Search Results

Search found 19191 results on 768 pages for 'core location'.

Page 48/768 | < Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >

  • SkyDrive broken after upgrade to Windows 8.1: "This location can't be found, please try later"

    - by avo
    Upgrading from Windows 8 to Windows 8.1 via the Store upgrade path has screwed my SkyDrive. The C:\Users\<user name>\SkyDrive folder is empty (it only has single file desktop.ini). When I open the native (Store) SkyDrive app, I see "This location can't be found, please try later". I'm glad to still have my files alive online in my SkyDrive account. I tried disconneting from / reconnecting to my Microsoft Account with no luck. Anyone has an idea on how to fix this without reinstalling/refreshing Windows 8.1? From Event Viewer: Faulting application name: skydrive.exe, version: 6.3.9600.16412, time stamp: 0x5243d370 Faulting module name: unknown, version: 0.0.0.0, time stamp: 0x00000000 Exception code: 0x00000000 Fault offset: 0x0000000000000000 Faulting process ID: 0x4e8 Faulting application start time: 0x01cece256589c7ee Faulting application path: C:\Windows\System32\skydrive.exe Faulting module path: unknown Report ID: {...} Faulting package full name: Faulting package-relative application ID: Also: The machine-default permission settings do not grant Local Activation permission for the COM Server application with CLSID {C2F03A33-21F5-47FA-B4BB-156362A2F239} and APPID {316CDED5-E4AE-4B15-9113-7055D84DCC97} to the user NT AUTHORITY\LOCAL SERVICE SID (S-1-5-19) from address LocalHost (Using LRPC) running in the application container Unavailable SID (Unavailable). This security permission can be modified using the Component Services administrative tool. Never was a big fan of in-place upgrade anyway, but this time it was a machine which I use for work, with a lot of stuff already installed on it. Shouldn't have tried to upgrade it in the first place, but was convinced Windows 8.1 is a solid update. Another lesson learnt.

    Read the article

  • Firebox 1250e Core Failing?

    - by Noah
    We have 2 Firebox 1250e Core firewall boxes in our production environment, serving as an active and passive mode. A few months back, the active box was flashing a warning light, so our consultant removed it, and plugged it in to a test network. Everything appeared to be working fine, so he reloaded it into the production environment, and we didn't see any other issues. Fast forward to last week, and out network was constantly dropping connections over RDC, timing out, and performing as if there was a traffic issue. I turned off the production box and everything began to work fine immediately. At this point though, I'm not sure how to proceed. Should the box be completely replaced? Is there any recommended testing we could do to determine if there is a failure of some type with this device? Should we try upgrading the software on it? I know the environment isn't the issue, since the passive box (which is now the active one) is working fine. We'd like to have 2 in production though for safety failover purposes. I am not a network admin, but am hoping someone here might be able to provide some guidance.

    Read the article

  • Cluster Core Resource state of Exchange 2010 DAG

    - by Christoph
    I have two Exchange 2010 servers in a DAG and a witness server to implement mailbox resiliency. The two Exchange servers are in two subnets and the Windows failover cluster therefore has two IP address resources. I now that Exchange uses "core functionality" of Windows Server failover clustering, but it does not use all features. My setup also seems to work, but if I run the validation in the Windows Failover Cluster Manager, it complains about one of the IP address resources being offline. However, I cannot bring this resource online, because the server complains that "the specified cluster node is not the owner of the resource, or the node is not a possible owner of the resource". If I "Simulate failure of this resource", it becomes offline and the other IP becomes online. I have the vague idea that Exchange might use the state of the IP resource to identify the Primary Active Manager, but I am not sure. As it is obviously important that failover really works, I would like to be sure. Therefore, my question is: Is it normal that only one IP address resource in a Exchange 2010 DAG failover cluster is active at a time? If not, how do I bring both resources online at the same time given the error described above?

    Read the article

  • Default /server-status location not inheriting in Apache

    - by rmalayter
    I'm having a problem getting /server-status to work Apache 2.2.14 on Ubuntu Server 10.04.1. The default symlinks for status.load and status.conf are present in /etc/apache2/mods-enabled. The status.conf does include the location /server-status and appropriate allow/deny directives. However, the only vhost I have in sites-enabled looks like this. The idea is to proxy anything with a Tomcat URL to a cluster of tomcats, and anything else to an IIS box. However, this seems to result in requests to /server-status being sent to IIS. Copying the /server-status in explicitly to the Vhost configuration doesn't seem to help, no matter what order I use. Is it possible to include /server-status do this within a vhost configuration that has a "default" proxy rule?: <VirtualHost *:80> ServerAdmin webmaster@localhost DocumentRoot /var/www Header add Set-Cookie "ROUTEID=.%{BALANCER_WORKER_ROUTE}e; path=/" env=BALANCER_ROUTE_CHANGED <Proxy balancer://tomcatCluster> BalancerMember ajp://qa-app1:8009 route=1 BalancerMember ajp://qa-app2:8009 route=2 ProxySet stickysession=ROUTEID </Proxy> <ProxyMatch "^/(mytomcatappA|mytomcatappB)/(.*)" > ProxyPassMatch balancer://tomcatCluster/$1/$2 </ProxyMatch> #proxy anything that's not a tomcat URL to IIS on port 80 <Proxy /> ProxyPass http://qa-web1/ </Proxy>

    Read the article

  • Setting up Virtual Host in Fedora Core 15 using apache

    - by Roland
    I'm trying to setup a couple of Virtual Host files on my Localhost PC running Fedora Core 15. Now I get this working, but now onloy one Virtual Host site works, and if I type in 127.0.0.1/test/testApp.php which is not related to the Virtual Host site , I get redirected to the Virtual Host site. Here's what I did. I created a new folder called virtualhosts in /etc/httpd/ where all my host files are stored in the following format site.conf In /etc/conf/httpd.conf I enabled NameVirtualHost *:80 and included the host files at the bottom of the config page like this Include virtualhosts/*.conf In /etc/hosts I added the line 127.0.0.1 website No when I run sudo httpd -t I get Syntax OK I restart apache and then the Virtualhost works, but as soon as I add other hosts and only use 127.0.0.1 as above it still links to the original host. Am I doing anything wrong here or left out something? An example of my Virtual Host file looks like this <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /var/www/html/website/ ServerName website ServerAlias website ErrorLog logs/dev-error_log CustomLog logs/dev-access_log common Alias /blog /var/www/html/blog/ <Directory /var/www/html/website/> Options FollowSymLinks Allow Override All Order allow,deny allow from all </Directory> #php_value error_reporting E_ALL & ~E_NOTICE & ~E_DEPRECATED php_flag display_errors On php_value date.timezone Europe/London </VirtualHost>

    Read the article

  • Fedora Core 6 Migration

    - by Matthew Sprankle
    I am at a loss as to what I should to for this server. I need it to run php5.3 and corresponding version of mysql. I received a client today through work that is using Fedora core 6 running 10 very small websites on some very hodge podge setup. My original idea was just upgrade to php5.3. I have yum (installed 3.0.8) reconfigured for the fedora archive. The latest version of php it allows is 5.1.8. I am still relatively new to server setups and am nervous about wiping their server to upgrade it. Since it is about 6-8 years old I'm not sure if it will even support the newest version of fedora. The server specs are: Parallels Plesk Panel version 9.5.4 Operating system Linux 2.6.9-023stab048.4-smp CPU GenuineIntel, Intel(R) Xeon(R)CPU E5335 @ 2.00GHz (10gb disk space and 1gb of memory). I use fedora for my personal server so I was a little familiar with it. I haven't done anything too extravagant. Is there a way I can escape this nightmare with installing php5.3 or do I need to migrate these sites to a new server?

    Read the article

  • Unable to call webservice from another webservice : NETBEANS

    - by PhoeniX
    ############## WEBSERVICE 1 (banking.java) package bank; import client.TestserviceService; import javax.jws.WebMethod; import javax.jws.WebService; import javax.xml.ws.WebServiceRef; @WebService() public class banking { @WebServiceRef(wsdlLocation = "WEB-INF/wsdl/localhost_23164/testwebservice/testserviceService.wsdl") private TestserviceService service; /** * Web service operation */ @WebMethod(operationName = "getBalance") public int getBalance() { //TODO write your implementation code here: int a=-1; try { // Call Web Service Operation client.Testservice port = service.getTestservicePort(); // TODO process result here java.lang.String result = port.getData(); a= Integer.parseInt(result); System.out.println("Result = "+result); } catch (Exception ex) { // TODO handle custom exceptions here } return a; } } ##################### WEB SERVICE 2 package test; import javax.jws.WebService; @WebService() public class testservice { public String getData() { return "3"; } } I am trying to call webservice refernce of webservice 2 from webservice 1 it can be seen in the code I am using netbeans ****************************************** ERROR I AM GETTING IS INFO: parsing WSDL... INFO: [ERROR] Premature end of file. INFO: line 1 of http://localhost:23164/learnwebservice/bankingService?WSDL WARNING: StandardWrapperValve[banking]: PWC1406: Servlet.service() for servlet banking threw exception javax.servlet.ServletException at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:152) at javax.servlet.http.HttpServlet.service(HttpServlet.java:754) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:279) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:332) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:233) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:619) Caused by: javax.servlet.ServletException: Service not found at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:149) ... 26 more WARNING: StandardWrapperValve[banking]: PWC1406: Servlet.service() for servlet banking threw exception javax.servlet.ServletException at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:152) at javax.servlet.http.HttpServlet.service(HttpServlet.java:754) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:279) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:332) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:233) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:619) Caused by: javax.servlet.ServletException: Service not found at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:149) ... 26 more WARNING: StandardWrapperValve[banking]: PWC1406: Servlet.service() for servlet banking threw exception javax.servlet.ServletException at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:152) at javax.servlet.http.HttpServlet.service(HttpServlet.java:754) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:279) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:332) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:233) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:619) Caused by: javax.servlet.ServletException: Service not found at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:149) ... 26 more WARNING: StandardWrapperValve[banking]: PWC1406: Servlet.service() for servlet banking threw exception javax.servlet.ServletException at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:152) at javax.servlet.http.HttpServlet.service(HttpServlet.java:754) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:279) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:332) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:233) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:619) Caused by: javax.servlet.ServletException: Service not found at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:149) ... 26 more INFO: [ERROR] Premature end of file. Failed to read the WSDL document: http//localhost:23164/learnwebservice/bankingService?WSDL, because 1) could not find the document; /2) the document could not be read; 3) the root element of the document is not . INFO: [ERROR] failed.noservice=Could not find wsdl:service in the provided WSDL(s): At least one WSDL with at least one service definition needs to be provided. INFO: Failed to parse the WSDL. INFO: Invoking wsimport with http//localhost:23164/learnwebservice/bankingService?WSDL SEVERE: wsimport failed INFO: parsing WSDL... INFO: [ERROR] Premature end of file. INFO: line 1 of http//localhost:23164/learnwebservice/bankingService?WSDL WARNING: StandardWrapperValve[banking]: PWC1406: Servlet.service() for servlet banking threw exception javax.servlet.ServletException at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:152) at javax.servlet.http.HttpServlet.service(HttpServlet.java:754) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:279) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:332) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:233) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:619) Caused by: javax.servlet.ServletException: Service not found at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:149) ... 26 more WARNING: StandardWrapperValve[banking]: PWC1406: Servlet.service() for servlet banking threw exception javax.servlet.ServletException at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:152) at javax.servlet.http.HttpServlet.service(HttpServlet.java:754) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:279) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:332) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:233) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:619) Caused by: javax.servlet.ServletException: Service not found at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:149) ... 26 more WARNING: StandardWrapperValve[banking]: PWC1406: Servlet.service() for servlet banking threw exception javax.servlet.ServletException at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:152) at javax.servlet.http.HttpServlet.service(HttpServlet.java:754) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:279) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:332) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:233) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:619) Caused by: javax.servlet.ServletException: Service not found at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:149) ... 26 more WARNING: StandardWrapperValve[banking]: PWC1406: Servlet.service() for servlet banking threw exception javax.servlet.ServletException at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:152) at javax.servlet.http.HttpServlet.service(HttpServlet.java:754) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:279) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:332) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:233) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:619) Caused by: javax.servlet.ServletException: Service not found at org.glassfish.webservices.JAXWSServlet.doPost(JAXWSServlet.java:149) ... 26 more INFO: [ERROR] Premature end of file. Failed to read the WSDL document: http//localhost:23164/learnwebservice/bankingService?WSDL, because 1) could not find the document; /2) the document could not be read; 3) the root element of the document is not . INFO: [ERROR] failed.noservice=Could not find wsdl:service in the provided WSDL(s): At least one WSDL with at least one service definition needs to be provided. INFO: Failed to parse the WSDL. INFO: Invoking wsimport with http//localhost:23164/learnwebservice/bankingService?WSDL SEVERE: wsimport failed

    Read the article

  • Skyrim: Heavy Performance Issues after a couple of location changes

    - by Derija
    Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

    Read the article

  • filtering itunes library items by file location

    - by Cawas
    3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

    Read the article

  • High load on X3220 Quad Core Linux Apache server

    - by John Templar
    I'm seriously in need of help. My sites are now nearly impossible to use because of massive loads on my server. I'm already a month late on my mortgage and this really isn't helping my situation. I've been working on fixing this intermittent load problem for months (never this bad). I'm suspecting some kind of attack since I'm under DDOS attack a lot! I've been trying to figure out what is causing the load but I'm afraid I just don't have the experience or knowledge to understand all the data I've been looking at. I don't even know where to begin or how to test for the large array of attacks out there. Here's some data you might find useful... Server: Xeon X3220 Quad Core 2.4 GHz - Linux, FreeBSD 500 GB HD and 8 Gig of Ram. Runs Centos release 5.7 Server Version: Apache/2.2.21 (Unix) mod_ssl/2.2.21 OpenSSL/0.9.8e-fips-rhel5 mod_auth_passthrough/2.1 mod_bwlimited/1.4 FrontPage/5.0.2.2635 mod_qos/9.74 Warning: All sites are softcore adult sites - mostly fantasy art like elves and amazons. 1) Sites may run fine for weeks or just days at less than 10 load then start jumping to 40-80 load - no idea why. Same sites, same mods, same amount of traffic - just WHAM! 2) I get an email almost every day that says: "Large Number of Failed Login Attempts from IP (different each time)". My webhost (who almost never helps me) told me it was a udp flood or something. 3) I've changed the port for MySQL from the default. If I ever put it back to the default - I get Loads of over 100 from what must be a constant mysql port flood. 4) I've reconfigured MYSQL. Link: http://www.deadlyamazons.com/logs/mycnf.txt 5) I have 3 Joomla Jomsocial networks. I've spent a couple weeks turning all the mods/plugins off, waiting a day and then turning them back on the next day or later if there isn't any change (there hasn't been). For example, on Thursday I'll turn off videos, on Friday I'll turn off chat.. etc and nothing changes the load appreciably. 6) Joomla info: All SEF turned off - sh404sef completely disabled and removed. Components: Joomla 1.5.22, Jomsocial 2.0.5, Kunena 1/31/2011, HWDMediashare 11/22/2010 and JBolo Chat 2.7.3, Comet Chat or Envolve Chat. Page Compression is on, Cache is on 15 mins. Please click on this forum to see links to all my reports: http://forum.joomla.org/viewtopic.php?f=433&t=706035&p=2777500#p2777500 Any help would be highly appreciated.

    Read the article

  • Clear OS always showing "Operation too slow. Less than 1 bytes/sec"

    - by Blue Gene
    Have been trying to install clear os addon but nothing is working as i am facing this error on every mirror in the .repo file. Yum install squid http://mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on http://mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-houston.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-houston.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'O*peration too slow. Less than 1 bytes/sec transfered the last 30 seconds'*) Trying other mirror. mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. Error: failure: repodata/primary.sqlite.bz2 from clearos-core: [Errno 256] No more mirrors to try. How can i fix this.i am able to access repo through web,and it seems nothing wrong with the repo.Where can be the problem. Tried yum clean all but it also didnt help. Is there a way to fix it as i am not able to install any package in it.

    Read the article

  • How to compare old laptop to new laptop?

    - by Lasse V. Karlsen
    I hope this question doesn't get closed at once :) I have an old laptop, a Compaq NC4200, which is going its final laps around the track these days. Battery is dead, and everything kinda runs slow. It also has only 1GB of memory, and even though I don't know if it can take more, I probably wouldn't be able to get hold of any that matches without having to special order it. The size, however, has been ideal for my usage pattern, so I'm looking to replace it with a similarly sized laptop, at least in the same size category. However, it's been a while since I tried keeping track of CPUs, so I have a question. The old laptop has a Intel Pentium M 760 1.86GHz processor. One laptop I found online has a Intel Pentium SU4100 1.3GHz dual-core. This type of processor seems to be quite common in the price and size-range I've been looking. What kind of relative performance boost could I expect from the old one to the new one? I am not expecting a "about 7.45x speed", but some indication would be nice. For instance, dual-core tells me it might be akin to 2.6GHz, but I assume I can't simply compare 1.86GHz to 2.6GHz and expect the new one to run about 1.4x as fast, I expect more these days. Or is that unrealistic for this kind of processor? Do I need to up my price range and go for a 2+ GHz processor?

    Read the article

  • S5000XVN Intel Motherboard - Only sees 12 out of 16GB of RAM

    - by Richie086
    So I have an older Intel S5000XVN motherboard, here are the specs CPU Arch : 2 CPU - 2 Cores - 2 Threads CPU PSN : Intel Xeon CPU 5160 @ 3.00GHz CPU EXT : MMX, SSE (1, 2, 3, 3S), EM64T, VT-x CPUID : 6.F.6 / Extended : 6.F CPU Cache : L1 : 2 x 32 / 2 x 32 KB - L2 : 4096 KB Core : Woodcrest (65 nm) / Stepping : B2 Freq : 2985.21 MHz (331.69 * 9) MB Brand : Intel MB Model : S5000XVN NB : Intel 5000X rev 31 SB : Intel 6321ESB rev 09 RAM : 16384 MB FB-DDR2 RAM Speed : 331.7 MHz (1:1) @ N/A Slot 1 : 2048MB (5300) Slot 1 Manufacturer : Kingston Slot 2 : 2048MB (5300) Slot 2 Manufacturer : Qimonda Slot 3 : 2048MB (5300) Slot 3 Manufacturer : Kingston Slot 4 : 2048MB (5300) Slot 4 Manufacturer : Qimonda Slot 5 : 2048MB (5300) Slot 5 Manufacturer : Kingston Slot 6 : 2048MB (5300) Slot 6 Manufacturer : Qimonda As you can clearly see, CPU-Z says I have 16GB of PC2-5300 RAM installed. For some reason in both BIOS and in Windows the maximum usable RAM is 12GB instead of 16GB. I have a dedicated video card connnected, so it can't be stealing RAM to use for the GPU (the S5000XVN does not have any onboard video). I am running Windows Server 2008 R2 x64 as the primary OS - so there should not be a memory limitation imposed on me from the OS. Has anyone experienced this before? Any ideas on how I can actually use all 16GB of RAM? I plan on using this machine to use for a Hyper-V server and have x2 Quad Core Xeon CPUs on the way as I write this post.

    Read the article

  • How to compare old CPU to new CPU?

    - by Lasse V. Karlsen
    I hope this question doesn't get closed at once :) I have an old laptop, a Compaq NC4200, which is going its final laps around the track these days. Battery is dead, and everything kinda runs slow. It also has only 1GB of memory, and even though I don't know if it can take more, I probably wouldn't be able to get hold of any that matches without having to special order it. The size, however, has been ideal for my usage pattern, so I'm looking to replace it with a similarly sized laptop, at least in the same size category. However, it's been a while since I tried keeping track of CPUs, so I have a question. The old laptop has a Intel Pentium M 760 1.86GHz processor. One laptop I found online has a Intel Pentium SU4100 1.3GHz dual-core. This type of processor seems to be quite common in the price and size-range I've been looking. What kind of relative performance boost could I expect from the old one to the new one? I am not expecting a "about 7.45x speed", but some indication would be nice. For instance, dual-core tells me it might be akin to 2.6GHz, but I assume I can't simply compare 1.86GHz to 2.6GHz and expect the new one to run about 1.4x as fast, I expect more these days. Or is that unrealistic for this kind of processor? Do I need to up my price range and go for a 2+ GHz processor?

    Read the article

  • Does using a hexacore CPU make sense?

    - by Exa
    I'm currently planning to upgrade my computer system and I want to exchange CPU, board and RAM. I already had a look at some hexacore-CPUs from AMD and would like to know if it makes any sense to use such a CPU with six cores. Is there any software which really uses six cores? Especially in gaming? I'm using this PC mostly for gaming and from time to time for developing. I know that on the dual-core system (2 x 3GHz) I currently use, Visual Studio creates two instances of the compiler, one for each core. Would there be six instances of the compiler on a hexacore system for super fast compiling? Is there any software that uses six cores? Would running two applications cause the usage of more CPUs? (For example two CPUs for a game you're playing while two other CPUs are used for compiling at the same time) I hope someone can point out the benefits of a hexacore system. The OS would be Windows 7 64 Bit and I use the PC for gaming most of the time. (Crysis 2, CoD, stuff like that)

    Read the article

  • quad sli with gtx 690 not working

    - by Moaadh
    I have two cards GTX 690 (dual core). I did the Sli successfully. Nvidia control panel acknowledges the two cards as quad Sli. However, the problem is that Windows 7 64-bit Ultimate is showing me the graph memory size as 4 GB while it is supposed to be 8 GB because of the Sli. Also the benchmark from all software is giving me a very low score compared to some other guy's benchmark on YouTube. It gives me a big headache. Does anyone know why this is happening? If so, how can I get Windows 7 to recognize all 8 GB of memory? Thanks for your help in advance. My computer specifications: (Processor: Intel Core i7-3930k @3.2GHz(12CPUs))--- (Memory: 65536 MB Ram 1866 MHz)-- (OS: Windows 7 Ultimate 64-bit)-- (OCZ 240GB as SSD PCIe drive for booting and storage disk)-- (DirextX version: DirectX 11)-- (VGA Card: 2 X EVGA GTX 690 Dual GPU. Each GPU is 2 GB, so total memory should be 8 GB.)-- (MotherBoard: ASUS Rampage IV Extreme)-- Others with lesser specifications get a 2500 score in heaven benchmark while I get 1501 as if it is one card.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • Cocoa Core data: cannot save Created Items in NSTableview

    - by Paul Rostorp
    Hello, I'm am a beginner in mac os x development and am trying to get started with all this. Here is my problem : I've create a non-document based cocoa app using core data as storage. I've added an entity and attributes to the xdatamodel. In IB i've created an NSArrayController and linked it properly. I've created an nstableview binded to the nsarraycontroller. Next I added a button linked to nsarraycontroller with the " add: " method. When I try it out, I can add and edit the items in the table. Here comes the problem: Core data is supposed to save everything automatically, but to make sure i linked the "save" button in the menu to the appdelegate and to the " file's owner" , first responder, application... everything possible ( with both " save :" and " saveaction:" methods ). And still it doesn't save when clicking save: when I restart the cell created ( and renamed ) are gone. And also, I didn't even edit the source code yet; core data for such simple tasks is supposed to only need Interface builder. Please help me for this, I haven't found any threads resolving this problem. Thank you in advance.

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • Why should I use core.autocrlf in Git

    - by Rich
    I have a Git repository that is accessed from both Windows and OS X, and that I know already contains some files with CRLF line-endings. As far as I can tell, there are two ways to deal with this: Set core.autocrlf to false everywhere, Follow the instructions here (echoed on GitHub's help pages) to convert the repository to contain only LF line-endings, and thereafter set core.autocrlf to true on Windows and input on OS X. The problem with doing this is that if I have any binary files in the repository that: a). are not correctly marked as binary in gitattributes, and b). happen to contain both CRLFs and LFs, they will be corrupted. It is possible my repository contains such files. So why shouldn't I just turn off Git's line-ending conversion? There are a lot of vague warnings on the web about having core.autocrlf switched off causing problems, but very few specific ones; the only that I've found so far are that kdiff3 cannot handle CRLF endings (not a problem for me), and that some text editors have line-ending issues (also not a problem for me). The repository is internal to my company, and so I don't need to worry about sharing it with people with different autocrlf settings or line-ending requirements. Are there any other problems with just leaving line-endings as-is that I am unaware of?

    Read the article

  • local vs core contoller

    - by latvian
    Hi, I am adding new column and action in the local admin app/code/local/Mage/Adminhtml/Block/Catalog/Product/Grid.php which works fine, however. The local controller/app/code/local/Mage/Adminhtml/Block/Catalog/Product.php is not being used or is not overloading the admin one /app/code/core/Mage/Adminhtml/Block/Catalog/Product.php. This is almost fresh install of Magento 1.4.0.1. I am the only one working, so i know it is not overloaded by some custom controller. I have disabled all custom modules. I have rolled back most of my changes. I have checked /etc/Modules/Mage_Catalog.xml. Refreshed cache all possible ways, loged in and out. Nothing....still using the core contoller copy. why? How do you troubleshoot, meaning, at what moment magento decides using between core or local copies? ...its even more strange because it does not parse local Adminhtml config.xml but uses local Adminthml copy of Blocks. Any pointer would help. I would like to keep everything in local code. Thank You, Margots

    Read the article

  • AMD 24 core server memory bandwidth

    - by ntherning
    I need some help to determine whether the memory bandwidth I'm seeing under Linux on my server is normal or not. Here's the server spec: HP ProLiant DL165 G7 2x AMD Opteron 6164 HE 12-Core 40 GB RAM (10 x 4GB DDR1333) Debian 6.0 Using mbw on this server I get the following numbers: foo1:~# mbw -n 3 1024 Long uses 8 bytes. Allocating 2*134217728 elements = 2147483648 bytes of memory. Using 262144 bytes as blocks for memcpy block copy test. Getting down to business... Doing 3 runs per test. 0 Method: MEMCPY Elapsed: 0.58047 MiB: 1024.00000 Copy: 1764.082 MiB/s 1 Method: MEMCPY Elapsed: 0.58012 MiB: 1024.00000 Copy: 1765.152 MiB/s 2 Method: MEMCPY Elapsed: 0.58010 MiB: 1024.00000 Copy: 1765.201 MiB/s AVG Method: MEMCPY Elapsed: 0.58023 MiB: 1024.00000 Copy: 1764.811 MiB/s 0 Method: DUMB Elapsed: 0.36174 MiB: 1024.00000 Copy: 2830.778 MiB/s 1 Method: DUMB Elapsed: 0.35869 MiB: 1024.00000 Copy: 2854.817 MiB/s 2 Method: DUMB Elapsed: 0.35848 MiB: 1024.00000 Copy: 2856.481 MiB/s AVG Method: DUMB Elapsed: 0.35964 MiB: 1024.00000 Copy: 2847.310 MiB/s 0 Method: MCBLOCK Elapsed: 0.23546 MiB: 1024.00000 Copy: 4348.860 MiB/s 1 Method: MCBLOCK Elapsed: 0.23544 MiB: 1024.00000 Copy: 4349.230 MiB/s 2 Method: MCBLOCK Elapsed: 0.23544 MiB: 1024.00000 Copy: 4349.359 MiB/s AVG Method: MCBLOCK Elapsed: 0.23545 MiB: 1024.00000 Copy: 4349.149 MiB/s On one of my other servers (based on Intel Xeon E3-1270): foo2:~# mbw -n 3 1024 Long uses 8 bytes. Allocating 2*134217728 elements = 2147483648 bytes of memory. Using 262144 bytes as blocks for memcpy block copy test. Getting down to business... Doing 3 runs per test. 0 Method: MEMCPY Elapsed: 0.18960 MiB: 1024.00000 Copy: 5400.901 MiB/s 1 Method: MEMCPY Elapsed: 0.18922 MiB: 1024.00000 Copy: 5411.690 MiB/s 2 Method: MEMCPY Elapsed: 0.18944 MiB: 1024.00000 Copy: 5405.491 MiB/s AVG Method: MEMCPY Elapsed: 0.18942 MiB: 1024.00000 Copy: 5406.024 MiB/s 0 Method: DUMB Elapsed: 0.14838 MiB: 1024.00000 Copy: 6901.200 MiB/s 1 Method: DUMB Elapsed: 0.14818 MiB: 1024.00000 Copy: 6910.561 MiB/s 2 Method: DUMB Elapsed: 0.14820 MiB: 1024.00000 Copy: 6909.628 MiB/s AVG Method: DUMB Elapsed: 0.14825 MiB: 1024.00000 Copy: 6907.127 MiB/s 0 Method: MCBLOCK Elapsed: 0.04362 MiB: 1024.00000 Copy: 23477.623 MiB/s 1 Method: MCBLOCK Elapsed: 0.04262 MiB: 1024.00000 Copy: 24025.151 MiB/s 2 Method: MCBLOCK Elapsed: 0.04258 MiB: 1024.00000 Copy: 24048.849 MiB/s AVG Method: MCBLOCK Elapsed: 0.04294 MiB: 1024.00000 Copy: 23847.599 MiB/s For reference here's what I get on my Intel based laptop: laptop:~$ mbw -n 3 1024 Long uses 8 bytes. Allocating 2*134217728 elements = 2147483648 bytes of memory. Using 262144 bytes as blocks for memcpy block copy test. Getting down to business... Doing 3 runs per test. 0 Method: MEMCPY Elapsed: 0.40566 MiB: 1024.00000 Copy: 2524.269 MiB/s 1 Method: MEMCPY Elapsed: 0.38458 MiB: 1024.00000 Copy: 2662.638 MiB/s 2 Method: MEMCPY Elapsed: 0.38876 MiB: 1024.00000 Copy: 2634.043 MiB/s AVG Method: MEMCPY Elapsed: 0.39300 MiB: 1024.00000 Copy: 2605.600 MiB/s 0 Method: DUMB Elapsed: 0.30707 MiB: 1024.00000 Copy: 3334.745 MiB/s 1 Method: DUMB Elapsed: 0.30425 MiB: 1024.00000 Copy: 3365.653 MiB/s 2 Method: DUMB Elapsed: 0.30342 MiB: 1024.00000 Copy: 3374.849 MiB/s AVG Method: DUMB Elapsed: 0.30491 MiB: 1024.00000 Copy: 3358.328 MiB/s 0 Method: MCBLOCK Elapsed: 0.07875 MiB: 1024.00000 Copy: 13003.670 MiB/s 1 Method: MCBLOCK Elapsed: 0.08374 MiB: 1024.00000 Copy: 12228.034 MiB/s 2 Method: MCBLOCK Elapsed: 0.07635 MiB: 1024.00000 Copy: 13411.216 MiB/s AVG Method: MCBLOCK Elapsed: 0.07961 MiB: 1024.00000 Copy: 12862.006 MiB/s So according to mbw my laptop is 3 times faster than the server!!! Please help me explain this. I've also tried to mount a ram disk and use dd to benchmark it and I get similar differences so I don't think mbw is to blame. I've checked the BIOS settings and the memory seem to be running at full speed. According to the hosting company the modules are all OK. Could this have something to do with NUMA? It seems like Node Interleaving is disabled on this server. Will enabling it (thus turning off NUMA) make a difference? foo1:~# numactl --hardware available: 4 nodes (0-3) node 0 cpus: 0 1 2 3 4 5 node 0 size: 8190 MB node 0 free: 7898 MB node 1 cpus: 6 7 8 9 10 11 node 1 size: 12288 MB node 1 free: 12073 MB node 2 cpus: 18 19 20 21 22 23 node 2 size: 12288 MB node 2 free: 12034 MB node 3 cpus: 12 13 14 15 16 17 node 3 size: 8192 MB node 3 free: 8032 MB node distances: node 0 1 2 3 0: 10 20 20 20 1: 20 10 20 20 2: 20 20 10 20 3: 20 20 20 10

    Read the article

< Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >