Search Results

Search found 12765 results on 511 pages for 'format'.

Page 470/511 | < Previous Page | 466 467 468 469 470 471 472 473 474 475 476 477  | Next Page >

  • How can I create the XML::Simple data structure using a Perl XML SAX parser?

    - by DVK
    Summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog—due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. I'm looking for an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been. I don't care much what the interface of the new module is; e.g whether I need to call next_record() or give it a callback coderef accepting a record.

    Read the article

  • Reading and writing C++ vector to a file

    - by JB
    For some graphics work I need to read in a large amount of data as quickly as possible and would ideally like to directly read and write the data structures to disk. Basically I have a load of 3d models in various file formats which take too long to load so I want to write them out in their "prepared" format as a cache that will load much faster on subsequent runs of the program. Is it safe to do it like this? My worries are around directly reading into the data of the vector? I've removed error checking, hard coded 4 as the size of the int and so on so that i can give a short working example, I know it's bad code, my question really is if it is safe in c++ to read a whole array of structures directly into a vector like this? I believe it to be so, but c++ has so many traps and undefined behavour when you start going low level and dealing directly with raw memory like this. I realise that number formats and sizes may change across platforms and compilers but this will only even be read and written by the same compiler program to cache data that may be needed on a later run of the same program. #include <fstream> #include <vector> using namespace std; struct Vertex { float x, y, z; }; typedef vector<Vertex> VertexList; int main() { // Create a list for testing VertexList list; Vertex v1 = {1.0f, 2.0f, 3.0f}; list.push_back(v1); Vertex v2 = {2.0f, 100.0f, 3.0f}; list.push_back(v2); Vertex v3 = {3.0f, 200.0f, 3.0f}; list.push_back(v3); Vertex v4 = {4.0f, 300.0f, 3.0f}; list.push_back(v4); // Write out a list to a disk file ofstream os ("data.dat", ios::binary); int size1 = list.size(); os.write((const char*)&size1, 4); os.write((const char*)&list[0], size1 * sizeof(Vertex)); os.close(); // Read it back in VertexList list2; ifstream is("data.dat", ios::binary); int size2; is.read((char*)&size2, 4); list2.resize(size2); // Is it safe to read a whole array of structures directly into the vector? is.read((char*)&list2[0], size2 * sizeof(Vertex)); }

    Read the article

  • Need help helping in converting jquery, ajax, json and asp.net

    - by Haja Mohaideen
    I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

    Read the article

  • Paging & Sorting grids with ASP.Net MVC

    - by Scott Ivey
    I'm new to MVC, and am not following how you'd do paging and sorting on a grid. I'm used to using the asp.Net GridView control with an ObjectDataSource pointed at objects in our business layer - and in that case the ODS handles all of the paging & sorting using the methods that our ORM generates on the objects. I've looked at using the same ORM with MVC - and things work out fine there - i just loop thru the collections to build the table on the page - but without the ODS to handle the paging & sorting, i'm confused as to how I'd handle that. Would I have a separate controller for the paging and sorting? I'm not sure what the best practices are for this scenario, so if someone can point me in the right direction it would be much appreciated. Edit: Ok, so I understand that I need to roll my own - but where do I start? I've created a CustomerController, and a view that displays a table of customers that looks like below - and I want to sort on FirstName or LastName columns. My Model has a Sort() method on it that'll take a string sort expression in the format that would be used by a GridView/ODS pair. Would I create a new Action on my CustomerController called Sort, and put an ActionLink in my header? <table> <tr> <th> First Name </th> <th> Last Name </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.Encode(item.FirstName) %> </td> <td> <%= Html.Encode(item.LastName) %> </td> </tr> <% } %> </table>

    Read the article

  • How do you create a MANIFEST.MF that's available when you're testing and running from a jar in produ

    - by warvair
    I've spent far too much time trying to figure this out. This should be the simplest thing and everyone who distributes Java applications in jars must have to deal with it. I just want to know the proper way to add versioning to my Java app so that I can access the version information when I'm testing, e.g. debugging in Eclipse and running from a jar. Here's what I have in my build.xml: <target name="jar" depends = "compile"> <property name="version.num" value="1.0.0"/> <buildnumber file="build.num"/> <tstamp> <format property="TODAY" pattern="yyyy-MM-dd HH:mm:ss" /> </tstamp> <manifest file="${build}/META-INF/MANIFEST.MF"> <attribute name="Built-By" value="${user.name}" /> <attribute name="Built-Date" value="${TODAY}" /> <attribute name="Implementation-Title" value="MyApp" /> <attribute name="Implementation-Vendor" value="MyCompany" /> <attribute name="Implementation-Version" value="${version.num}-b${build.number}"/> </manifest> <jar destfile="${build}/myapp.jar" basedir="${build}" excludes="*.jar" /> </target> This creates /META-INF/MANIFEST.MF and I can read the values when I'm debugging in Eclipse thusly: public MyClass() { try { InputStream stream = getClass().getResourceAsStream("/META-INF/MANIFEST.MF"); Manifest manifest = new Manifest(stream); Attributes attributes = manifest.getMainAttributes(); String implementationTitle = attributes.getValue("Implementation-Title"); String implementationVersion = attributes.getValue("Implementation-Version"); String builtDate = attributes.getValue("Built-Date"); String builtBy = attributes.getValue("Built-By"); } catch (IOException e) { logger.error("Couldn't read manifest."); } } But, when I create the jar file, it loads the manifest of another jar (presumably the first jar loaded by the application - in my case, activation.jar). Also, the following code doesn't work either although all the proper values are in the manifest file. Package thisPackage = getClass().getPackage(); String implementationVersion = thisPackage.getImplementationVersion(); Any ideas?

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • clarification on the concept of "web service"

    - by udit
    Im a little confused on the varying definitions and implementations of web services available as implementations. Need some clarification please. Ones I have used till now: If a vendor gives me a specific format of XML that I can send populated with data to request and I make a simple HTTP POST over the internet passing in the XML String as the payload, is this a web service call ? If so, is there a specific name to it, this kind of web service ? Because obviously, it does not use anything like Axis, WSDL or SOAP to establish this connection. A variant of this is If the vendor gives me an XSD, I use JAXB to make a java class out of it and pass in the serialized version of the object, which eventually works out to be the same as option 1. RESTful web service: Vendor gives me a URL like http://restfulservice/products and I can make HTTP Requests to the URL and depending on what HTTP verb I use, the appropropriate action is called and the response sent over the wire. Ones I have only read about\ have a vague idea about SOAP. How does this work?.. Ive read the W3Schools tutorial and I undertsand that there is a very specific form of XML that is standardized according to W3C standards that we use to pass the same kind of messages as we did in option 1. But how does this work in real life? Vendor sends me what? Do I generate classes? Do I serialize some objects and http post them over to an address? Or do the generated objects themselves have connection methods that will do them for me? What about WSDL? When does a vendor send me WSDL and what do I do with it ? I guess I can generate classes from it. If yes, then what do I do with the generated classes ? When do I need that axis jar to generate classes from something that the vendor sends ? As you can see, I have some clear and other mostly vague ideas about the different kinds of web services available. would help if someone ould clarify and\or point to more real-world resources. I've looked a little bit into Java Web Services on the internet and the numerous four letter acronyms that get thrown at me make me dizzy. Thanks

    Read the article

  • iPhone Image Resources, ICO vs PNG, app bundle filesize

    - by Jasarien
    My application has a collection of around 1940 icons that are used throughout. They're currently in ICO and new images provided to me come in ICO format too. I have noticed that they contain a 16x16 and 32x32 representation of each icon in one file. Each file is roughly 4KB in filesize (as reported by finder, but ls reports that they vary from being ~1000 bytes to 5000 bytes) A very small number of these icons only contain the 32x32 representation, and as a result are only around 700 bytes in size. Currently I am bundling these icons with my application and they are inflating the size of the app a bit more than I would like. Altogether, the images total just about 25.5MB. Xcode must do some kind of compression because the resulting app bundle is about 12.4MB. Compressing this further into a ZIP (as it would be when submitted to the App Store), results in a final file of 5.8MB. I'm aware that the maximum limit for over the air App Store downloads has been raised to 20MB since the introduction of the iPad (I'm not sure if that extends to iPhone apps as well as iPad apps though, if not the limit would be 10MB). My worry is that new icons are going to be added (sometimes up to 10 icons per week), and will continue to inflate the app bundle over time. What is the best way to distribute these icons with my app? Things I've tried and not had much success with: Converting the icons from ICO to PNG: I tried this in the hopes that the pngcrush utility would help out with the filesize. But it appears that it doesn't make much of a difference between a normal PNG and a crushed png (I believe it just optimises the image for display on the iPhone's GPU rather than compress it's size). Also in going from ICO to PNG actually increased the size of the icon file... Zipping the images, and then uncompressing them on first run. While this did reduce the overall image sizes, I found that the effort needed to unzip them, copy them to the documents folder and ensure that duplication doesn't happen on upgrades was too much hassle to be worth the benefit. Also, on original and 3G iPhones unzipping and copying around 25MB of images takes too long and creates a bad experience... Things I've considered but not yet tried: Instead of distributing the icons within the app bundle, host them online, and download each icon on demand (it depends on the user's data as to which icons will actually be displayed and when). Issues with this is that bandwidth costs money, and image downloads will be bandwidth intensive. However, my app currently has a small userbase of around 5,500 users (of which I estimate around 1500 to be active based on Flurry stats), and I have a huge unused bandwidth allowance with my current hosting package. So I'm open to thoughts on how to solve this tricky issue.

    Read the article

  • Parsing Data in XML and Storing to DB in Python

    - by Rakesh
    Hi Guys i have problem parsing an xml file and entering the data to sqlite, the format is like i need to enter the chracters before the token like 111,AAA,BBB etc <DOCUMENT> <PAGE width="544.252" height="634.961" number="1" id="p1"> <MEDIABOX x1="0" y1="0" x2="544.252" y2="634.961"/> <BLOCK id="p1_b1"> <TEXT width="37.7" height="74.124" id="p1_t1" x="51.1" y="20.8652"> <TOKEN sid="p1_s11" id="p1_w1" font-name="Verdanae" bold="yes" italic="no">111</TOKEN> </TEXT> </BLOCK> <BLOCK id="p1_b3"> <TEXT width="151.267" height="10.725" id="p1_t6" x="24.099" y="572.096"> <TOKEN sid="p1_s35" id="p1_w22" font-name="Verdanae" bold="yes" italic="yes">AAA</TOKEN> <TOKEN sid="p1_s36" id="p1_w23" font-name="verdanae" bold="yes" italic="no">BBB</TOKEN> <TOKEN sid="p1_s37" id="p1_w24" font-name="verdanae" bold="yes" italic="no">CCC</TOKEN> </TEXT> </BLOCK> <BLOCK id="p1_b4"> <TEXT width="82.72" height="26" id="p1_t7" x="55.426" y="138.026"> <TOKEN sid="p1_s42" id="p1_w29" font-name="verdanae" bold="yes" italic="no">DDD</TOKEN> <TOKEN sid="p1_s43" id="p1_w30" font-name="verdanae" bold="yes" italic="no">EEE</TOKEN> </TEXT> <TEXT width="101.74" height="26" id="p1_t8" x="55.406" y="162.026"> <TOKEN sid="p1_s45" id="p1_w31" font-name="verdanae" bold="yes" italic="no">FFF</TOKEN> </TEXT> <TEXT width="152.96" height="26" id="p1_t9" x="55.406" y="186.026"> <TOKEN sid="p1_s47" id="p1_w32" font-name="verdanae" bold="yes" italic="no">GGG</TOKEN> <TOKEN sid="p1_s48" id="p1_w33" font-name="verdanae" bold="yes" italic="no">HHH</TOKEN> </TEXT> </BLOCK> </PAGE> </DOCUMENT> in .net it is done with 3 foreach loops 1. for "DOCUMENT/PAGE/BLOCK" 2."TEXT" 3. "TOKEN" and then it is entered into the DB i dont get how to do it in python and i am trying it with lxml module

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • Activity gets killed while executing the camera intent

    - by BlackRider
    In my app I call the system camera to take a picture, and then handle the result in onActivityResult. You know, the usual. It used to work, but now my calling activity gets killed while I'm taking the picture. Specifically, onDestroy() is called on my activity right after I press the camera shutter. The photo does get taken & saved (I've checked that the file gets written on the SD card). After I accept the photo, instead of returning to the calling activity and invoking onActivityResult, the previous activity in the activity stack gets called. I see no exceptions in the logcat. My custom exception handler doesn't get called. If it matters, my app also includes a service that listens to GPS updates, but I unregister all the receivers in onPause(). Here's the call stack for MyCallingActivity.onDestroy(): Thread [<1> main] (Suspended (breakpoint at line 303 in NewPlaceDetailsActivity)) NewPlaceDetailsActivity.onDestroy() line: 303 ActivityThread.performDestroyActivity(IBinder, boolean, int, boolean) line: 2663 ActivityThread.handleDestroyActivity(IBinder, boolean, int, boolean) line: 2694 ActivityThread.access$2100(ActivityThread, IBinder, boolean, int, boolean) line: 117 BinderProxy(ActivityThread$H).handleMessage(Message) line: 968 ActivityThread$H(Handler).dispatchMessage(Message) line: 99 Looper.loop() line: 130 ActivityThread.main(String[]) line: 3687 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 842 ZygoteInit.main(String[]) line: 600 NativeStart.main(String[]) line: not available [native method] This is how I start the camera activity, in case you're wondering: protected void startCamera() { createPhotoDirsIfNeeded(); String fileName = "temp.jpg"; ContentValues values = new ContentValues(); values.put(MediaStore.Images.Media.TITLE, fileName); m_capturedImageUri = getContentResolver().insert(MediaStore.Images.Media.EXTERNAL_CONTENT_URI, values); m_photoFileName = APP_PHOTO_PATH + "/" + DateFormat.format(DATE_FORMAT, Calendar.getInstance().getTime()) + ".jpg"; File picFile = new File(m_photoFileName); if(picFile.exists()) { picFile.delete(); } // start the camera activity Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); intent.putExtra(MediaStore.EXTRA_OUTPUT, Uri.fromFile(picFile)); startActivityForResult(intent, IntentHelper.REQUEST_TAKE_PHOTO); } How can I find out why does my activity get killed, AND removed from the stack instead of being created again?

    Read the article

  • Programmatically created GridView cells don't scale to fit screen

    - by ChrisAshton84
    I've read a ton of other responses about GridView already but almost all deal with the XML format (which I had working). I wanted to learn the programmatic way of designing Android, though, so I'm trying to build most of this app without XML. All I define in XML are the GridView and the first TextView. After that I add the other LinearLayouts in onCreate(). I would like to have a 2 column GridView containing a title and several (4 for now) LinearLayouts. I realize from documentation that the GridView won't scale cells unless they have a gravity set, but no matter how I try to do this I can't get it to work. After adding two cells, my GridView tree would look like: GridView -> TextView (colspan 2) -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView I've tried about every combination of FILL and FILL_HORIZONTAL I could think of on either the outermost LinearLayouts, or also trying on the TextViews and inner LinearLayouts. No matter what I do, the LinearLayouts I add are always sized as small as possible and pushed to the left of the screen. Meanwhile, the first TextView (the colspan 2 one) with only CENTER_HORIZONTAL set is correctly centered in the screen. Its as if that TextView gets one idea of the column widths and the LinearLayouts get another! (If I add the FILL Gravity for it, it also moves all the way left.) I believe I had this working accidentally with 100% XML, but I would prefer not to switch back unless this is known to not work programatically. Any ideas what I can try to get this working?

    Read the article

  • How to convert m4a file to aac adts file in Xcode?

    - by Bird Hsuie
    I have a mp4 file copied from iPod lib and saved to my Document for my next step, I need it to convert to .mp3 or .aac(ADTS type) I use this code and failed... -(IBAction)compressFile:(id)sender{ NSLog (@"handleConvertToPCMTapped"); // open an ExtAudioFile NSLog (@"opening %@", exportURL); ExtAudioFileRef inputFile; CheckResult (ExtAudioFileOpenURL((__bridge CFURLRef)exportURL, &inputFile), "ExtAudioFileOpenURL failed"); // prepare to convert to a plain ol' PCM format AudioStreamBasicDescription myPCMFormat; myPCMFormat.mSampleRate = 44100; // todo: or use source rate? myPCMFormat.mFormatID = kAudioFormatMPEGLayer3 ; myPCMFormat.mFormatFlags = kAudioFormatFlagsCanonical; myPCMFormat.mChannelsPerFrame = 2; myPCMFormat.mFramesPerPacket = 1; myPCMFormat.mBitsPerChannel = 16; myPCMFormat.mBytesPerPacket = 4; myPCMFormat.mBytesPerFrame = 4; CheckResult (ExtAudioFileSetProperty(inputFile, kExtAudioFileProperty_ClientDataFormat, sizeof (myPCMFormat), &myPCMFormat), "ExtAudioFileSetProperty failed"); // allocate a big buffer. size can be arbitrary for ExtAudioFile. // you have 64 KB to spare, right? UInt32 outputBufferSize = 0x10000; void* ioBuf = malloc (outputBufferSize); UInt32 sizePerPacket = myPCMFormat.mBytesPerPacket; UInt32 packetsPerBuffer = outputBufferSize / sizePerPacket; // set up output file NSString *outputPath = [myDocumentsDirectory() stringByAppendingPathComponent:@"m_export.mp3"]; NSURL *outputURL = [NSURL fileURLWithPath:outputPath]; NSLog (@"creating output file %@", outputURL); AudioFileID outputFile; CheckResult(AudioFileCreateWithURL((__bridge CFURLRef)outputURL, kAudioFileCAFType, &myPCMFormat, kAudioFileFlags_EraseFile, &outputFile), "AudioFileCreateWithURL failed"); // start convertin' UInt32 outputFilePacketPosition = 0; //in bytes while (true) { // wrap the destination buffer in an AudioBufferList AudioBufferList convertedData; convertedData.mNumberBuffers = 1; convertedData.mBuffers[0].mNumberChannels = myPCMFormat.mChannelsPerFrame; convertedData.mBuffers[0].mDataByteSize = outputBufferSize; convertedData.mBuffers[0].mData = ioBuf; UInt32 frameCount = packetsPerBuffer; // read from the extaudiofile CheckResult (ExtAudioFileRead(inputFile, &frameCount, &convertedData), "Couldn't read from input file"); if (frameCount == 0) { printf ("done reading from file"); break; } // write the converted data to the output file CheckResult (AudioFileWritePackets(outputFile, false, frameCount, NULL, outputFilePacketPosition / myPCMFormat.mBytesPerPacket, &frameCount, convertedData.mBuffers[0].mData), "Couldn't write packets to file"); NSLog (@"Converted %ld bytes", outputFilePacketPosition); // advance the output file write location outputFilePacketPosition += (frameCount * myPCMFormat.mBytesPerPacket); } // clean up ExtAudioFileDispose(inputFile); AudioFileClose(outputFile); // show size in label NSLog (@"checking file at %@", outputPath); [self transMitFile:outputPath]; if ([[NSFileManager defaultManager] fileExistsAtPath:outputPath]) { NSError *fileManagerError = nil; unsigned long long fileSize = [[[NSFileManager defaultManager] attributesOfItemAtPath:outputPath error:&fileManagerError] fileSize]; } any suggestion?.......thanks for your great help!

    Read the article

  • .NET Extension Objects with XSLT -- how to iterate over a collection?

    - by Pandincus
    Help me, Stackoverflow! I have a simple .NET 3.5 console app that reads some data and sends emails. I'm representing the email format in an XSLT stylesheet so that we can easily change the wording of the email without needing to recompile the app. We're using Extension Objects to pass data to the XSLT when we apply the transformation: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" xmlns:EmailNotification="ext:EmailNotification"> -- this way, we can have statements like: <p> Dear <xsl:value-of select="EmailNotification:get_FullName()" />: </p> The above works fine. I pass the object via code like this (some irrelevant code omitted for brevity): // purely an example structure public struct EmailNotification { public string FullName { get; set; } } // Somewhere in some method ... var notification = new Notification("John Smith"); // ... XsltArgumentList xslArgs = new XsltArgumentList(); xslArgs.AddExtensionObject("ext:EmailNotification", notification); // ... // The part where it breaks! (This is where we do the transformation) xslt.Transform(fakeXMLDocument.CreateNavigator(), xslArgs, XmlWriter.Create(transformedXMLString)); So, all of the above code works. However, I wanted to get a little fancy (always my downfall) and pass a collection, so that I could do something like this: <p>The following accounts need to be verified:</p> <xsl:for-each select="EmailNotification:get_SomeCollection()"> <ul> <li> <xsl:value-of select="@SomeAttribute" /> </li> </ul> <xsl:for-each> When I pass the collection in the extension object and attempt to transform, I get the following error: "Extension function parameters or return values which have Clr type 'String[]' are not supported." or List, or IEnumerable, or whatever I try to pass in. So, my questions are: How can I pass in a collection to my XSLT? What do I put for the xsl:value-of select="" inside the xsl:for-each ? Is what I am trying to do impossible?

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • Parallel Task Library WaitAny Design

    - by colithium
    I've just begun to explore the PTL and have a design question. My Scenario: I have a list of URLs that each refer to an image. I want each image to be downloaded in parallel. As soon as at least one image is downloaded, I want to execute a method that does something with the downloaded image. That method should NOT be parallelized -- it should be serial. I think the following will work but I'm not sure if this is the right way to do it. Because I have separate classes for collecting the images and for doing "something" with the collected images, I end up passing around an array of Tasks which seems wrong since it exposes the inner workings of how images are retrieved. But I don't know a way around it. In reality there is more to both of these methods but that's not important for this. Just know that they really shouldn't be lumped into one large method that both retrieves and does something with the image. Task<Image>[] downloadTasks = collector.RetrieveImages(listOfURLs); for (int i = 0; i < listOfURLs.Count; i++) { //Wait for any of the remaining downloads to complete int completedIndex = Task<Image>.WaitAny(downloadTasks); Image completedImage = downloadTasks[completedIndex].Result; //Now do something with the image (this "something" must happen serially) } /////////////////////////////////////////////////// public Task<Image>[] RetrieveImages(List<string> urls) { Task<Image>[] tasks = new Task<Image>[urls.Count]; int index = 0; foreach (string url in urls) { string lambdaVar = url; //Required... Bleh tasks[index] = Task<Image>.Factory.StartNew(() => { using (WebClient client = new WebClient()) { //TODO: Replace with live image locations string fileName = String.Format("{0}.png", i); client.DownloadFile(lambdaVar, Path.Combine(Application.StartupPath, fileName)); } return Image.FromFile(Path.Combine(Application.StartupPath, fileName)); }, TaskCreationOptions.LongRunning | TaskCreationOptions.AttachedToParent); index++; } return tasks; }

    Read the article

  • Create a timer countdown using hours, minutes & seconds from a future date

    - by Tommy Coffee
    I am using some code I found on the internet that creates a countdown from a certain date. I am trying to edit the code so that it only gives me a countdown from an hour, minute, and second that I specify from a future date. I cannot just have code that counts down from a specified time, I need it to countdown to a specified date in the future. This is important so that if the browser is refreshed the countdown doesn't start over but continues where left off. I will be using cookies so the browser remembers what future date was specified when it was first run. Here is the HTML: <form name="count"> <input type="text" size="69" name="count2"> </form> And here is the javascript: window.onload = function() { //change the text below to reflect your own, var montharray=new Array("Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec") function countdown(yr,m,d){ var theyear=yr; var themonth=m; var theday=d var today=new Date() var todayy=today.getYear() if (todayy < 1000) todayy+=1900; var todaym=today.getMonth() var todayd=today.getDate() var todayh=today.getHours() var todaymin=today.getMinutes() var todaysec=today.getSeconds() var todaystring=montharray[todaym]+" "+todayd+", "+todayy+" "+todayh+":"+todaymin+":"+todaysec futurestring=montharray[m-1]+" "+d+", "+yr var dd=Date.parse(futurestring)-Date.parse(todaystring) var dday=Math.floor(dd/(60*60*1000*24)*1) var dhour=Math.floor((dd%(60*60*1000*24))/(60*60*1000)*1) var dmin=Math.floor(((dd%(60*60*1000*24))%(60*60*1000))/(60*1000)*1) var dsec=Math.floor((((dd%(60*60*1000*24))%(60*60*1000))%(60*1000))/1000*1) if(dday==0&&dhour==0&&dmin==0&&dsec==1){ document.forms.count.count2.value=current return } else document.forms.count.count2.value= dhour+":"+dmin+":"+dsec; setTimeout(function() {countdown(theyear,themonth,theday)},1000) } //enter the count down date using the format year/month/day countdown(2012,12,25) } I am sure there is superfluous code above since I only need an hour, minute, and second that I would like to pass to the countdown() function. The year, month and day is unimportant but as I said this is code I am trying to edit which I found on the internet. Any help would be very appreciated. Thank you!

    Read the article

  • Running a graph returns E_FAIL

    - by Manish
    Hi, I have been struggling for a while now to get my filter graph to run .I am trying to crop a .wmv file into smaller duration .wmv files .It looks quite a simple task I dont know why its is getting so complicated.I follow this Source- SampleGrabber-WMA sf writer. Here is my code IBaseFilter* pASFWriter; ICaptureGraphBuilder2 * pBuilder=NULL; CoCreateInstance(CLSID_CaptureGraphBuilder2,NULL,CLSCTX_INPROC_SERVER,IID_ICaptureGraphBuilder2,(LPVOID*)&pBuilder); pBuilder-SetFiltergraph(pGraphBuilder); pBuilder-SetOutputFileName(&MEDIASUBTYPE_Asf,OUTFILE,&pASFWriter,NULL); IConfigAsfWriter *pConfig=NULL; HRESULT hr80 = pASFWriter-QueryInterface(IID_IConfigAsfWriter, (void**)&pConfig); if (SUCCEEDED(hr80)) { // Configure the ASF Writer filter. pConfig-Release(); } IBaseFilter *pSource=NULL; pGraphBuilder->AddSourceFilter(FILENAME,L"Source",&pSource); IBaseFilter *pGrabberF2=NULL; ISampleGrabber *pGrabber2=NULL; CoCreateInstance(CLSID_SampleGrabber,NULL,CLSCTX_INPROC_SERVER,IID_PPV_ARGS(&pGrabberF2)); pGraphBuilder->AddFilter(pGrabberF2,L"Sample Grabber2"); AM_MEDIA_TYPE mt1; ZeroMemory(&mt1,sizeof(mt1)); mt1.majortype=MEDIATYPE_Video; mt1.subtype=MEDIASUBTYPE_RGB24; pGrabberF2->QueryInterface(IID_ISampleGrabber,(void**)(&pGrabber2)); pGrabber2->SetBufferSamples(TRUE); pGrabber2->SetOneShot(FALSE); pGrabber->SetMediaType(&mt1); pSource->EnumPins(&pEnum2); pEnum2->Next(1,&pPin2,NULL); HRESULT hr108=ConnectFilters(pGraphBuilder,pPin2,pGrabberF2);//Source to Grabber pGrabberF2->EnumPins(&pEnum3); IEnumPins *pEnum4=NULL; pASFWriter->EnumPins(&pEnum4); IPin* pPin4=NULL; while (S_OK==pEnum3->Next(1,&pPin3,NULL)&& S_OK==pEnum4->Next(1,&pPin4,NULL)){ pGraphBuilder->Connect(pPin3,pPin4);//Grabber to FileWriter } pGraphBuilder->RenderFile(FILENAME,NULL);//FILENAME=INPUTFILENAME (.wmv format) pMediaPosition->put_CurrentPosition(start); pMediaPosition->put_StopTime(stop); HRESULT test1=pMediaControl->Run(); All of it runs fine(returns S_OK) .But test1 returns E_FAIL and no file is created.Can somebody help?

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Does CakePHP treat all INT fields as ID's for join tables?

    - by Jonnie
    I am trying to save a User, their Profile, and some tags and my join table that links the profile and the tags keeps getting messed up. The profile model is called Instructor, the tag model is called Subject. The Instructor has a phone number and a zip code and for some reason CakePHP thinks these are the fields it should use when creating entries in my join table. My Join table always comes out as: id | instructor_id | subject_id | 1 | 90210 | 1 | // thinks that the zip code is an instructor_id 2 | 1112223333 | 1 | // thinks that the phone number is an instructor_id 3 | 1 | 1 | // thinks that user_id is an instructor_id 4 | 1 | 1 | // the actual instructor_id, this one's correct 5 | 90210 | 2 | 6 | 1112223333 | 2 | 3 | 1 | 2 | 4 | 1 | 2 | My Models: class Instructor extends AppModel { var $name = 'Instructor'; var $belongsTo = array('User', 'State'); var $hasAndBelongsToMany = array( 'Subject' = array( 'className' = 'Subject', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'instructor_id', 'associationForeignKey' = 'subject_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } class Subject extends AppModel { var $name = 'Subject'; var $hasAndBelongsToMany = array( 'Instructor' = array( 'className' = 'Instructor', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'subject_id', 'associationForeignKey' = 'instructor_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } My Model Associations: User hasOne Instructor Instructor belongsTo User Instructor hasAndBelongsToMany Subject Subject hasAndBelongsToMany Instructor My form data looks like: Array ( [User] = Array ( [username] = MrInstructor [password] = cddb06c93c72f34eb9408610529a34645c29c55d [group_id] = 2 ) [Instructor] = Array ( [name] = Jimmy Bob [email] = [email protected] [phone] = 1112223333 [city] = Beverly Hills [zip_code] = 90210 [states] = 5 [website] = www.jimmybobbaseballschool.com [description] = Jimmy Bob is an instructor. [user_id] = 1 [id] = 1 ) [Subject] = Array ( [name] = hitting, pitching ) ) My function for processing the form looks like: function instructor_register() { $this-set('groups', $this-User-Group-find('list')); $this-set('states', $this-User-Instructor-State-find('list')); if (!empty($this-data)) { // Set the group to Instructor $this-data['User']['group_id'] = 2; // Save the user data $user = $this-User-save($this-data, true, array( 'username', 'password', 'group_id' )); // If the user was saved, save the instructor's info if (!empty($user)) { $this-data['Instructor']['user_id'] = $this-User-id; $instructor = $this-User-Instructor-save($this-data, true, array( 'user_id', 'name', 'email', 'phone', 'city', 'zip_code', 'state_id', 'website', 'description' )); // If the instructor was saved, save the rest if(!empty($instructor)) { $instructorId = $this-User-Instructor-id; $this-data['Instructor']['id'] = $instructorId; // Save each subject seperately $subjects = explode(",", $this-data['Subject']['name']); foreach ($subjects as $_subject) { // Get the correct subject format $_subject = strtolower(trim($_subject)); $this-User-Instructor-Subject-create($this-data); $this-User-Instructor-Subject-set(array( 'name' = $_subject )); $this-User-Instructor-Subject-save(); echo ''; print_r($this-data); echo ''; } } } } }

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • MATLAB image corner coordinates & referncing to cell arrays

    - by James
    Hi, I am having some problems comparing the elements in different cell arrays. The context of this problem is that I am using the bwboundaries function in MATLAB to trace the outline of an image. The image is of a structural cross section and I am trying to find if there is continuity throughout the section (i.e. there is only one outline produced by the bwboundaries command). Having done this and found where the is more than one section traced (i.e. it is not continuous), I have used the cornermetric command to find the corners of each section. The code I have is: %% Define the structural section as a binary matrix (Image is an I-section with the web broken) bw(20:40,50:150) = 1; bw(160:180,50:150) = 1; bw(20:60,95:105) = 1; bw(140:180,95:105) = 1; Trace = bw; [B] = bwboundaries(Trace,'noholes'); %Traces the outer boundary of each section L = length(B); % Finds number of boundaries if L > 1 disp('Multiple boundaries') % States whether more than one boundary found end %% Obtain perimeter coordinates for k=1:length(B) %For all the boundaries perim = B{k}; %Obtains perimeter coordinates (as a 2D matrix) from the cell array end %% Find the corner positions C = cornermetric(bw); Areacorners = find(C == max(max(C))) % Finds the corner coordinates of each boundary [rowindexcorners,colindexcorners] = ind2sub(size(Newgeometry),Areacorners) % Convert corner coordinate indexes into subcripts, to give x & y coordinates (i.e. the same format as B gives) %% Put these corner coordinates into a cell array Cornerscellarray = cell(length(rowindexcorners),1); % Initialises cell array of zeros for i =1:numel(rowindexcorners) Cornerscellarray(i) = {[rowindexcorners(i) colindexcorners(i)]}; %Assigns the corner indicies into the cell array %This is done so the cell arrays can be compared end for k=1:length(B) %For all the boundaries found perim = B{k}; %Obtains coordinates for each perimeter Z = perim; % Initialise the matrix containing the perimeter corners Sectioncellmatrix = cell(length(rowindexcorners),1); for i =1:length(perim) Sectioncellmatrix(i) = {[perim(i,1) perim(i,2)]}; end for i = 1:length(perim) if Sectioncellmatrix(i) ~= Cornerscellarray Sectioncellmatrix(i) = []; %Gets rid of the elements that are not corners, but keeps them associated with the relevent section end end end This creates an error in the last for loop. Is there a way I can check whether each cell of the array (containing an x and y coordinate) is equal to any pair of coordinates in cornercellarray? I know it is possible with matrices to compare whether a certain element matches any of the elements in another matrix. I want to be able to do the same here, but for the pair of coordinates within the cell array. The reason I don't just use the cornercellarray cell array itself, is because this lists all the corner coordinates and does not associate them with a specific traced boundary.

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

< Previous Page | 466 467 468 469 470 471 472 473 474 475 476 477  | Next Page >