Search Results

Search found 30023 results on 1201 pages for 'version numbering'.

Page 466/1201 | < Previous Page | 462 463 464 465 466 467 468 469 470 471 472 473  | Next Page >

  • Emulating Test::More::done_testing - what is the most idiomatic way?

    - by DVK
    I have to build unit tests for in environment with a very old version of Test::More (perl5.8 with $Test::More::VERSION being '0.80') which predates the addition of done_testing(). Upgrading to newer Test::More is out of the question for practical reasons. And I am trying to avoid using no_tests - it's generally a bad idea not catching when your unit test dies prematurely. What is the most idiomatic way of running a configurable amount of tests, assuming no no_tests or done_testing() is used? Details: My unit tests usually take the form of: use Test::More; my @test_set = ( [ "Test #1", $param1, $param2, ... ] ,[ "Test #1", $param1, $param2, ... ] # ,... ); foreach my $test (@test_set) { run_test($test); } sub run_test { # $expected_tests += count_tests($test); ok(test1($test)) || diag("Test1 failed"); # ... } The standard approach of use Test::More tests => 23; or BEGIN {plan tests => 23} does not work since both are obviously executed before @tests is known. My current approach involves making @tests global and defining it in the BEGIN {} block as follows: use Test::More; BEGIN { our @test_set = (); # Same set of tests as above my $expected_tests = 0; foreach my $test (@tests) { my $expected_tests += count_tests($test); } plan tests = $expected_tests; } our @test_set; # Must do!!! Since first "our" was in BEGIN's scope :( foreach my $test (@test_set) { run_test($test); } # Same sub run_test {} # Same I feel this can be done more idiomatically but not certain how to improve. Chief among the smells is the duplicate our @test_test declarations - in BEGIN{} and after it.

    Read the article

  • What is the MSBuild equivalent to ant's -project-help?

    - by Jeremy Stein
    I come from an ant background, and I'm starting to use msbuild. I want to create a .proj file with targets for clean, compile, deploy, etc. In ant, I would expect my user to run ant -project-help to get a list of the targets with their descriptions. There doesn't appear to be anything like this with msbuild, so I was thinking of setting DefaultTargets to "Help" and adding this target: <Target Name="Help"> <Message Text="/t:Clean - Remove all bin folders and generated files"/> <Message Text="/t:Compile - Generate assembly"/> <Message Text="/t:Deploy - Install the assembly"/> </Target> When I run msbuild, I see this: Microsoft (R) Build Engine Version 3.5.30729.1 [Microsoft .NET Framework, Version 2.0.50727.3053] Copyright (C) Microsoft Corporation 2007. All rights reserved. Build started 5/13/2010 9:00:00 AM. Project "C:\MyProject\MyProject.proj" on node 0 (default targets). /t:Clean - Remove all bin folders and generated files /t:Compile - Generate assembly /t:Deploy - Install the assembly Done Building Project "C:\MyProject\MyProject.proj" (default targets). Build succeeded. 0 Warning(s) 0 Error(s) Time Elapsed 00:00:00.05 My target description are hidden among all the other output. It feels like I have a paradigm-mismatch here. What's the best way to provide the build functionality I want so that users know where to find each target?

    Read the article

  • How do I get require_login()-like functionality using the new PHP Client Library for Facebook?

    - by cc
    Howdy. I've been tasked with making a Facebook game, but I'm new to Facebook development, so I'm just getting started. Apologies in advance if this is a no-brainer to people. I'm having trouble following all the examples I see on sites, and I keep running into missing pages in the Facebook documentation when I am trying to read up. I think it's because there's a new version of the PHP Client Library for Facebook, and everything I'm finding is referring to the old client. For instance, I see this code in a lot of examples: require 'facebook.php'; $facebook = new Facebook( array( 'appId' => '(id)', 'secret' => '(secret)' ) ); $facebook_account = $facebook->require_login(); ...but there's no "require_login()" in the client library provided in the facebook.php file. From what I can tell, it looks like Facebook has very recently rolled out some new system for development, but I don't see any sample code anywhere to deal with it. The new library comes with an "example.php" file, but it appears to be only for adding "Log in with Facebook" functionality to other sites (what I'm assuming is what they mean by "Facebook Connect" sites), not for just running apps in a Canvas page on Facebook itself. Specifically, what I need to do is let users visit an application page within Facebook, have it bring up the dialog box allowing them to authorize the app, have it show up in their "games" page, and then have it pass me the relevant info about the user so I can start creating the game. But I can't seem to find any tutorials or examples that show how to do this using the new library. Seems like this should be pretty straightforward, but I'm running into roadblocks. Or am I missing something about the PHP client library? Should require_login() be working for me, and there's something broken with my implementation, such as having the wrong client library or something? I downloaded from GitHub yesterday, so I'm pretty sure I have the most recent version of the code I have, but perhaps I'm downloading the wrong "facebook.php" file...?

    Read the article

  • python os.mkfifo() for Windows

    - by user302099
    Hello. Short version (if you can answer the short version it does the job for me, the rest is mainly for the benefit of other people with a similar task): In python in Windows, I want to create 2 file objects, attached to the same file (it doesn't have to be an actual file on the hard-drive), one for reading and one for writing, such that if the reading end tries to read it will never get EOF (it will just block until something is written). I think in linux os.mkfifo() would do the job, but in Windows it doesn't exist. What can be done? (I must use file-objects). Some extra details: I have a python module (not written by me) that plays a certain game through stdin and stdout (using raw_input() and print). I also have a Windows executable playing the same game, through stdin and stdout as well. I want to make them play one against the other, and log all their communication. Here's the code I can write (the get_fifo() function is not implemented, because that's what I don't know to do it Windows): class Pusher(Thread): def __init__(self, source, dest, p1, name): Thread.__init__(self) self.source = source self.dest = dest self.name = name self.p1 = p1 def run(self): while (self.p1.poll()==None) and\ (not self.source.closed) and (not self.source.closed): line = self.source.readline() logging.info('%s: %s' % (self.name, line[:-1])) self.dest.write(line) self.dest.flush() exe_to_pythonmodule_reader, exe_to_pythonmodule_writer =\ get_fifo() pythonmodule_to_exe_reader, pythonmodule_to_exe_writer =\ get_fifo() p1 = subprocess.Popen(exe, shell=False, stdin=subprocess.PIPE, stdout=subprocess.PIPE) old_stdin = sys.stdin old_stdout = sys.stdout sys.stdin = exe_to_pythonmodule_reader sys.stdout = pythonmodule_to_exe_writer push1 = Pusher(p1.stdout, exe_to_pythonmodule_writer, p1, '1') push2 = Pusher(pythonmodule_to_exe_reader, p1.stdin, p1, '2') push1.start() push2.start() ret = pythonmodule.play() sys.stdin = old_stdin sys.stdout = old_stdout

    Read the article

  • How to append new elements to Xml from stream

    - by Wololo
    I have a method which returns some xml in a memory stream private MemoryStream GetXml() { XmlWriterSettings settings = new XmlWriterSettings(); settings.Indent = true; using (MemoryStream memoryStream = new MemoryStream()) { using (XmlWriter writer = XmlWriter.Create(memoryStream, settings)) { writer.WriteStartDocument(); writer.WriteStartElement("root"); writer.WriteStartElement("element"); writer.WriteString("content"); writer.WriteEndElement(); writer.WriteEndElement(); writer.WriteEndDocument(); writer.Flush(); } return memoryStream; } } In this example the format of the xml will be: <?xml version="1.0" encoding="utf-8"?> <root> <element>content</element> </root> How can i insert a new element under the root e.g <?xml version="1.0" encoding="utf-8"?> <root> <element>content</element> ----->New element here <------ </root>

    Read the article

  • Phonegap jqm mixing local and server html files

    - by DavidVdd
    I would like to add some online pages to an application keep them up to date without releasing a new store version. For this I taught I could use jqm ajax navigation to load the external page. (I'm aware that might not be allowed for all platforms.) I have set: $.mobile.allowCrossDomainPages = true; $.mobile.pushStateEnabled = false; This seems to work but the problem is that all my href's and $.mobile.ChangePages would have to be changed to <a href='http://mydomain.com/mypage.html'>link</a> $.mobile.changePage('http://mydomain.com/mypage.html'); in stead of <a href='mypage.html'>link</a> $.mobile.changePage('http://mydomain.com/mypage.html'); I was thinking about overriding the changepage method(found this somewhere) to add a domain when the user is online, but the problem is that this method get's called more then once. var originalChangePage = $.mobile.changePage; $.mobile.changePage = function(to, options) { var o = JSON.stringify(o); try { to = to.replace('file:///android_asset/www/', 'http://mydomain.com/'); } catch (err) { //to isn't always filled in. } originalChangePage(to, options); }; Is there a better way to load html pages locally and online using jqm ajax navigation? Extra info: Phonegap/Cordova version 3.5.0 jqm 1.3.2

    Read the article

  • grailsApplication access in Grails unit Test

    - by Reza
    I am trying to write unit tests for a service which use grailsApplication.config to do some settings. It seems that in my unit tests that service instance could not access the config file (null pointer) for its setting while it could access that setting when I run "run-app". How could I configure the service to access grailsApplication service in my unit tests. class MapCloudMediaServerControllerTests { def grailsApplication @Before public void setUp(){ grailsApplication.config= ''' video{ location="C:\\tmp\\" // or shared filesystem drive for a cluster yamdi{ path="C:\\FFmpeg\\ffmpeg-20121125-git-26c531c-win64-static\\bin\\yamdi" } ffmpeg { fileExtension = "flv" // use flv or mp4 conversionArgs = "-b 600k -r 24 -ar 22050 -ab 96k" path="C:\\FFmpeg\\ffmpeg-20121125-git-26c531c-win64-static\\bin\\ffmpeg" makethumb = "-an -ss 00:00:03 -an -r 2 -vframes 1 -y -f mjpeg" } ffprobe { path="C:\\FFmpeg\\ffmpeg-20121125-git-26c531c-win64-static\\bin\\ffprobe" params="" } flowplayer { version = "3.1.2" } swfobject { version = "" qtfaststart { path= "C:\\FFmpeg\\ffmpeg-20121125-git-26c531c-win64-static\\bin\\qtfaststart" } } ''' } @Test void testMpegtoFlvConvertor() { log.info "In test Mpg to Flv Convertor function!" def controller=new MapCloudMediaServerController() assert controller!=null controller.videoService=new VideoService() assert controller.videoService!=null log.info "Is the video service null? ${controller.videoService==null}" controller.videoService.grailsApplication=grailsApplication log.info "Is grailsApplication null? ${controller.videoService.grailsApplication==null}" //Very important part for simulating the HTTP request controller.metaClass.request = new MockMultipartHttpServletRequest() controller.request.contentType="video/mpg" controller.request.content= new File("..\\MapCloudMediaServer\\web-app\\videoclips\\sample3.mpg").getBytes() controller.mpegtoFlvConvertor() byte[] videoOut=IOUtils.toByteArray(controller.response.getOutputStream()) def outputFile=new File("..\\MapCloudMediaServer\\web-app\\videoclips\\testsample3.flv") outputFile.append(videoOut) } }

    Read the article

  • Unable to retrieve search results from server side : Facebook Graph API usig Python

    - by DjangoRocks
    Hi all, I'm doing some simple Python + FB Graph training on my own, and I faced a weird problem: import time import sys import urllib2 import urllib from json import loads base_url = "https://graph.facebook.com/search?q=" post_id = None post_type = None user_id = None message = None created_time = None def doit(hour): page = 1 search_term = "\"Plastic Planet\"" encoded_search_term = urllib.quote(search_term) print encoded_search_term type="&type=post" url = "%s%s%s" % (base_url,encoded_search_term,type) print url while(1): try: response = urllib2.urlopen(url) except urllib2.HTTPError, e: print e finally: pass content = response.read() content = loads(content) print "==================================" for c in content["data"]: print c print "****************************************" try: content["paging"] print "current URL" print url print "next page!------------" url = content["paging"]["next"] print url except: pass finally: pass """ print "new URL is =======================" print url print "==================================" """ print url What I'm trying to do here is to automatically page through the search results, but trying for content["paging"]["next"] But the weird thing is that no data is returned; i received the following: {"data":[]} Even in the very first loop. But when i copied the URL into a browser, a lot of results were returned. I've also tried a version with my access token and th same thing happens. Can anyone enlighten me? +++++++++++++++++++EDITED and SIMPLIFIED++++++++++++++++++ ok thanks to TryPyPy, here's the simplified and edited version of my previous question: Why is that: import urllib2 url = "https://graph.facebook.com/searchq=%22Plastic+Planet%22&type=post&limit=25&until=2010-12-29T19%3A54%3A56%2B0000" response = urllib2.urlopen(url) print response.read() result in {"data":[]} ? But the same url produces a lot of data in a browser? Anyone? Best Regards.

    Read the article

  • ASP.NET Web Application: use 1 or multiple virtual directories

    - by tster
    I am working on a (largish) internal web application which has multiple modules (security, execution, features, reports, etc.). All the pages in the app share navigation, CSS, JS, controls, etc. I want to make a single "Web Application" project, which includes all the pages for the app, then references various projects which will have the database and business logic in them. However, some of the people on the project want to have separate projects for the pages of each module. To make this more clear, this is what I'm advocating to be the projects. /WebInterface* /SecurityLib /ExecutionLib etc... And here is what they are advocating: /SecurityInterface* /SecutiryLib /ExecutionInterface* /ExecutionLib etc... *project will be published to a virtual directory of IIS Basically What I'm looking for is the advantages of both approaches. Here is what I can think of so far: Single Virtual Directory Pros Modules can share a single MasterPage Modules can share UserControls (this will be common) Links to other modules are within the same Virtual directory, and thus don't need to be fully qualified. Less chance of having incompatible module versions together. Multiple Virtual Directories Pros Can publish a new version of a single module without disrupting other modules Module is more compartmentalized. Less likely that changes will break other modules. I don't buy those arguments though. First, using load balanced servers (which we will have) we should be able to publish new versions of the project with zero downtime assuming there are no breaking database changes. Second, If something "breaks" another module, then there is either an improper dependency or the break will show up eventually in the other module, when the developers copy over the latest version of the UserControl, MasterPage or dll. As a point of reference, there are about 10 developers on the project for about 50% of their time. The initial development will be about 9 months.

    Read the article

  • Drupal view filter to show only one of a certain item

    - by Joel
    I'm fairly new to Drupal, and am using Node Import to take a TSV file and turn it into nodes. I'm hitting a problem, though, with automating updates to the nodes. Again, I'd like to take a Tab Separated Values text file, and load it into my site via Node Import (or whatever else anyone might suggest) and then only show updated Nodes. Here's a specific example: I have a Node with the following info: StoreId Name Address Phone Contact 01 Name1 Address1 Phone1 Contact1 02 Name2 Address2 Phone2 Contact2 etc. The info pulls into the nodes just fine (Thank you Node Import!), but we also want to process updates to the nodes. So far I have two ideas... figure out how to delete duplicate (previous) instances of the same StoreID, or just save the node with the duplicate StoreID (and new other info) and just display the most current version. In Views, I can get it to show the nodes and everything, but I can't figure out how to only display the most recent version of each StoreID. A view of views would work, but I can't seem to get that to work, either. Any ideas or other approaches I could take? Thanks in advance for the help!

    Read the article

  • Fluent NHibernate AutoMap

    - by Markus
    Hi. I have a qouestion regarding the AutoMap xml generation. I have two classes: public class User { virtual public Guid Id { get; private set; } virtual public String Name { get; set; } virtual public String Email { get; set; } virtual public String Password { get; set; } virtual public IList<OpenID> OpenIDs { get; set; } } public class OpenID { virtual public Guid Id { get; private set; } virtual public String Provider { get; set; } virtual public String Ticket { get; set; } virtual public User User { get; set; } } The generated sequences of xml files are: For User class: <bag name="OpenIDs"> <key> <column name="User_Id" /> </key> <one-to-many class="BL_DAL.Entities.OpenID, BL_DAL, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null" /> </bag> For OpenID class: <many-to-one class="BL_DAL.Entities.User, BL_DAL, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null" name="User"> <column name="User_id" /> </many-to-one> I don't see the inverse=true attribute for the User mapping. Is it a normal behavior, or I made a mistake somewhere?

    Read the article

  • xsl:for-each not supported in this context

    - by alexbf
    Hi! I have this XSLT document : <xsl:stylesheet version="1.0" xmlns:mstns="http://www.w3.org/2001/XMLSchema" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output method="xml" version="1.0" encoding="UTF-8" indent="yes"/> <xsl:template match="/MyDocRootElement"> <xs:schema id="DataSet" targetNamespace="http://www.w3.org/2001/XMLSchema" attributeFormDefault="qualified" elementFormDefault="qualified" > <xs:element name="DataSet" msdata:IsDataSet="true"> <xs:complexType> <xs:choice maxOccurs="unbounded"> <xs:element name="Somename"> </xs:element> <xs:element name="OtherName"> </xs:element> <!-- FOR EACH NOT SUPPORTED? --> <xsl:for-each select="OtherElements/SubElement"> <xs:element name="OtherName"> </xs:element> </xsl:for-each> </xs:choice> </xs:complexType> </xs:element> </xs:schema> </xsl:template> </xsl:stylesheet> I have a validation error saying that the "for-each element is not supported in this context" I am guessing it has something to do with the xs namespace validation. Any ideas on how can I make this work? (Exclude validation?) Thanks Alex

    Read the article

  • Casting Type array to Generic array?

    - by George R
    The short version of the question - why can't I do this? I'm restricted to .NET 3.5. T[] genericArray; // Obviously T should be float! genericArray = new T[3]{ 1.0f, 2.0f, 0.0f }; // Can't do this either, why the hell not genericArray = new float[3]{ 1.0f, 2.0f, 0.0f }; Longer version - I'm working with the Unity engine here, although that's not important. What is - I'm trying to throw conversion between its fixed Vector2 (2 floats) and Vector3 (3 floats) and my generic Vector< class. I can't cast types directly to a generic array. using UnityEngine; public struct Vector { private readonly T[] _axes; #region Constructors public Vector(int axisCount) { this._axes = new T[axisCount]; } public Vector(T x, T y) { this._axes = new T[2] { x, y }; } public Vector(T x, T y, T z) { this._axes = new T[3]{x, y, z}; } public Vector(Vector2 vector2) { // This doesn't work this._axes = new T[2] { vector2.x, vector2.y }; } public Vector(Vector3 vector3) { // Nor does this this._axes = new T[3] { vector3.x, vector3.y, vector3.z }; } #endregion #region Properties public T this[int i] { get { return _axes[i]; } set { _axes[i] = value; } } public T X { get { return _axes[0];} set { _axes[0] = value; } } public T Y { get { return _axes[1]; } set { _axes[1] = value; } } public T Z { get { return this._axes.Length (Vector2 vector2) { Vector vector = new Vector(vector2); return vector; } public static explicit operator Vector(Vector3 vector3) { Vector vector = new Vector(vector3); return vector; } #endregion }

    Read the article

  • Why is UseCompatibleTextRendering needed here?

    - by HotOil
    Hi, I think I'm missing something fundamental. Please tell me what it is, if you can. I have developed a little C++ WinForms app using VS2008. So it is built using .NET 3.5 SP1. My development box is Win7, if that matters. The default value of UseCompatibleTextRendering property in WinForms controls is false in this version of VStudio. And this should not matter to me, I don't think. I don't have any custom-drawn text or controls. The app looks good running on my Win7 box. If I package it up (dragging along .NET 3.5) and install it on one of our WinXP desktops, the buttons and labels don't look good; the text is chopped off in them. If I set UseCompatibleTextRendering to true and then run it on the XP boxes, the text fits into the buttons and labels. My question is: Why? The installation puts .Net 3.5 on the XP boxes, so the app should be able to find and use the right version of WinForms, right? I should note that before I put my app + .NET 3.5 on these boxes, they have no .NET at all. They do not get automatic Microsoft updates; our IT guy gates the patches and upgrades. [ This sort of thing has happened before with apps I create.. they look/work great on the Engineering machines, because we maintain those and they mostly have up-to-date stuff. When they are run on the corporate boxes, they usually don't run and need the VCredist installed. ] Back to the question at hand: The text looks better with the UseCompatibleTextRendering set to false, so I'd rather keep it that way, if I can. I'd like to understand what might be missing on those XP boxes that is making the text not fit. Thanks S

    Read the article

  • Can anyone explain this strange behaviour?

    - by partizan
    Hi, guys. Here is the example with comments: class Program { // first version of structure public struct D1 { public double d; public int f; } // during some changes in code then we got D2 from D1 // Field f type became double while it was int before public struct D2 { public double d; public double f; } static void Main(string[] args) { // Scenario with the first version D1 a = new D1(); D1 b = new D1(); a.f = b.f = 1; a.d = 0.0; b.d = -0.0; bool r1 = a.Equals(b); // gives true, all is ok // The same scenario with the new one D2 c = new D2(); D2 d = new D2(); c.f = d.f = 1; c.d = 0.0; d.d = -0.0; bool r2 = c.Equals(d); // false! this is not the expected result } } So, what do you think about this?

    Read the article

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • Load more function in Javascript

    - by erastusnjuki
    EDIT: This question was initially too general, I think. So What I really need is a very good tutorial on how to implement the Load More function on Safari for iPhone just like the Twitter website(mobile.twitter.com) does. Just a wordpress plugin won't really help. But if the plugin is well explained, like if it is wptouch, home(that also has this function) that can also do. I know that it doesn't really matter that it is being displayed on a mobile device, but the point I am stressing is that if such a function is well explained, then it will be up to me to know how to customize it to suit me. I am using a javascript function to load entries that come from the database dynamically, so that content opens in the same page (like with twitter(tweets feed) and facebook(news feed)). The php/html version(That opens a page in a new tab) is echo '<a href="http://'. $_SERVER['HTTP_HOST'] .'/'.$domain_page.'?form='.$form_id.'&page='.($page+1).'">Load more entries&rsaquo; </a>'; The javascript/ajax version: <div id="call_hv<?php echo md5($_SERVER['REQUEST_URI']); ?>" class="ajax-load-more"> <img id="spinner<?php echo md5($_SERVER['REQUEST_URI']); ?>" class="spin" src="<?php bloginfo('template_directory'); ?>/images/main-ajax-loader.gif" style="display:none" alt="" /> <a class="ajax" href="javascript:$ajax_hv('#spinner<?php echo md5($_SERVER['REQUEST_URI']); ?>').fadeIn(200); $ajax_hv('#ajaxentries_hv<?php echo md5($_SERVER['REQUEST_URI']); ?>').load('form='<? echo $form_id; ?>&page=<?php echo $page+1;?>', {}, function(){ $ajax_hv('#call_hv<?php echo md5($_SERVER['REQUEST_URI']); ?>').fadeOut();})">Load more entries... </a>

    Read the article

  • MapView EXC_BAD_ACCESS (SIGSEGV) and KERN_INVALID_ADDRESS

    - by user768113
    I'm having some 'issues' with my application... well, it crashes in an UIViewController that is presented modally, there the user enters information through UITextFields and his location is tracked by a MapView. Lets call this view controller "MapViewController" When the user submits the form, I call a different ViewController - modally again - that processes this info and a third one answers accordingly, then go back to a MenuVC using unwinding segues, which then calls MapViewController and so on. This sequence is repeated many times, but it always crashes in MapViewController. Looking at the crash log, I think that the MapView can be the problem of this or some element in the UI (because of the UIKit framework). I tried to use NSZombie in order to track a memory issue but it doesn't give me a clue about whats happening. Here is the crash log Hardware Model: iPad3,4 Process: MyApp [2253] OS Version: iOS 6.1.3 (10B329) Report Version: 104 Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000044 Crashed Thread: 0 Thread 0 name: Dispatch queue: com.apple.main-thread Thread 0 Crashed: 0 IMGSGX554GLDriver 0x328b9be0 0x328ac000 + 56288 1 IMGSGX554GLDriver 0x328b9b8e 0x328ac000 + 56206deallocated instance 2 IMGSGX554GLDriver 0x328bc2f2 0x328ac000 + 66290 3 IMGSGX554GLDriver 0x328baf44 0x328ac000 + 61252 4 libGPUSupportMercury.dylib 0x370f86be 0x370f6000 + 9918 5 GLEngine 0x34ce8bd2 0x34c4f000 + 629714 6 GLEngine 0x34cea30e 0x34c4f000 + 635662 7 GLEngine 0x34c8498e 0x34c4f000 + 219534 8 GLEngine 0x34c81394 0x34c4f000 + 205716 9 VectorKit 0x3957f4de 0x394c7000 + 754910 10 VectorKit 0x3955552e 0x394c7000 + 582958 11 VectorKit 0x394d056e 0x394c7000 + 38254 12 VectorKit 0x394d0416 0x394c7000 + 37910 13 VectorKit 0x394cb7ca 0x394c7000 + 18378 14 VectorKit 0x394c9804 0x394c7000 + 10244 15 VectorKit 0x394c86a2 0x394c7000 + 5794 16 QuartzCore 0x354a07a4 0x35466000 + 239524 17 QuartzCore 0x354a06fc 0x35466000 + 239356 18 IOMobileFramebuffer 0x376f8fd4 0x376f4000 + 20436 19 IOKit 0x344935aa 0x34490000 + 13738 20 CoreFoundation 0x33875888 0x337e9000 + 575624 21 CoreFoundation 0x338803e4 0x337e9000 + 619492 22 CoreFoundation 0x33880386 0x337e9000 + 619398 23 CoreFoundation 0x3387f20a 0x337e9000 + 614922 24 CoreFoundation 0x337f2238 0x337e9000 + 37432 25 CoreFoundation 0x337f20c4 0x337e9000 + 37060 26 GraphicsServices 0x373ad336 0x373a8000 + 21302 27 UIKit 0x3570e2b4 0x356b7000 + 357044 28 MyApp 0x000ea12e 0xe9000 + 4398 29 MyApp 0x000ea0e4 0xe9000 + 4324 I think thats all, additionally, I would like to ask you: if you are using unwind segues then you are releasing view controllers from the memory heap, right? Meanwhile, performing segues let you instantiate those controllers. Technically, MenuVC should be the only VC alive in the heap during the app life cycle if you understand me.

    Read the article

  • Tracking down slow managed DLL loading

    - by Alex K
    I am faced with the following issue and at this point I feel like I'm severely lacking some sort of tool, I just don't know what that tool is, or what exactly it should be doing. Here is the setup: I have a 3rd party DLL that has to be registered in GAC. This all works fine and good on pretty much every machine our software was deployed on before. But now we got 2 machines, seemingly identical to the ones we know work (they are cloned from the same image and stuffed with the same hardware, so pretty much the only difference is software settings, over which I went over and over, and they seem fine). Now the problem, the DLL in GAC takes a very long time to load. At least I believe this is the issue, what I can say definitively is that instantiating a single class from that DLL is the slow part. Once it is loaded, thing fly as they always have. But while on known-good machines the DLL loads so fast that a timestamp in the log doesn't even change, on these 2 machines it take over 1min to load. Knowns: I have no access to the source, so I can't debug through the DLL. Our app is the only one that uses it (so shouldn't be simultaneous access issues). There is only one version of this DLL in existance, so it shouldn't be a matter of version conflict. The GAC reference is being used (if I uninstall the DLL from GAC, an exception will be thrown about the missing GAC reference). Could someone with a greater skill in debug-fu suggest what I can do to track down the root cause of this issue?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How to save XML file before update?

    - by Robert Iagar
    Right so I have a simple app that consists of a calendar a Set Event button and list box that populates using a DataTemplate in WPF. When I build the app the Events.xml file is like this: <?xml version="1.0" encoding="utf-8" ?> <events> </events> I add events to xml through code. Final structure of the xml file is the following <?xml version="1.0" encoding="utf-8" ?> <events> <event Name="Some Name"> <startDate>20.03.2010</startDate> <endDate>29.03.2010</endDate> </event> </event> Now here's my problem. If I update the app and deploy it with Click Once and the app updates it self, I lose the list because the new file is empty. Any workaround this? Here's how I add the Data: var xDocument = XDocument.Load(@"Data\Events.xml"); xDocument.Root.Add(new XElement("event", new XAttribute("name", event.Name), new XElement("startDate", startDate), new XElement("endDate", endDate) ) ); xDocument.Save(@"Data\Events.xml");

    Read the article

  • Conditional references in .NET project, possible to get rid of warning?

    - by Lasse V. Karlsen
    I have two references to a SQLite assembly, one for 32-bit and one for 64-bit, which looks like this (this is a test project to try to get rid of the warning, don't get hung up on the paths): <Reference Condition=" '$(Platform)' == 'x64' " Include="System.Data.SQLite, Version=1.0.61.0, Culture=neutral, PublicKeyToken=db937bc2d44ff139, processorArchitecture=AMD64"> <SpecificVersion>True</SpecificVersion> <HintPath>..\..\LVK Libraries\SQLite3\version_1.0.65.0\64-bit\System.Data.SQLite.DLL</HintPath> </Reference> <Reference Condition=" '$(Platform)' == 'x86' " Include="System.Data.SQLite, Version=1.0.65.0, Culture=neutral, PublicKeyToken=db937bc2d44ff139, processorArchitecture=x86"> <SpecificVersion>True</SpecificVersion> <HintPath>..\..\LVK Libraries\SQLite3\version_1.0.65.0\32-bit\System.Data.SQLite.DLL</HintPath> </Reference> This produces the following warning: Warning 1 The referenced component 'System.Data.SQLite' could not be found. Is it possible for me to get rid of this warning? One way I've looked at it to just configure my project to be 32-bit when I develop, and let the build machine fix the reference when building for 64-bit, but this seems a bit awkward and probably prone to errors. Any other options? The reason I want to get rid of it is that the warning is apparently being picked up by TeamCity and periodically flagged as something I need to look into, so I'd like to get completely rid of it.

    Read the article

  • Cannot display converted value inside xml field

    - by zurna
    PS: My bad, there was not an error. I forgot to upload the latest version to the server... I have multimedias and images table. I save images in multimedias table with their images table id numbers. Then whenever I need image's url, with a simple function I get it from images table. The problem I am having is when I try to display image's url inside ImageURL, it just does not happen. This is very annoying. xml output <?xml version='1.0' encoding='windows-1254' ?> <rows><row id='1'> <MultimediaTitle>Hagi Goals</MultimediaTitle> /FLPM/media/images/5Y2K4T5V_sm.jpg <ImageURL><![CDATA[]]></ImageURL> <Videos> <VideoID id='1'><VideoURL>/FLPM/media/videos/0H7T9C0F.flv</VideoURL></VideoID> <VideoID id='2'><VideoURL>/FLPM/media/videos/9L6X9G9J.flv</VideoURL></VideoID> </Videos> </row> </rows>

    Read the article

  • Logging in "Java Library Code" libs for Android applications

    - by K. Claszen
    I follow the advice to implement Android device (not application!) independent library code for my Android Apps in a seperate "Java Library Code" project. This makes testing easier for me as I can use the standard maven project layout, Spring test support and Continuous Build systems the way I am used to. I do not want to mix this inside my Android App project although this might be possible. I now wonder how to implement logging in this library. As this library will be used on the Android device I would like to go with android.util.Log. I added the followind dependency to my project to get the missing Android packages/classes and dependencies: <dependency> <groupId>com.google.android</groupId> <artifactId>android</artifactId> <version>2.2.1</version> <scope>provided</scope> </dependency> But this library just contains stub method (similar to the android.jar inside the android-sdk), thus using android.util.Log results in java.lang.RuntimeException: Stub! when running my unit tests. How do I implement logging which works on the Android device but does not fail outside (I do not expect it to work, but it must not fail)? Thanks for any advice Klaus For now I am going with the workaround to catch the exception outside android but hope there is a better solution. try { Log.d("me", "hello"); } catch (RuntimeException re) { // ignore failure outside android }

    Read the article

  • Scala path dependent return type from parameter

    - by Rich Oliver
    In the following code using 2.10.0M3 in Eclipse plugin 2.1.0 for 2.10M3. I'm using the default setting which is targeting JVM 1.5 class GeomBase[T <: DTypes] { abstract class NewObjs { def newHex(gridR: GridBase, coodI: Cood): gridR.HexRT } class GridBase { selfGrid => type HexRT = HexG with T#HexTr def uniformRect (init: NewObjs) { val hexCood = Cood(2 ,2) val hex: HexRT = init.newHex(selfGrid, hexCood)// won't compile } } } Error message: Description Resource Path Location Type type mismatch; found: GeomBase.this.GridBase#HexG with T#HexTr required: GridBase.this.HexRT (which expands to) GridBase.this.HexG with T#HexTr GeomBase.scala Why does the compiler think the method returns the type projection GridBase#HexG when it should be this specific instance of GridBase? Edit transferred to a simpler code class in responce to comments now getting a different error message. package rStrat class TestClass { abstract class NewObjs { def newHex(gridR: GridBase): gridR.HexG } class GridBase { selfGrid => def uniformRect (init: NewObjs) { val hex: HexG = init.newHex(this) //error here } class HexG { val test12 = 5 } } } . Error line 11:Description Resource Path Location Type type mismatch; found : gridR.HexG required: GridBase.this.HexG possible cause: missing arguments for method or constructor TestClass.scala /SStrat/src/rStrat line 11 Scala Problem Update I've switched to 2.10.0M4 and updated the plug-in to the M4 version on a fresh version of Eclipse and switched to JVM 1.6 (and 1.7) but the problems are unchanged.

    Read the article

< Previous Page | 462 463 464 465 466 467 468 469 470 471 472 473  | Next Page >