 'wpNick' => true ); } function allowPasswordChange() { return false; } function setPassword( $user, $password ) { return false; } function strict() { return true; } function initUser( & $user ) { } function updateExternalDB( $user ) { return false; } function canCreateAccounts() { return false; } function addUser( $user, $password ) { return false; } function getCanonicalName( $username ) { return $username; } } function SetupAuthMyExtension() { global $wgHooks; global $wgAuth; $wgHooks['UserLoadFromSession'][] = 'Auth_MyExtension_autologin_hook'; $wgHooks['UserLogoutComplete'][] = 'Auth_MyExtension_UserLogoutComplete'; $wgHooks['PersonalUrls'][] = 'Auth_MyExtension_personalURL_hook'; $wgAuth = new MyExtensionPlugin(); } function Auth_MyExtension_autologin_hook($user, &$return_user ) { global $wgUser; global $wgAuth; global $wgContLang; wfSetupSession(); // Give us a user, see if we're around $tmpuser = new User() ; $rc = $tmpuser->newFromSession(); $rc = $tmpuser->load(); if( $rc && $rc->isLoggedIn() ) { if ( $rc->authenticate($rc->getName(), '') ) { return true; } else { $rc->logout(); } } $id = trim($_SESSION['id']); $name = ucfirst(trim($_SESSION['name'])); if (empty($dsid)) { $result = false; // Deny access return true; } $user = User::newFromName($dsid); if (0 == $user->getID() ) { // we have a new user to add... $user->setName( $id); $user->addToDatabase(); $user->setToken(); $user->saveSettings(); $ssUpdate = new SiteStatsUpdate( 0, 0, 0, 0, 1 ); $ssUpdate->doUpdate(); } else { $user->saveToCache(); } // update email, real name, etc. $wgAuth->updateUser( $user ); $result = true; // Go ahead and log 'em in $user->setToken(); $user->saveSettings(); $user->setupSession(); $user->setCookies(); return true; } function Auth_MyExtension_personalURL_hook(& $personal_urls, & $title) { global $wgUser; unset( $personal_urls['mytalk'] ); unset($personal_urls['Userlogin']); $personal_urls['userpage']['text'] = $wgUser->getRealName(); foreach (array('login', 'anonlogin') as $k) { if (array_key_exists($k, $personal_urls)) { unset($personal_urls[$k]); } } return true; } function Auth_MyExtension_UserLogoutComplete(&$user, &$inject_html, $old_name) { setcookie( $GLOBALS['wgCookiePrefix'] . '_session', '', time() - 3600, $GLOBALS['wgCookiePath']); setcookie( $GLOBALS['wgCookiePrefix'] . 'UserName', '', time() - 3600, $GLOBALS['wgCookiePath']); setcookie( $GLOBALS['wgCookiePrefix'] . 'UserID', '', time() - 3600, $GLOBALS['wgCookiePath']); setcookie( $GLOBALS['wgCookiePrefix'] . 'Token', '', time() - 3600, $GLOBALS['wgCookiePath']); return true; } ?> Here is part of my LocalSettings.php file: ############################# # Disallow Anonymous Access ############################# $wgGroupPermissions['*']['read'] = false; $wgGroupPermissions['*']['edit'] = false; $wgGroupPermissions['*']['createpage'] = false; $wgGroupPermissions['*']['createtalk'] = false; $wgGroupPermissions['*']['createaccount'] = false; $wgShowIPinHeader = false; # For non-logged in users ############################# # Extension: MyExtension ############################# require_once("$IP/extensions/MyExtension.php"); $wgAutoLogin = true; SetupAuthMyExtension(); $wgDisableCookieCheck = true;

    Read the article

  • Can't change text color in Microsoft Word 2010

    - by Wesley
    I have Microsoft Office 2010 32-bit running on Windows 7 32-bit. When text is highlighted and a color is selected from the mini-toolbar or the ribbon, the text does not change color. If I change the color for multiple words, and select a different color for each word, the toolbar and ribbon will reflect each of the different colors that I chose, however it is not displayed in the document. So it appears that Word is aware of the text color and not as if it is simply not applying the change. What may be causing this inability to view text colors and how might I fix it? My only troubleshooting attempt so far has been to perform a repair installation of Office. EDIT 1 I created a document, typed a word, selected it and changed the color. I then saved the document as HTML. The text did not change color. This is the HTML in the document: <html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns="http://www.w3.org/TR/REC-html40"> <head> <meta http-equiv=Content-Type content="text/html; charset=windows-1252"> <meta name=ProgId content=Word.Document> <meta name=Generator content="Microsoft Word 14"> <meta name=Originator content="Microsoft Word 14"> <link rel=File-List href="Document_1_files/filelist.xml"> <!--[if gte mso 9]><xml> <o:DocumentProperties> <o:Author>Name</o:Author> <o:LastAuthor>Name</o:LastAuthor> <o:Revision>2</o:Revision> <o:TotalTime>0</o:TotalTime> <o:Created>2012-01-05T21:43:00Z</o:Created> <o:LastSaved>2012-01-05T21:43:00Z</o:LastSaved> <o:Pages>1</o:Pages> <o:Characters>5</o:Characters> <o:Company>Microsoft</o:Company> <o:Lines>1</o:Lines> <o:Paragraphs>1</o:Paragraphs> <o:CharactersWithSpaces>5</o:CharactersWithSpaces> <o:Version>14.00</o:Version> </o:DocumentProperties> <o:OfficeDocumentSettings> <o:AllowPNG/> </o:OfficeDocumentSettings> </xml><![endif]--> <link rel=themeData href="Document_1_files/themedata.thmx"> <link rel=colorSchemeMapping href="Document_1_files/colorschememapping.xml"> <!--[if gte mso 9]><xml> <w:WordDocument> <w:SpellingState>Clean</w:SpellingState> <w:GrammarState>Clean</w:GrammarState> <w:TrackMoves>false</w:TrackMoves> <w:TrackFormatting/> <w:PunctuationKerning/> <w:ValidateAgainstSchemas/> <w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid> <w:IgnoreMixedContent>false</w:IgnoreMixedContent> <w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText> <w:DoNotPromoteQF/> <w:LidThemeOther>EN-US</w:LidThemeOther> <w:LidThemeAsian>X-NONE</w:LidThemeAsian> <w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript> <w:Compatibility> <w:BreakWrappedTables/> <w:SnapToGridInCell/> <w:WrapTextWithPunct/> <w:UseAsianBreakRules/> <w:DontGrowAutofit/> <w:SplitPgBreakAndParaMark/> <w:EnableOpenTypeKerning/> <w:DontFlipMirrorIndents/> <w:OverrideTableStyleHps/> </w:Compatibility> <m:mathPr> <m:mathFont m:val="Cambria Math"/> <m:brkBin m:val="before"/> <m:brkBinSub m:val="&#45;-"/> <m:smallFrac m:val="off"/> <m:dispDef/> <m:lMargin m:val="0"/> <m:rMargin m:val="0"/> <m:defJc m:val="centerGroup"/> <m:wrapIndent m:val="1440"/> <m:intLim m:val="subSup"/> <m:naryLim m:val="undOvr"/> </m:mathPr></w:WordDocument> </xml><![endif]--><!--[if gte mso 9]><xml> <w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true" DefSemiHidden="true" DefQFormat="false" DefPriority="99" LatentStyleCount="267"> <w:LsdException Locked="false" Priority="0" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Normal"/> <w:LsdException Locked="false" Priority="9" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="heading 1"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/> <w:LsdException Locked="false" Priority="39" Name="toc 1"/> <w:LsdException Locked="false" Priority="39" Name="toc 2"/> <w:LsdException Locked="false" Priority="39" Name="toc 3"/> <w:LsdException Locked="false" Priority="39" Name="toc 4"/> <w:LsdException Locked="false" Priority="39" Name="toc 5"/> <w:LsdException Locked="false" Priority="39" Name="toc 6"/> <w:LsdException Locked="false" Priority="39" Name="toc 7"/> <w:LsdException Locked="false" Priority="39" Name="toc 8"/> <w:LsdException Locked="false" Priority="39" Name="toc 9"/> <w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/> <w:LsdException Locked="false" Priority="10" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Title"/> <w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/> <w:LsdException Locked="false" Priority="11" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/> <w:LsdException Locked="false" Priority="22" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Strong"/> <w:LsdException Locked="false" Priority="20" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/> <w:LsdException Locked="false" Priority="59" SemiHidden="false" UnhideWhenUsed="false" Name="Table Grid"/> <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/> <w:LsdException Locked="false" Priority="1" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 1"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 1"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 1"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/> <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/> <w:LsdException Locked="false" Priority="34" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/> <w:LsdException Locked="false" Priority="29" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Quote"/> <w:LsdException Locked="false" Priority="30" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 1"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 1"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 2"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 2"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 2"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 2"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 2"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 3"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 3"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 3"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 3"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 3"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 4"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 4"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 4"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 4"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 4"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 5"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 5"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 5"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 5"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 5"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 6"/> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 6"/> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 6"/> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 6"/> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 6"/> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/> <w:LsdException Locked="false" Priority="19" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/> <w:LsdException Locked="false" Priority="21" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/> <w:LsdException Locked="false" Priority="31" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/> <w:LsdException Locked="false" Priority="32" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/> <w:LsdException Locked="false" Priority="33" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Book Title"/> <w:LsdException Locked="false" Priority="37" Name="Bibliography"/> <w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/> </w:LatentStyles> </xml><![endif]--> <style> <!-- /* Font Definitions */ @font-face {font-family:Calibri; panose-1:2 15 5 2 2 2 4 3 2 4; mso-font-charset:0; mso-generic-font-family:swiss; mso-font-pitch:variable; mso-font-signature:-520092929 1073786111 9 0 415 0;} /* Style Definitions */ p.MsoNormal, li.MsoNormal, div.MsoNormal {mso-style-unhide:no; mso-style-qformat:yes; mso-style-parent:""; margin-top:0in; margin-right:0in; margin-bottom:10.0pt; margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:Calibri; mso-fareast-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} span.GramE {mso-style-name:""; mso-gram-e:yes;} .MsoChpDefault {mso-style-type:export-only; mso-default-props:yes; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:Calibri; mso-fareast-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} .MsoPapDefault {mso-style-type:export-only; margin-bottom:10.0pt; line-height:115%;} @page WordSection1 {size:8.5in 11.0in; margin:1.0in 1.0in 1.0in 1.0in; mso-header-margin:.5in; mso-footer-margin:.5in; mso-paper-source:0;} div.WordSection1 {page:WordSection1;} --> </style> <!--[if gte mso 10]> <style> /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} </style> <![endif]--><!--[if gte mso 9]><xml> <o:shapedefaults v:ext="edit" spidmax="1026"/> </xml><![endif]--><!--[if gte mso 9]><xml> <o:shapelayout v:ext="edit"> <o:idmap v:ext="edit" data="1"/> </o:shapelayout></xml><![endif]--> </head> <body lang=EN-US style='tab-interval:.5in'> <div class=WordSection1> <p class=MsoNormal><o:p>&nbsp;</o:p></p> <p class=MsoNormal><span class=GramE><span style='color:red'>blah</span></span><span style='color:red'><o:p></o:p></span></p> </div> </body> </html> EDIT 2 I recorded a macro and did the following: Typed a word Selected the word Changed the color. Oddly, I had some strange issues while the macro was recorded. I could not select text with my cursor. I had to select the text with control a and then apply the color change. I then couldn't deselect the selected text. Nonetheless, the text showed that it had a different color in the toolbar, but the color did not display in the document. Here's the macro: Sub Change_Text_Color() ' ' Change_Text_Color Macro ' ' Selection.TypeText Text:="Test Text" Selection.WholeStory Selection.WholeStory End Sub EDIT 3 I opened WordPad and created some text and was able to successfully change the color. If I copy and paste the colored text into a Word 2010 document, the color is lost. However, if you place the I-beam in the text and then look at the color selection drop-down menu on the ribbon or mini-toolbar, you can see that the proper color that the text should be in is highlighted. Edit 4 I uninstalled the entire Office 2010 Suite, rebooted and then reinstalled the suite. No change in behavior. Edit 5 Text cannot be colored in Excel either.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • How do I replace the screen of a Dell Ispiron 1545?

    - by Ajus10
    I got a new screen for a Dell Inspiron 1545. The old screen says Dell Inspiron 1545 LP156WH1 (TL)(C1?) HD and the new one says Dell Inspiron 1545 LP156WH1 (TL)(C1?) LCD Does that make a difference? All I can get to work on the new screen is the backlight. The old screen had a crack. Now when I plug the old one in, it will not turn on at all. Could I have blown the inverter or messed up the cable?

    Read the article

  • How long do Lithium Ion batteries normally last?

    - by Zifre
    On the laptop I have, I've had to buy a new Li-Ion batter roughly every year. I do use this computer quite a lot, but I'm wondering if this is normal. Right now, my battery is completely dead (it lasts for about 0.1 seconds), so I plan on buying a new one soon. Is there anything you can do to prevent Li-Ion batteries from going dead so quickly?

    Read the article

  • Laptop battery: is voltage really important to respect?

    - by Marc-Andre R.
    I got an Acer Aspire 5100 and I just bought a new battery (after the stock battery just died yesterday). But I saw something after buying and I'm wondering whether it's really important or not. My stock battery was a 6-cell 4000mah 11.1v and the new battery is an 8-cell 4800mah 14.8v . I know that 8-cell and 4800mah is okay, but what about the 14.8v instead of 11.1v? The battery description says it's compatible with my laptop model (AS5100, model BL51), but the voltage difference makes me wonder. Will the laptop only take what it needs? Or will it be getting 14.8v straight in the brain? I know that my wall plug claims to output 19v, so logically I'm thinking a higher voltage battery shouldn't be a problem. Am I correct in thinking this? Thanks in advance for your answers!

    Read the article

  • Excel Smart Find and Replace only specific characters

    - by Asim
    I want to change INT to INTERNATIONAL and NA to NATIONAL ASSEMBLY in whole excel workbook through an excel Macro or Find and Replace dialogue box. But when I run the macro or change it through Find and Replace dialogue box it also replace NA from CHINA last 2 characters and it became CHINATIONAL ASSEMBLY and INTERIOR to INTERNATIONALERIOR. Now, I want that Excel should only smartly find the character NA in the workbook which is not included with any other character likewise character INT which is not attach to any other character. I would be grateful if anyone give any formula, Excel Macro or anything else to overcome this issue. Thanks,

    Read the article

  • Laptop battery: is voltage really important to respect?

    - by Fox
    I got an Acer Aspire 5100 and I just bought a new battery (after the stock battery just died yesterday). But I saw something after buying and I'm wondering whether it's really important or not. My stock battery was a 6-cell 4000mah 11.1v and the new battery is an 8-cell 4800mah 14.8v . I know that 8-cell and 4800mah is okay, but what about the 14.8v instead of 11.1v? The battery description says it's compatible with my laptop model (AS5100, model BL51), but the voltage difference makes me wonder. Will the laptop only take what it needs? Or will it be getting 14.8v straight in the brain? I know that my wall plug claims to output 19v, so logically I'm thinking a higher voltage battery shouldn't be a problem. Am I correct in thinking this? Thanks in advance for your answers!

    Read the article

  • Utility or technique for swapping files quickly in Windows

    - by foraidt
    I frequently need to swap one file with another, without overwriting the original. Let's say there are two files, foo_new.dll and foo.dll. I usually rename them the follwing way: foo.dll - foo_old.dll, foo_new.dll - foo.dll, [do something with replaced file], foo.dll - foo_new.dll, foo_old.dll - foo.dll. This is ok for a single file to swap but it becomes tedious when swapping multiple files at once. Is there a Windows (7 and preferrably XP) utility or a technique that simplifies this task and works well when swapping multiple files? I'd prefer to be able to use it from within FreeCommander but Windows Explorer would be ok, too.

    Read the article

  • How do I replace the screen of a Dell Inspiron 1545?

    - by Ajus10
    I got a new screen for a Dell Inspiron 1545. The old screen says Dell Inspiron 1545 LP156WH1 (TL)(C1?) HD and the new one says Dell Inspiron 1545 LP156WH1 (TL)(C1?) LCD Does that make a difference? All I can get to work on the new screen is the backlight. The old screen had a crack. Now when I plug the old one in, it will not turn on at all. Could I have blown the inverter or messed up the cable?

    Read the article

  • compatible laptop screens for dv6-1050us

    - by eran
    i have a laptop with 16'' wide screen, but the screen is broken and i want to buy only the screen and replace it.. my laptop is: HP Pavilion dv6-1050us what i know about the screen is that it's model number 512357-001 "16inch widescreen BrightView BV display panel IMR, with web camera and microphone". I did find some screen which seems to be the one but i'm not sure and dont want to spend money for the wrong screen, can any one help please? I search on e-bay for a compatible screen and left with a few questions.. There are some sceens which can be compatible.. they dont mention the specific computer models compatibles.. is all dv6-1000 of hp has the same screen?are all of them compatible? thanks for you help Eran

    Read the article

< Previous Page | 42 43 44 45 46 47 48 49 50 51 52 53  | Next Page >