Search Results

Search found 14236 results on 570 pages for 'times square'.

Page 470/570 | < Previous Page | 466 467 468 469 470 471 472 473 474 475 476 477  | Next Page >

  • Can I use drawRect to refresh a UIView subclass?

    - by Timbo
    I've created a subclass of UIView called Status which is designed to display a rectangle of a certain size (within a view) depending on the value of a variable. // Interface #import <Foundation/Foundation.h> #import <QuartzCore/QuartzCore.h> @interface Status: UIView { NSString* name; int someVariable; } @property int someVariable; @property (assign) NSString *name; - (void) createStatus: (NSString*)withName; - (void) drawRect:(CGRect)rect; @end // Implementation #import "Status.h" @implementation Status @synthesize name, someVariable; - (void) createStatus: (NSString*)withName { name = withName; someVariable = 10000; } - (void) drawRect:(CGRect)rect { CGContextRef context = UIGraphicsGetCurrentContext(); //Draw Status CGContextSetRGBFillColor(context, 0.0, 0.0, 1.0, 1); // fill CGContextFillRect(context, CGRectMake(0.0, 0.0, someVariable, 40.0)); } //// myviewcontroller implementation - (void) viewDidAppear:(BOOL)animated { [super viewDidAppear:animated]; myStatus = [[Status alloc] initWithFrame:CGRectMake(8,8,200,56)]; myStatus.backgroundColor = [UIColor grayColor]; [self.view addSubview:myStatus]; } How do I set this up so I can repeatedly call a refresh of the status bar? I'll probably call the refresh 4 times per second using a NSTimer, I'm just not sure what to call or if I should move this rectangle drawing to a separate function or something... Thanks in advance for your help :)

    Read the article

  • Efficient way to maintain a sorted list of access counts in Python

    - by David
    Let's say I have a list of objects. (All together now: "I have a list of objects.") In the web application I'm writing, each time a request comes in, I pick out up to one of these objects according to unspecified criteria and use it to handle the request. Basically like this: def handle_request(req): for h in handlers: if h.handles(req): return h return None Assuming the order of the objects in the list is unimportant, I can cut down on unnecessary iterations by keeping the list sorted such that the most frequently used (or perhaps most recently used) objects are at the front. I know this isn't something to be concerned about - it'll make only a miniscule, undetectable difference in the app's execution time - but debugging the rest of the code is driving me crazy and I need a distraction :) so I'm asking out of curiosity: what is the most efficient way to maintain the list in sorted order, descending, by the number of times each handler is chosen? The obvious solution is to make handlers a list of (count, handler) pairs, and each time a handler is chosen, increment the count and resort the list. def handle_request(req): for h in handlers[:]: if h[1].handles(req): h[0] += 1 handlers.sort(reverse=True) return h[1] return None But since there's only ever going to be at most one element out of order, and I know which one it is, it seems like some sort of optimization should be possible. Is there something in the standard library, perhaps, that is especially well-suited to this task? Or some other data structure? (Even if it's not implemented in Python) Or should/could I be doing something completely different?

    Read the article

  • How can I send GET data to multiple URLs at the same time using cURL?

    - by Rob
    My apologies, I've actually asked this question multiple times, but never quite understood the answers. Here is my current code: while($resultSet = mysql_fetch_array($SQL)){ $ch = curl_init($resultSet['url'] . $fullcurl); //load the urls and send GET data curl_setopt($ch, CURLOPT_TIMEOUT, 2); //Only load it for two seconds (Long enough to send the data) curl_exec($ch); //Execute the cURL curl_close($ch); //Close it off } //end while loop What I'm doing here, is taking URLs from a MySQL Database ($resultSet['url']), appending some extra variables to it, just some GET data ($fullcurl), and simply requesting the pages. This starts the script running on those pages, and that's all that this script needs to do, is start those scripts. It doesn't need to return any output. Just the load the page long enough for the script to start. However, currently it's loading each URL (currently 11) one at a time. I need to load all of them simultaneously. I understand I need to use curl_multi_*, but I haven't the slightest idea on how cURL functions work, so I don't know how to change my code to use curl_multi_* in a while loop. So my questions are: How can I change this code to load all of the URLs simultaneously? Please explain it and not just give me code. I want to know what each individual function does exactly. Will curl_multi_exec even work in a while loop, since the while loop is just sending each row one at a time? And of course, any references, guides, tutorials about cURL functions would be nice, as well. Preferably not so much from php.net, as while it does a good job of giving me the syntax, its just a little dry and not so good with the explanations.

    Read the article

  • Building static (but complicated) lookup table using templates.

    - by MarkD
    I am currently in the process of optimizing a numerical analysis code. Within the code, there is a 200x150 element lookup table (currently a static std::vector < std::vector < double ) that is constructed at the beginning of every run. The construction of the lookup table is actually quite complex- the values in the lookup table are constructed using an iterative secant method on a complicated set of equations. Currently, for a simulation, the construction of the lookup table is 20% of the run time (run times are on the order of 25 second, lookup table construction takes 5 seconds). While 5-seconds might not seem to be a lot, when running our MC simulations, where we are running 50k+ simulations, it suddenly becomes a big chunk of time. Along with some other ideas, one thing that has been floated- can we construct this lookup table using templates at compile time? The table itself never changes. Hard-coding a large array isn't a maintainable solution (the equations that go into generating the table are constantly being tweaked), but it seems that if the table can be generated at compile time, it would give us the best of both worlds (easily maintainable, no overhead during runtime). So, I propose the following (much simplified) scenario. Lets say you wanted to generate a static array (use whatever container suits you best- 2D c array, vector of vectors, etc..) at compile time. You have a function defined- double f(int row, int col); where the return value is the entry in the table, row is the lookup table row, and col is the lookup table column. Is it possible to generate this static array at compile time using templates, and how?

    Read the article

  • How strict should I be in the "do the simplest thing that could possible work" while doing TDD

    - by Support - multilanguage SO
    For TDD you have to Create a test that fail Do the simplest thing that could possible work to pass the test Add more variants of the test and repeat Refactor when a pattern emerge With this approach you're supposing to cover all the cases ( that comes to my mind at least) but I'm wonder if am I being too strict here and if it is possible to "think ahead" some scenarios instead of simple discover them. For instance, I'm processing a file and if it doesn't conform to a certain format I am to throw an InvalidFormatException So my first test was: @Test void testFormat(){ // empty doesn't do anything... processor.validate("empty.txt"); try { processor.validate("invalid.txt"); assert false: "Should have thrown InvalidFormatException"; } catch( InvalidFormatException ife ) { assert "Invalid format".equals( ife.getMessage() ); } } I run it and it fails because it doesn't throw an exception. So the next thing that comes to my mind is: "Do the simplest thing that could possible work", so I : public void validate( String fileName ) throws InvalidFormatException { if(fileName.equals("invalid.txt") { throw new InvalidFormatException("Invalid format"); } } Doh!! ( although the real code is a bit more complicated, I found my self doing something like this several times ) I know that I have to eventually add another file name and other test that would make this approach impractical and that would force me to refactor to something that makes sense ( which if I understood correctly is the point of TDD, to discover the patterns the usage unveils ) but: Q: am I taking too literal the "Do the simplest thing..." stuff?

    Read the article

  • extra new lines with several outputStream.write

    - by Sam
    Hi All, I am writing jsp to export data in excel format to user. An excel could be recieved on the cient side. However, since there's large amount of data, and I don't want to keep it in the server memory and write them at the end. I try to divide them and write serveral times. However, each extra write(..) will cause an extra new lines at the top of the excel worksheet and then the extra data is placed after these new lines. Does anyone know the reasons? The code is something like this: response.setHeader("Content-disposition","attachment;filename=DocuShareSearch.xls"); response.setHeader("Content-Type", "application/octet-stream"); responseContent ="<table><tr><td>12131</td></tr>......."; byte[] responseByte1 = responseContent.getBytes("utf-16"); outputStream.write(responseByte1, 0, responseByte1.length ); responseContent =".....<tr><td>12131</td></tr></table>"; byte[] responseByte2 = responseContent.getBytes("utf-16"); outputStream.write(responseByte2, 0, responseByte2.length ); outputStream.close();

    Read the article

  • Javascript error : " 'Sys' is undefined "

    - by Simon
    Hi there, I keep having an error when running my web application. The error does not cause a compilation error when on live server at least a javascript error and nothing else. But the real problem is when "debug" ... javascript error stops the compilation and I have to "Continue" three times before proceeding normally my debug. But this error occurs at every refresh the page. All this using Visual Studio. After several hours of search on google, I saw that it was a problem with the ScriptManager and Ajax. The real problem is that I do not use any Ajax on this page but the ScriptManager is on the masterpage. Worse still, on any other page on the website, that may use Ajax or not, no javascript error! Only THIS page cause this error! Any suggestion? Note that I usualy talk french so there's probably error and sorry for this! EDIT There's the 3 places were compilation stop. 1. Sys.WebForms.PageRequestManager._initialize('ctl00$ctl08', document.getElementById('aspnetForm')); 2. Sys.WebForms.PageRequestManager.getInstance()._updateControls([], [], [], 90); 3. Sys.Application.initialize();

    Read the article

  • OrderBy Linq.Expression as parameter = (Of Func(Of T,IComparable)) to perform LinqToEntity is not working

    - by NicoJuicy
    I'd like to get this working: Call: (Count & Page are used for pagination, so Count = 20 and Page = 1 for example, for the first 20 values). Sorting should be by name LeverancierService.GetLeveranciers(Function(el) el.Name, Count, Page) Equivalent in c#: LeverancierService.GetLeveranciers(el= el.Name, Count, Page) Method that gives an error (parameters shown above): Public Overridable Function GetAllPaged(orderby As Expression(Of Func(Of T, IComparable)), ByVal Count As Integer, ByVal Page As Integer) As IEnumerable(Of T) Return dbset.OrderBy(orderby).Skip((Page - 1) * Count).Take(Count).ToList() End Function Already tried changing it to this, but it gives the same error: Public Overridable Function GetAllPaged(Of TOrderBy)(orderby As Expression(Of Func(Of T, TOrderBy)), ByVal Count As Integer, ByVal Page As Integer) As IEnumerable(Of T) Return dbset.OrderBy(orderby).Skip((Page - 1) * Count).Take(Count).ToList() End Function Error: Unable to cast the type 'System.String' to type 'System.IComparable'. LINQ to Entities only supports casting Entity Data Model primitive types. Any idea how to do this? Extra info: I'm in a DDD-layered application, so the parameter should stay the same as the called method is an overridden interface (eg. if i change this, i have to do this for 200 times or so, because it's in VB.Net and not in C# (= 1 change) ) I know there is a way to change the expression to a string and then use DLinq (= Dynamic Linq), but that's not how it should be.

    Read the article

  • Does "delegate" mean a type or an object?

    - by Michal Czardybon
    Reading from MSDN: "A delegate is a type that references a method. Once a delegate is assigned a method, it behaves exactly like that method." Does then "delegate" mean a type or an object?! ...It cannot be both. It seems to me that the single word is used in two different meanings: a type containing a reference to a method of some specified signature, an object of that type, which can be actually called like a method. I would prefer a more precise vocabulary and use "delegate type" for the first case. I have been recently reading a lot about events and delegates and that ambiguity was making me confused many times. Some other uses of "delegate" word in MSDN in the first meaning: "Custom event delegates are needed only when an event generates event data" "A delegate declaration defines a class that is derived from the class System.Delegate" Some other uses of "delegate" word in MSDN in the second meaning: "specify a delegate that will be called upon the occurrence of some event" "Delegates are objects that refer to methods. They are sometimes described as type-safe function pointers" What do you think? Why did people from Microsoft introduced this ambiguity? Am I the only person to have conceptual problems with different notions being referenced with the same word.

    Read the article

  • Scripts fail when jQuery.js isn't cached. When cached, scripts run fine.

    - by Bob
    I have jQuery UI Tabs which load their content via AJAX. About once every 15 times when the entire page is loaded (not just XHR), things fail and I don't see the proper content in the tab. Fiddler showed me that when things fail I also see that jQuery.js and jQuery-ui.js are both sent to the browser in full (~100kB). Normally, a page load results in HTTP status code 304 for both of those files, they're not re-downloaded, and the page displays properly. When the status code is 200 and fresh copies of jQuery/UI are sent, things fail. I notice this most often in IE8, but that's because I use it for web development. I have seen it in Firefox, but for some reason I can't reproduce it now. Fiddler shows that the HTTP request asks for: GET /Scripts/jquery-1.3.2.min.js?_=1255309685187 HTTP/1.1 I can't figure out what the ?_=1255309685187 is for, but I'm guessing it's a token to indicate for how long the file should be cached. Since I can't reproduce the problem in Firefox right now, I don't know what Firebug says. Any insight would be appreciated. EDIT: This is with Visual Studio's development webserver.

    Read the article

  • While loop not reading in the last item

    - by Gandalf StormCrow
    I'm trying to read in a multi line string then split it then print it .. here is the string : 1T1b5T!1T2b1T1b2T!1T1b1T2b2T!1T3b1T1b1T!3T3b1T!1T3b1T1b1T!5T1*1T 11X21b1X 4X1b1X When I split the string with ! I get this without the last line string : 1T1b5T 1T1b5T1T2b1T1b2T 1T2b1T1b2T1T1b1T2b2T 1T1b1T2b2T1T3b1T1b1T 1T3b1T1b1T3T3b1T 3T3b1T1T3b1T1b1T 1T3b1T1b1T5T1*1T 5T1*1T11X21b1X 11X21b1X Here is my code : import java.io.BufferedInputStream; import java.util.Scanner; public class Main { public static void main(String args[]) { Scanner stdin = new Scanner(new BufferedInputStream(System.in)); while (stdin.hasNext()) { for (String line : stdin.next().split("!")) { System.out.println(line); for (int i = 0; i < line.length(); i++) { System.out.print(line.charAt(i)); } } } } } Where did I make the mistake, why is not reading in the last line? After I read in all lines properly I should go trough each line if I encounter number I should print the next char the n times the number I just read, but that is long way ahead first I need help with this. Thank you UPDATE : Here is how the output should look like : 1T1b5T 1T2b1T1b2T 1T1b1T2b2T 1T3b1T1b1T 3T3b1T 1T3b1T1b1T 5T1*1T 11X21b1X 4X1b1X Here is a solution in C(my friend solved it not me), but I'd stil wanted to do it in JAVA : #include <stdio.h> int main (void) { char row[134]; for (;fgets (row,134,stdin)!=NULL;) { int i,j=0; for (i=0;row[i]!='\0';i++) { if (row[i]<='9'&&row[i]>='1') j+=(row[i]-'0'); else if ((row[i]<='Z'&&row[i]>='A')||row[i]=='*') for (;j;j--) printf ("%c",row[i]); else if (row[i]=='b') for (;j;j--) printf (" "); else if (row[i]=='!'||row[i]=='\n') printf ("\n"); } } return 0; }

    Read the article

  • send email to list of users with different timezones?

    - by ylazez
    i use the following method to send email to list of users i want the (To) in each email to be for just the user only not all users i.e appears to the users that the email is sent to only him my guess is to loop on: message.addRecipients(Message.RecipientType.TO, address); then send the message right? , but this is a heavy process sending an email many times any ideas ? suppose that i have the timezone for each user and i want to send each user the message in his timzone, the same issue i guess setting sent date for each user in his timezone then sending the message, right ? the method is: try { Properties props = System.getProperties(); props.put("mail.smtp.host", "localhost"); // Get a mail session Session session = Session.getDefaultInstance(props, null); // Define a new mail message Message message = new MimeMessage(session); InternetAddress ia = new InternetAddress(); ia.setPersonal("MySite"); ia.setAddress(from); message.setFrom(ia); Address[] address = new Address[recievers.size()]; for (int i = 0; i < recievers.size(); i++) { address[i] = new InternetAddress(recievers.get(i)); } message.addRecipients(Message.RecipientType.TO, address); message.setSubject(subject); // Create a message part to represent the body text BodyPart messageBodyPart = new MimeBodyPart(); messageBodyPart.setContent(body, "text/html"); // use a MimeMultipart as we need to handle the file attachments Multipart multipart = new MimeMultipart(); // add the message body to the mime message multipart.addBodyPart(messageBodyPart); // Put all message parts in the message message.setContent(multipart); message.setSentDate(getCurrentDate()); // Send the message Transport.send(message); } catch (Exception ex) {}

    Read the article

  • Performance of a get unique elements/group by operation on an IEnumerable<T>.

    - by tolism7
    I was wondering how could I improve the performance of the following code: public class MyObject { public int Year { get; set; } } //In my case I have 30000 IEnumerable<MyObject> data = MethodThatReturnsManyMyObjects(); var groupedByYear = data.GroupBy(x => x.Year); //Here is the where it takes around 5 seconds foreach (var group in groupedByYear) //do something here. The idea is to get a set of objects with unique year values. In my scenario there are only 6 years included in the 30000 items in the list so the foreach loop will be executed 6 times only. So we have many items needing to be grouped in a few groups. Using the .Distinct() with an explicit IEqualityComparer would be an alternative but somehow I feel that it wont make any difference. I can understand if 30000 items is too much and that i should be happy with the 5 seconds I get, but I was wondering if the above can be imporved performance wise. Thanks.

    Read the article

  • Unusual heap size limitations in VS2003 C++

    - by Shane MacLaughlin
    I have a C++ app that uses large arrays of data, and have noticed while testing that it is running out of memory, while there is still plenty of memory available. I have reduced the code to a sample test case as follows; void MemTest() { size_t Size = 500*1024*1024; // 512mb if (Size > _HEAP_MAXREQ) TRACE("Invalid Size"); void * mem = malloc(Size); if (mem == NULL) TRACE("allocation failed"); } If I create a new MFC project, include this function, and run it from InitInstance, it works fine in debug mode (memory allocated as expected), yet fails in release mode (malloc returns NULL). Single stepping through release into the C run times, my function gets inlined I get the following // malloc.c void * __cdecl _malloc_base (size_t size) { void *res = _nh_malloc_base(size, _newmode); RTCCALLBACK(_RTC_Allocate_hook, (res, size, 0)); return res; } Calling _nh_malloc_base void * __cdecl _nh_malloc_base (size_t size, int nhFlag) { void * pvReturn; // validate size if (size > _HEAP_MAXREQ) return NULL; ' ' And (size _HEAP_MAXREQ) returns true and hence my memory doesn't get allocated. Putting a watch on size comes back with the exptected 512MB, which suggests the program is linking into a different run-time library with a much smaller _HEAP_MAXREQ. Grepping the VC++ folders for _HEAP_MAXREQ shows the expected 0xFFFFFFE0, so I can't figure out what is happening here. Anyone know of any CRT changes or versions that would cause this problem, or am I missing something way more obvious?

    Read the article

  • Magento products will not show in category

    - by Aaron
    I've recently been tasked with the build and deployment of a large Ecommerce site. In the past we've had to use the clients legacy X-cart installation for redevelopment (too far integrated with their existing work flow). We'd heard good things about Magento, so I've set up a test install to get to grips with it. After a couple of initial issues, there is a live development site which displays categories on the default theme. The problem we've hit now is that products don't display..! After a lot more in-depth research into this, all I've been able to discover is that quite a number of developers endorse using other solutions entirely, with the other 50% saying after the steep learning curve the platform is as wonderful as we'd initially been led to believe. Now, my test category is showing, so I know this is configured properly. I've set up three test products and associated them with this (all done following the Magento user guide), checked double checked and thrice checked the products are enabled and visible individually, yet still the front end says the category has no products in it. I've cleared the cache repeatedly, reset everything possible many times in index management - no products show up. I have to make a call tomorrow morning on whether we're going ahead with Magento. If I can't even get it to show products I'm going to have to go with something with a more established track record and more community support available. Can anybody advise what could possibly be wrong here?

    Read the article

  • Entity Framework + MySQL - Why is the performance so terrible?

    - by Cyril Gupta
    When I decided to use an OR/M (Entity Framework for MySQL this time) for my new project I was hoping it would save me time, but I seem to have failed it (for the second time now). Take this simple SQL Query SELECT * FROM POST ORDER BY addedOn DESC LIMIT 0, 50 It executes and gives me results in less than a second as it should (the table has about 60,000 rows). Here's the equivalent LINQ To Entities query that I wrote for this var q = (from p in db.post orderby p.addedOn descending select p).Take(50); var q1 = q.ToList(); //This is where the query is fetched and timed out But this query never even executes it times out ALWAYS (without orderby it takes 5 seconds to run)! My timeout is set to 12 seconds so you can imagine it is taking much more than that. Why is this happening? Is there a way I can see what is the actual SQL Query that Entity Framework is sending to the db? Should I give up on EF+MySQL and move to standard SQL before I lose all eternity trying to make it work? I've recalibrated my indexes, tried eager loading (which actually makes it fail even without the orderby clause) Please help, I am about to give up OR/M for MySQL as a lost cause.

    Read the article

  • SQLAlchemy Custom Type Which Contains Multiple Columns

    - by Kekoa
    I would like to represent a datatype as a single column in my model, but really the data will be stored in multiple columns in the database. I cannot find any good resources on how to do this in SQLAlchemy. I would like my model to look like this(this is a simplified example using geometry instead of my real problem which is harder to explain): class 3DLine(DeclarativeBase): start_point = Column(my.custom.3DPoint) end_point = Column(my.custom.3DPoint) This way I could assign an object with the (x, y, z) components of the point at once without setting them individually. If I had to separate each component, this could get ugly, especially if each class has several of these composite objects. I would combine the values into one encoded field except that I need to query each value separately at times. I was able to find out how to make custom types using a single column in the documentation. But there's no indication that I can map a single type to multiple columns. I suppose I could accomplish this by using a separate table, and each column would be a foreign key, but in my case I don't think it makes sense to have a one to one mapping for each point to a separate table, and this still does not give the ability to set the related values all at once.

    Read the article

  • What are the best software/website UI design you have even seen?

    - by Edwin
    What are the best UI design in terms of usability and esthetics you have even seen? I mean both desktop software (of all OS) and website. My list: Picasa 3 - the way it organizes photos. Find-and-highlight-as-you-type in google Chrome. Dynamic search hints when entering something in the search box in Gmail. I'm not a Mac OS X user, but I have seen in most windows on the top toolbar there are both the icons and texts shown for each function, as apposed to on Windows I have seen many programs (MS Office included) have many small toolbar icons which you can hardly understand what they do until you hover the mouse on it for a while to see the hints (if any). The ability to search an setting in Eclipse IDE. the way to make 3D models in Google Sketchup. the way to label an email in Gmail. What are you list? Well, I couldn't resist to list some annoying UI design I have experienced and remember at this moment. IE on Windows server, when you visit the new website, you have to click many times to get it added to the white list before you can start browsing, IIRC, it's not fixed in IE 8 when that last time I used it on Windows 2008. The default search behavior in the File Explorer on Windows xp, that animated thing... the dialog that shows up when you are trying to save a plain text CSV file in Excel after applied some formatting options which does not compatible with CSV.

    Read the article

  • How can get unique values from data table using dql?

    - by piemesons
    I am having a table in which there is a column in which various values are stored.i want to retrieve unique values from that table using dql. Doctrine_Query::create() ->select('rec.school') ->from('Records rec') ->where("rec.city='$city' ") ->execute(); Now i want only unique values. Can anybody tell me how to do that... Edit Table Structure: CREATE TABLE IF NOT EXISTS `records` ( `id` int(11) NOT NULL AUTO_INCREMENT, `state` varchar(255) COLLATE utf8_unicode_ci DEFAULT NULL, `city` varchar(255) COLLATE utf8_unicode_ci DEFAULT NULL, `school` varchar(255) COLLATE utf8_unicode_ci DEFAULT NULL, PRIMARY KEY (`id`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 COLLATE=utf8_unicode_ci AUTO_INCREMENT=16334 ; This is the Query I am using: Doctrine_Query::create() ->select('DISTINCT rec.city') ->from('Records rec') ->where("rec.state = '$state'") // ->getSql(); ->execute(); Generting Sql for this gives me: SELECT DISTINCT r.id AS r__id, r.city AS r__city FROM records r WHERE r.state = 'AR' Now check the sql generated:::: DISTINCT is on 'id' column where as i want Distinct on city column. Anybody know how to fix this. EDIT2 Id is unique cause its an auto incremental value.Ya i have some real duplicates in city column like: Delhi and Delhi. Right.. Now when i am trying to fetch data from it, I am getting Delhi two times. How can i make query like this: select DISTINCT rec.city where state="xyz"; Cause this will give me the proper output. EDIT3: Anybody who can tell me how to figure out this query..???

    Read the article

  • correct way of initializing variables

    - by OVERTONE
    ok this is just a shot in the dark but it may be the cause of most of the errors ive gotten. when your initializing something. lets say a smal swing program. would it go liek this variables here { private Jlist contactList; String [] contactArray; ArrayList <String> contactArrayList; ResultSet namesList constructor here public whatever() { GridLayout aGrid = new GridLayout(2,2,10,10); contact1 = new String(); contact2 = new String(); contact3 = new String(); contactArrayList = new ArrayList<String>(); // is something supposed too go in the () of this JList? contactList = new JList(); contactArray = new String[5]; from1 =new JLabel ("From: " + contactArray[1]); gridlayout.add(components)// theres too many components to write onto SO. } // methods here public void fillContactsGui() { createConnection(); ArrayList<String> contactsArrayList = new ArrayList<String>(); while (namesList.next()) { contactArrayList.add(namesList.getString(1)); ContactArray[1] = namesList[1]; } } i know this is probably a huge beginner question but this is the code ive gotten used too. im initializing thigns three and fours times without meaning too because im not sure where they gp. can anyone shed some light on this? p.s. sorry for the messy sample code. i done my best.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Visual Studio: Collapse Methods, but not Comments (Summary etc.)

    - by Alex
    Hello, is there a way (settings? "macro"? extension?) that I can simply toggle outlining so that only the using section and my methods collapse to their signature line, but my comments (summary and double slash comments) and classes stay expanded? Examples: 1) Uncollapsed using System; using MachineGun; namespace Animals { /// <summary> /// Angry animal /// Pretty Fast, too /// </summary> public partial class Lion { // // Dead or Alive public Boolean Alive; /// <summary> /// Bad bite /// </summary> public PieceOfAnimal Bite(Animal animalToBite) { return animalToBite.Shoulder; } /// <summary> /// Fatal bite /// </summary> public PieceOfAnimal Kill(Animal animalToKill) { return animalToKill.Head; } } } 2) Collapsed (the following is my desired result): using[...] namespace Animals { /// <summary> /// Angry animal /// Pretty Fast, too /// </summary> public partial class Lion { // // Dead or Alive public Boolean Alive; /// <summary> /// Bad bite /// </summary> public PieceOfAnimal Bite(Animal animalToBite)[...] /// <summary> /// Fatal bite /// </summary> public PieceOfAnimal Kill(Animal animalToKill)[...] } } This is how I prefer seeing my class files (the collapsed form). I've been doing the collapsing by hand a million times by now and I think there should be a way to automate/customize/extend VS to do it the way I want? Every time I debug/hit a breakpoint, it uncollapses and messes up things. If I collapse via the context menu's collapse to outline etc. it also collapses my comments which isn't desired. Appreciate your help!

    Read the article

  • Longer execution through Java shell than console?

    - by czuk
    I have a script in Python which do some computations. When I run this script in console it takes about 7 minutes to complete but when I run it thought Java shell it takes three times longer. I use following code to execute the script in Java: this.p = Runtime.getRuntime().exec("script.py --batch", envp); this.input = new BufferedReader(new InputStreamReader(p.getInputStream())); this.output = new BufferedWriter(new OutputStreamWriter(p.getOutputStream())); this.error = new BufferedReader(new InputStreamReader(p.getErrorStream())); Do you have any suggestion why the Python script runs three time longer in Java than in a console? update The computation goes as follow: Java sends data to the Python. Python reads the data. Python generates a decision tree --- this is a long operation. Python sends a confirmation that the tree is ready. Java receives the confirmation. Later there is a series of communications between Java and Python but it takes only several second.

    Read the article

  • Scalable Full Text Search With Per User Result Ordering

    - by jeremy
    What options exist for creating a scalable, full text search with results that need to be sorted on a per user basis? This is for PHP/MySQL (Symfony/Doctrine as well, if relevant). In our case, we have a database of workouts that have been performed by users. The workouts that the user has done before should appear at the top of the results. The more frequently they've done the workout, the higher it should appear in search matches. If it helps, you can assume we know the number of times a user has done a workout in advance. Possible Solutions Sphinx - Use Sphinx to implement full text search, do all the querying and sorting in MySQL. This seems promising (and there's a Symfony Plugin!) but I don't know much about it. Lucene - Use Lucene to perform full text search and put the users' completions into the query. As is suggested in this Stack Overflow thread. Alternatively, use Lucene to retrieve the results, then reorder them in PHP. However, both solutions seem clunky and potentially unscalable as a user may have completed hundreds of workouts. Mysql - No native full text support (InnoDB), so we'd have use LIKE or REGEX, which isn't scalable.

    Read the article

  • transmit a java.lang.reflect.Proxy over a network

    - by panzi
    Is there a convenient way to transmit an object including its code (the class) over a network (not just the instance data)? Don't ask me why I want to do this. It's in an assignment. I asked several times if that is really what they meant and the didn't rephrase their answer so I guess they really want us to transmit code (not just the field data) over a network. To be honest I have no clue why we need a Proxy in this assignment anyway, just writing a simple class would do IMO. The assignment says that we should instantiate the proxy on the server and transmit it to the client (and yes, they talk about a java.lang.reflect.Proxy, they name this class). Because there is no class file for a proxy I can't deploy that. I guess I would have to somehow read out the bytecode of the generated Proxy, transmit it to the client and then load it. Which makes absolutely no sense at all, but this seems what they want us to do. I don't get why.

    Read the article

< Previous Page | 466 467 468 469 470 471 472 473 474 475 476 477  | Next Page >