Search Results

Search found 24202 results on 969 pages for 'window location'.

Page 48/969 | < Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >

  • How to fix this window.open memory leak?

    - by DotnetShadow
    Hi there, I was recently looking at this memory leak tool sIEve: http://home.orange.nl/jsrosman/ So I decided to test out the tool by creating a main page that will open up a popup window. I started by creating 3 pages: index.html, page1.html and page2.html, the index.html page will open a child window (popup) linking to page1.html. Page1 will have a anchor tag that links to page2.html, while page2 will have a link back to page1.html PROBLEM So in the tool I entered the index.html page, popup window opened to page1.html, I then clicked the page2 link, no leaks detected yet. While I'm on page2 I click the link back to page1, and that's where the tool claims there is a link. The leak seems to be happening on the index.html page and I have no idea as to why it would be doing that. Even more concerning is that I can see elements that the tool detects that aren't even on my page. Does anyone have any experience with this tool or know if this really is a memory leak? Any samples of showing how to achieve what I'm doing without memory leaks? INDEX.HTML <script type="text/javascript"> MYLEAK = function() { var childWindow = null; function showWindow() { childWindow = window.open("page1.html", "myWindow"); return false; } return { init: function() { $("#window-link").bind("click", showWindow); } } }(); </script> </head> <body> <a id="window-link" href="#" on>Open Window</a> <script type="text/javascript"> $(document).ready(function() { MYLEAK.init(); }); </script> </body> </html> PAGE1.HTML <html> <body> <h1>Page 1</h1> <a href="page2.html">Page2</a> </body> </html> PAGE2.HTML <html> <body> <h1>Page 2</h1> <a href="page1.html">Page1</a> </body> </html> Appreciate your efforts.

    Read the article

  • GNOME 2 + Compiz equivalent?

    - by virtualeyes
    Running Fedora 14 and realize I need to either change distros or find an alternative to GNOME 3 in Fedora 17. Based on what I have read to-date, XFCE and KDE are the go-to WMs if I want to avoid GNOME 3. I tried KDE 4 and I wasn't impressed; I like the simplicity of GNOME 2 with Compiz and Emerald. Can't stay on Fedora 14 forever, however, so...where to turn? Basically looking for these features in my desktop environment: GNOME Do or equivalent Snap to grid/Window tiling A must-have, the ability to hot key focused window to a monitor grid region is a huge productivity win. Zoom window to cursor In a multi-monitor setup sometimes it's nice to, say, GNOME Do terminal in one monitor and then hot key the opened window to the other monitor just by zipping the mouse cursor anywhere on target monitor (followed by, of course, snap-to-grid hotkey, all without a single mouse click) Polarization At night white background hurts the eyes, so I prefer to hot key polarize to black. Multi-monitor support I'm partial to Fedora given that I've worked with CentOS for years and have little experience with any other Linux distro; however, if the difference between Fedora and Arch, Mint, etc. is fairly subtle, I'll make the leap, just need a distro & desktop environment that allows me to be productive with keyboard hot keys and provides the above basic features. Any suggestions?

    Read the article

  • How can I make Cygwin open a new window each time I use a Window 7 keyboard shortcut?

    - by Michael Gundlach
    [Update: The short answer is, if an application in the 3rd thing on your taskbar, press WindowsKey+Shift+3 to open a new instance. Hooray!] I have Chrome and Cygwin on my taskbar. Chrome's shortcut is Ctrl-Alt-C (as set through right clicking the icon and putting Ctrl-Alt-C into Chrome - Properties - Shortcut Key). Cygwin's shortcut is Ctrl-Alt-T. When I press Ctrl-Alt-C, I get a new Chrome window. Great! It's as if I had shift-clicked on the Chrome icon. When I press Ctrl-Alt-T, I get a Cygwin window the first time, but after that I just get focused on the Cygwin window. As if I had simply clicked on the Cygwin icon and not shift-clicked. As if Cygwin wasn't able to have more than one instance open. I can still shift-click the icon to get more instances. I've tried with different keys than Ctrl-Alt-T and got the same behavior. Strangely, I've twice managed to get it into a state (via just clearing and setting the shortcut key over and over) where a shortcut WOULD open multiple instances -- but it was Ctrl-Alt-G both times, which doesn't make sense to my brain which has been trained to use Ctrl-Alt-T for years. Ctrl-Alt-G usually behaves just as poorly as Ctrl-Alt-T, except for the two times when magically it started behaving properly. So I'm thinking this is a Windows 7 bug (which has existed since Windows XP at least), but I'm hoping someone knows something I don't :)

    Read the article

  • Skyrim: Heavy Performance Issues after a couple of location changes

    - by Derija
    Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

    Read the article

  • Chrome's new window disappear from desktop

    - by faulty
    I'm having this problem with Chrome on a Windows 7 x86 machine. I'm using Chrome for a locally hosted intranet web app. In the web app, there's frequent use of new window which popup, which works like a dialog box for the app. The problem started since yesterday. All the new windows doesn't appear on top and no where to be found on the desktop. But it does appear on the taskbar. Clicking the button on the taskbar doesn't bring up the window as well. I've also tried Alt+Space, then Move, it doesn't work. I only found 2 way to bring it up, Maximize or Show as tab. What could have caused this and how should I fix it? Thanks EDIT: I've configure to not group taskbar buttons. EDIT: I've just gone through the javascript of the button, it call window.open to display the popup. I can see the popup flicker and disappear. If I step through the code, the popup will display properly, sometime. Also, if I click the button twice, it will also display the popup, but at a much smaller size, less than 100x100

    Read the article

  • filtering itunes library items by file location

    - by Cawas
    3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

    Read the article

  • Anonymous file sharing without login window, from Windows 7 server to XP clients

    - by Niten
    I'm trying to provide machines on a small LAN with read-only, anonymous access to files shared from a Windows 7 workstation (let's call it WIN7SVR). In particular, I don't want clients to have to deal with a login window when they navigate to, e.g., \\WIN7SVR in Windows Explorer, but we do not have a domain and synchronizing accounts between the server and clients would be intractable. There are both Windows 7 and Windows XP clients that need access to these shares. I got this working for Windows 7 clients by just enabling the Guest account on WIN7SVR and setting appropriate share permissions. Other Windows 7 machines automatically try logging in as Guest, it seems, so their users don't have to deal with the login window. The problem is with the XP clients--they can access the server if the user enters "Guest" in the login window, but I don't want users to have to do that. So from what I gather, in my limited understanding of Windows file sharing, this boils down to granting null sessions access to file shares on WIN7SVR. But I've had no success so far on that front. I've tried all the following in the local group policy editor on the Windows 7 server: Set Network access: Let Everyone permissions apply to anonymous users to Enabled Set Network access: Restrict anonymous access to Named Pipes and Shares to Disabled Added the names of corresponding shares to Network access: Shares that can be accessed anonymously Added "ANONYMOUS LOGON" to Access this computer from the network under User Rights Assignment Any advice would be highly appreciated... I'm mostly a Unix guy, so I feel somewhat out of my league with Windows file sharing. I do understand that any sort of anonymous access to file shares isn't generally ideal from a security standpoint, but it's the most practical solution for us in this case, and access to our network is well enough controlled that share-level security isn't a concern.

    Read the article

  • Firefox window disappears

    - by Lord Torgamus
    Now this is odd. At some point in the last half hour, my Firefox window disappeared. I didn't notice, as I was working in another program at the time. No Firefox icon shows up with Alt-Tab, and no Firefox listing shows up under the Applications tab in the task manager. There is a Firefox entry under the Processes tab. Normally, I probably wouldn't have noticed, just opened Firefox up again, but I'm listening to an Internet radio station and the stream never stopped. When I did open a new Firefox window, it showed up in the Task Manager's applications tab. I'm running Windows XP, and my Firefox has the add-ons Adblock Plus, BetterPrivacy, Cert Viewer Plus, DOM Inspector, Firebug, Greasemonkey, Java Quick Starter, Live HTTP headers, Microsoft .NET Framework Assistant, NoScript, WebDeveloper and XPather. The radio station is Slacker; it's never given me any trouble before, and I've been using it for months. I don't think there was anything unusual in my open tabs; just a few static pages at non-sketchy sites like Java APIs, plus GMail and the aforementioned Slacker. Googling brought up a handful of similar-but-not-quite-the-same errors, none of which had useful resolutions. Does anyone know how to bring that window back and/or prevent this from happening again?

    Read the article

  • What is causing ocassional white windows on my Mac?

    - by user63333
    Hello. I'm having a very strange problem with my Mac lately. When I'm working in an app and a new window pane or sheet is displayed, sometimes it comes up completely white. Once an app is having these problems, it will continue to bring up a blank screen for that particular window (although other windows work fine). After the app is relaunched, the window is fine again. What I'm noticing that's very strange is that although the interface turns completely white, the functions of the interface are still available. So I have to "navigate blindly" around the interface, until I can relaunch. This occurs throughout the operating system. Screenshots: This is what happened when I tried opening the File menu in Lightroom app. What happened to me on Lynda.com (in Firefox) after selecting the "Software..." dropdown. (All other dropdowns were fine. Reloading the page fixed it.) When I was decompressing a file, The Unarchiver launched and opened this white window. It still decompressed the file. This is what happened one time when I opened Finder (with TotalFinder) to my Downloads folder. This is something I've never seen before. This just started happening lately. What could be the problem? Thanks for your help. NOTE: since new users are not allowed to post images, just image blank white interface elements. And since new users also aren't allowed to post more than one link, here's the first screenshot:

    Read the article

  • C# lost local variable window from debug (f11 step by step)

    - by Jane
    I was running my code (visual studio 2010) and I accidentally closed the window that shows the state of variables step by step. I think it was called locals but I can't find it on any of the menu option. Would appreciate any help on this, I didn't realize how handy it was until now - The following link is what my local window looks like when selecting debug/start debugging/selecting breakpoints, which I'm don't find helpful. This is what my window used to look like: http://www.google.co.nz/imgresum=1&hl=en&sa=N&biw=1600&bih=761&tbm=isch&tbnid=Sa5AmVW5BxxakM:&imgrefurl=http://www.codeproject.com/Articles/79508/Mastering-Debugging-in-Visual-Studio-2010-A-Beginn&docid=4Iskh8P-E7oVSM&imgurl=http://www.codeproject.com/KB/cs/MasteringInDebugging/debug30_small.png&w=640&h=228&ei=TjKBUKGwKcXVsgauvIGYDQ&zoom=1&iact=hc&vpx=1119&vpy=441&dur=1559&hovh=134&hovw=376&tx=219&ty=79&sig=104270260849502265426&page=1&tbnh=91&tbnw=256&start=0&ndsp=22&ved=1t:429,r:0,s:20,i:134 It's probably a mode/option within debugging I need to select but I can't figure out how to get it back to the nice and simple variable state display..

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • my layout breaks in IE7 and javascript page reloads make the screen blink

    - by chibineku
    My layout breaks if I change the window size in IE7/AOL, so I added a simple javascript function that fires on window.onresize, but no matter how I change the location I get problems. It was suggested I post a link and here it is: link text I already use PHP to detect browser and include an IE7-only inline stylesheet (and for mobile browsers), and my page looks nearly identical to the way it does in FF, Opera, Chrome, Safari and IE8, but when I change the window size, some things go wonky, and come back into line if you refresh. Any advice is welcome :)

    Read the article

  • The Best Ways to Lock Down Your Multi-User Computer

    - by Lori Kaufman
    Whether you’re sharing a computer with other family members or friends at home, or securing computers in a corporate environment, there may be many reasons why you need to protect the programs, data, and settings on the computers. This article presents multiple ways of locking down a Windows 7 computer, depending on the type of usage being employed by the users. You may need to use a combination of several of the following methods to protect your programs, data, and settings. How to Stress Test the Hard Drives in Your PC or Server How To Customize Your Android Lock Screen with WidgetLocker The Best Free Portable Apps for Your Flash Drive Toolkit

    Read the article

  • Dual boot windows 8 and Ubuntu with Windows 8 Boot manager

    - by Mevin Babu
    I have two partitions on my hard-didk , I have installed ubuntu on my 1st partition and windows 8 later on another partition.Now i can only boot into windows 8 because it doesn't recognize Ubuntu. How would i dual boot my PC without using grub . I would like using Windows 8 boot manager as its pretty neat. I tried using easyBCD but it doesn't work.It causes the boot manager to switch to windows 7 Boot Manager .Is there anyother work around or solution Any help would be appreciated. Note: The windows 8 boot Manager is sky blue color interactive menu with mouse and other options and windows 7 boot manager is the normal black and white one where you can only use your keyboard

    Read the article

  • How do I install only the KDE desktop (and not apps) on Unity?

    - by Gaba_p
    My question is pretty simple. I have Ubuntu 12.04 with Unity and I want to login with KDE. I have seen recommendations to: 1- run the three commands: $ sudo add-apt-repository ppa:kubuntu-ppa/backports $ sudo apt-get update $ sudo apt-get install kubuntu-desktop 2- run just the command: $ sudo apt-get install kubuntu-desktop 3- run the command: $ sudo apt-get install kde-standard 4- run the command: $ sudo apt-get install kde-full 5- run the command: $ sudo apt-get install plasma-desktop 6- run the command: $ sudo apt-get install kde-plasma-desktop 7- etc ... This question is very related to this one, but the answer there is not clear enough to me. There seems to be quite a number of quasi-identical commands one could use to install the KDE desktop. I just want the desktop, no KDE apps since I'll just use the ones I'm already using in Unity. Of course I also want the needed repositories added so the KDE desktop will be kept updated. How would I go about doing that?

    Read the article

  • terminal does not find xmonad.hs

    - by arpho
    Iam using xmonad on ubuntu 13.04, in ~/.xmonad my computer has the file xmonad.hs, if I try to read it from terminal using nano it opens a new file, I can access the file opening it from geany or gedit, but if I try to recompile it, the system does not find that file, so I cannot configure xmonad, every thing I try on this file from console does not work, because terminal even if I am root cannot see it, can you help me solve this issue?

    Read the article

  • How can I stop new Command Prompt windows spawned by another program from covering my foreground win

    - by Chris W. Rea
    Under Windows 7 x64, when I'm ripping CDs with Exact Audio Copy, it spawns a Command Prompt window each time it invokes the external MP3 compression program I use, LAME. While that's going on, I usually like to surf the web. However, I find it quite annoying that even when Firefox has the foreground, the Command Prompt windows spawned by EAC are coming up in the foreground, on top of my Firefox window. Is there a way to make those new Command Prompt windows spawn in the background? Alternatively, is there a way to make the current active window stay in the foreground / on top while I'm using it?

    Read the article

  • Spread windows not working on minimized applications

    - by Jeggy
    When I'm using "SUPER" + "W" to spread all running windows I only see the applications that are not minimized and the others are just nothing as seen on picture below. I have 5 applications running and 3 of them are minimized and this is how it looks: How to fix this? I don't know if this is a bug or if this is normal, but i don't like it this way UPDATE: Just found out that it actually only happens when i use "Super" + "D" to minimize all windows, and then when opening some of them up again it will happen

    Read the article

  • How to Install the MATE Desktop & Go Back to GNOME 2 on Ubuntu

    - by Chris Hoffman
    If you long for the days of GNOME 2 and just can’t get along with Unity or GNOME 3, MATE is here to save you. It’s an actively developed fork of GNOME 2, and it’s easily installable on Ubuntu. MATE isn’t available in Ubuntu’s repositories, but the MATE developers offer an official repository for Ubuntu. Unlike some methods that recommend you use Linux Mint’s repository on Ubuntu, this won’t mess up your system. How to Own Your Own Website (Even If You Can’t Build One) Pt 1 What’s the Difference Between Sleep and Hibernate in Windows? Screenshot Tour: XBMC 11 Eden Rocks Improved iOS Support, AirPlay, and Even a Custom XBMC OS

    Read the article

  • Intermittent temporary GUI freeze in Ubuntu 11.10

    - by Oscar
    I've been using Ubuntu 11.10 for a month or so. In the last week it's started freezing randomly (every few hours or minutes). I can still move the mouse and switch to other terminals with ctrl+alt. I thought this was purely a gui issue as I could continue entering commands (mouse clicks and keys) which seem to be processed once the system resumes (generally 30 seconds to a few minutes). I'm using gnome and metacity. I can't identify anything in particular that triggers the freezes. Saving a file in LibreOffice causes the system to hang. I tried disabling most of the services I've installed (dropbox, autokey, etc.) but doesn't help. Switching to another terminal and running top, the CPU column is shared equally among all of my processes (i.e. non-root). I have no idea what that signifies. My PC is unusable in this state. CPU model name : Pentium(R) Dual-Core CPU E6700 @ 3.20GHz [7m PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND [0;10m[39;49m[K [0;10m[0;10m 1499 ogga 20 0 404m 32m 13m R 10 0.8 0:28.19 python [0;10m[39;49m [0;10m[0;10m 1501 ogga 20 0 216m 13m 6224 R 10 0.3 0:18.28 ibus-x11 [0;10m[39;49m [0;10m[0;10m 1679 ogga 20 0 449m 34m 15m R 10 0.9 0:41.10 gnome-panel [0;10m[39;49m [0;10m[0;10m 1710 ogga 20 0 350m 15m 8324 R 10 0.4 0:18.25 bluetooth-apple [0;10m[39;49m [0;10m[0;10m 1752 ogga 20 0 458m 37m 13m R 10 0.9 0:22.62 autokey-gtk [0;10m[39;49m [0;10m[0;10m 2081 ogga 20 0 354m 17m 9800 R 10 0.5 0:16.36 update-notifier [0;10m[39;49m [0;10m[0;10m 5439 ogga 20 0 640m 104m 38m R 10 2.6 0:45.17 chromium-browse [0;10m[39;49m [0;10m[0;10m 5586 ogga 20 0 381m 42m 21m R 10 1.1 0:20.17 chromium-browse [0;10m[39;49m [0;10m[0;10m 6422 ogga 20 0 529m 59m 18m R 10 1.5 0:28.15 sublime_text [0;10m[39;49m [0;10m[0;10m 1362 ogga 20 0 264m 14m 7884 R 8 0.4 0:18.29 gnome-session [0;10m[39;49m [0;10m[0;10m 1673 ogga 20 0 351m 17m 9768 R 8 0.4 0:21.78 metacity [0;10m[39;49m [0;10m[0;10m 1708 ogga 20 0 249m 13m 7156 R 8 0.3 0:18.23 gnome-fallback- [0;10m[39;49m [0;10m[0;10m 1709 ogga 20 0 572m 28m 15m R 8 0.7 0:18.37 nautilus [0;10m[39;49m [0;10m[0;10m 1722 ogga 20 0 467m 18m 9m R 8 0.5 0:18.43 nm-applet [0;10m[39;49m [0;10m[0;10m 1727 ogga 20 0 225m 12m 6304 R 8 0.3 0:18.24 polkit-gnome-au [0;10m[39;49m [0;10m[0;10m 1731 ogga 20 0 422m 19m 10m R 8 0.5 0:26.62 gnome-sound-app [0;10m[39;49m [0;10m[0;10m 1735 ogga 20 0 306m 31m 13m R 8 0.8 0:18.37 python [0;10m[39;49m [0;10m[0;10m 1754 ogga 20 0 286m 16m 8912 R 8 0.4 0:18.90 vino-server [0;10m[39;49m [0;10m[0;10m 1798 ogga 20 0 246m 15m 7476 R 8 0.4 0:18.25 gnome-screensav [0;10m[39;49m [0;10m[0;10m 1851 ogga 20 0 185m 14m 7256 R 8 0.4 0:18.18 gdu-notificatio [0;10m[39;49m [0;10m[0;10m 1923 ogga 20 0 251m 28m 11m R 8 0.7 0:17.96 applet.py [0;10m[39;49m [0;10m[0;10m 4085 ogga 20 0 378m 22m 11m R 8 0.6 0:18.19 gnome-terminal [0;10m[39;49m [0;10m 4213 ogga 20 0 263m 73m 15m S 2 1.9 3:57.44 skype [0;10m[39;49m [0;10m 1 root 20 0 24188 1492 1320 S 0 0.0 0:00.45 init [0;10m[39;49m [0;10m 2 root 20 0 0 0 0 S 0 0.0 0:00.00 kthreadd [0;10m[39;49m [0;10m 3 root 20 0 0 0 0 S 0 0.0 0:02.27 ksoftirqd/0 [0;10m[39;49m [0;10m 6 root RT 0 0 0 0 S 0 0.0 0:00.00 migration/0 [0;10m[39;49m [0;10m 7 root RT 0 0 0 0 S 0 0.0 0:00.00 migration/1 [0;10m[39;49m [0;10m 9 root 20 0 0 0 0 S 0 0.0 0:01.97 ksoftirqd/1 [0;10m[39;49m [0;10m 10 root 20 0 0 0 0 S 0 0.0 0:01.16 kworker/0:1 [0;10m[39;49m [0;10m 11 root 0 -20 0 0 0 S 0 0.0 0:00.00 cpuset [0;10m[39;49m [0;10m 12 root 0 -20 0 0 0 S 0 0.0 0:00.00 khelper [0;10m[39;49m [0;10m 13 root 0 -20 0 0 0 S 0 0.0 0:00.00 netns [0;10m[39;49m [0;10m 15 root 20 0 0 0 0 S 0 0.0 0:00.00 sync_supers [0;10m[39;49m [0;10m 16 root 20 0 0 0 0 S 0 0.0 0:00.00 bdi-default [0;10m[39;49m [0;10m 17 root 0 -20 0 0 0 S 0 0.0 0:00.00 kintegrityd [0;10m[39;49m [0;10m 18 root 0 -20 0 0 0 S 0 0.0 0:00.00 kblockd [0;10m[39;49m [0;10m 19 root 0 -20 0 0 0 S 0 0.0 0:00.00 ata_sff [0;10m[39;49m [0;10m 20 root 20 0 0 0 0 S 0 0.0 0:00.00 khubd [0;10m[39;49m [0;10m 21 root 0 -20 0 0 0 S 0 0.0 0:00.00 md [0;10m[39;49m [0;10m 23 root 20 0 0 0 0 S 0 0.0 0:00.00 khungtaskd [0;10m[39;49m [0;10m 24 root 20 0 0 0 0 S 0 0.0 0:00.14 kswapd0 [0;10m[39;49m [0;10m 25 root 25 5 0 0 0 S 0 0.0 0:00.00 ksmd [0;10m[39;49m [0;10m 26 root 39 19 0 0 0 S 0 0.0 0:00.00 khugepaged [0;10m[39;49m [0;10m 27 root 20 0 0 0 0 S 0 0.0 0:00.00 fsnotify_mark [0;10m[39;49m [0;10m 28 root 20 0 0 0 0 S 0 0.0 0:00.00 ecryptfs-kthrea [0;10m[39;49m [0;10m 29 root 0 -20 0 0 0 S 0 0.0 0:00.00 crypto [0;10m[39;49m [0;10m 37 root 0 -20 0 0 0 S 0 0.0 0:00.00 kthrotld [0;10m[39;49m [0;10m 38 root 20 0 0 0 0 S 0 0.0 0:00.00 scsi_eh_0 [0;10m[39;49m [0;10m 39 root 20 0 0 0 0 S 0 0.0 0:00.00 scsi_eh_1 [0;10m[39;49m [0;10m 41 root 20 0 0 0 0 S 0 0.0 0:00.00 scsi_eh_2 [0;10m[39;49m [0;10m 42 root 20 0 0 0 0 S 0 0.0 0:00.00 scsi_eh_3 [0;10m[39;49m [0;10m 64 root 20 0 0 0 0 S 0 0.0 0:02.98 kworker/0:2 [0;10m[39;49m [0;10m 242 root 20 0 0 0 0 S 0 0.0 0:00.39 jbd2/sdb1-8 [0;10m[39;49m [0;10m 243 root 0 -20 0 0 0 S 0 0.0 0:00.00 ext4-dio-unwrit [0;10m[39;49m [0;10m 288 root 20 0 17236 448 448 S 0 0.0 0:00.04 upstart-udev-br [0;10m[39;49m [0;10m 295 root 20 0 21752 884 796 S 0 0.0 0:00.06 udevd And at another time: [7m PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND [0;10m[39;49m[K [0;10m[0;10m 1757 ogga 20 0 222m 9932 6300 R 13 0.2 0:05.69 polkit-gnome-au [0;10m[39;49m [0;10m[0;10m 1559 ogga 20 0 152m 9764 6112 R 13 0.2 0:05.77 ibus-x11 [0;10m[39;49m [0;10m[0;10m 1786 ogga 20 0 457m 33m 13m R 13 0.9 0:06.10 autokey-gtk [0;10m[39;49m [0;10m[0;10m 1395 ogga 20 0 262m 12m 7880 R 12 0.3 0:05.88 gnome-session [0;10m[39;49m [0;10m[0;10m 1557 ogga 20 0 403m 31m 13m R 12 0.8 0:14.95 python [0;10m[39;49m [0;10m[0;10m 1745 ogga 20 0 247m 11m 7196 R 12 0.3 0:05.69 gnome-fallback- [0;10m[39;49m [0;10m[0;10m 1767 ogga 20 0 237m 26m 11m R 12 0.7 0:05.87 python [0;10m[39;49m [0;10m[0;10m 1713 ogga 20 0 440m 25m 13m R 12 0.6 0:13.76 gnome-panel [0;10m[39;49m [0;10m[0;10m 1747 ogga 20 0 348m 13m 8328 R 11 0.3 0:05.22 bluetooth-apple [0;10m[39;49m [0;10m[0;10m 1754 ogga 20 0 465m 16m 10m R 11 0.4 0:05.21 nm-applet [0;10m[39;49m [0;10m[0;10m 1710 ogga 20 0 167m 11m 7564 R 11 0.3 0:05.21 metacity [0;10m[39;49m [0;10m[0;10m 1761 ogga 20 0 406m 17m 9928 R 11 0.4 0:12.71 gnome-sound-app [0;10m[39;49m [0;10m[0;10m 1789 ogga 20 0 283m 13m 8852 R 11 0.3 0:05.55 vino-server [0;10m[39;49m [0;10m[0;10m 1815 ogga 20 0 243m 11m 7452 R 11 0.3 0:05.17 gnome-screensav [0;10m[39;49m [0;10m[0;10m 1885 ogga 20 0 182m 11m 7256 R 11 0.3 0:05.18 gdu-notificatio [0;10m[39;49m [0;10m[0;10m 1957 ogga 20 0 249m 25m 11m R 11 0.7 0:05.32 applet.py [0;10m[39;49m [0;10m[0;10m 2067 ogga 20 0 260m 12m 7828 R 11 0.3 0:05.21 update-notifier [0;10m[39;49m [0;10m 1975 ogga 20 0 292m 48m 11m S 0 1.2 0:08.28 ubuntuone-syncd [0;10m[39;49m [0;10m[0;10m 2363 ogga 20 0 21468 1384 988 R 0 0.0 0:00.01 top [0;10m[39;49m [0;10m 1 root 20 0 24284 2296 1320 S 0 0.1 0:00.46 init [0;10m[39;49m [0;10m 2 root 20 0 0 0 0 S 0 0.0 0:00.00 kthreadd [0;10m[39;49m [0;10m 3 root 20 0 0 0 0 S 0 0.0 0:00.05 ksoftirqd/0 [0;10m[39;49m [0;10m 4 root 20 0 0 0 0 S 0 0.0 0:00.00 kworker/0:0 [0;10m[39;49m [0;10m 5 root 20 0 0 0 0 S 0 0.0 0:00.19 kworker/u:0 [0;10m[39;49m [0;10m 6 root RT 0 0 0 0 S 0 0.0 0:00.00 migration/0 [0;10m[39;49m [0;10m 7 root RT 0 0 0 0 S 0 0.0 0:00.00 migration/1 [0;10m[39;49m [0;10m 8 root 20 0 0 0 0 S 0 0.0 0:00.00 kworker/1:0 [0;10m[39;49m [0;10m 9 root 20 0 0 0 0 S 0 0.0 0:00.06 ksoftirqd/1 [0;10m[39;49m [0;10m 10 root 20 0 0 0 0 S 0 0.0 0:00.09 kworker/0:1 [0;10m[39;49m [0;10m 11 root 0 -20 0 0 0 S 0 0.0 0:00.00 cpuset [0;10m[39;49m [0;10m 12 root 0 -20 0 0 0 S 0 0.0 0:00.00 khelper [0;10m[39;49m [0;10m 13 root 0 -20 0 0 0 S 0 0.0 0:00.00 netns [0;10m[39;49m [0;10m 14 root 20 0 0 0 0 S 0 0.0 0:00.25 kworker/u:1 [0;10m[39;49m [0;10m 15 root 20 0 0 0 0 S 0 0.0 0:00.00 sync_supers [0;10m[39;49m [0;10m 16 root 20 0 0 0 0 S 0 0.0 0:00.00 bdi-default [0;10m[39;49m [0;10m 17 root 0 -20 0 0 0 S 0 0.0 0:00.00 kintegrityd [0;10m[39;49m [0;10m 18 root 0 -20 0 0 0 S 0 0.0 0:00.00 kblockd [0;10m[39;49m [0;10m 19 root 0 -20 0 0 0 S 0 0.0 0:00.00 ata_sff [0;10m[39;49m [0;10m 20 root 20 0 0 0 0 S 0 0.0 0:00.00 khubd [0;10m[39;49m [0;10m 21 root 0 -20 0 0 0 S 0 0.0 0:00.00 md [0;10m[39;49m [0;10m 22 root 20 0 0 0 0 S 0 0.0 0:00.22 kworker/1:1 [0;10m[39;49m [0;10m 23 root 20 0 0 0 0 S 0 0.0 0:00.00 khungtaskd [0;10m[39;49m [0;10m 24 root 20 0 0 0 0 S 0 0.0 0:00.00 kswapd0 [0;10m[39;49m [0;10m 25 root 25 5 0 0 0 S 0 0.0 0:00.00 ksmd [0;10m[39;49m [0;10m 26 root 39 19 0 0 0 S 0 0.0 0:00.00 khugepaged [0;10m[39;49m [0;10m 27 root 20 0 0 0 0 S 0 0.0 0:00.00 fsnotify_mark [0;10m[39;49m [0;10m 28 root 20 0 0 0 0 S 0 0.0 0:00.00 ecryptfs-kthrea [0;10m[39;49m [0;10m 29 root 0 -20 0 0 0 S 0 0.0 0:00.00 crypto [0;10m[39;49m [0;10m 37 root 0 -20 0 0 0 S 0 0.0 0:00.00 kthrotld [0;10m[39;49m [0;10m 38 root 20 0 0 0 0 S 0 0.0 0:00.00 scsi_eh_0 [0;10m[39;49m [0;10m 39 root 20 0 0 0 0 S 0 0.0 0:00.00 scsi_eh_1 [0;10m[39;49m [0;10m 40 root 20 0 0 0 0 S 0 0.0 0:00.00 kworker/u:2 [0;10m[39;49m [0;10m 41 root 20 0 0 0 0 S 0 0.0 0:00.00 scsi_eh_2 [0;10m[39;49m [0;10m 42 root 20 0 0 0 0 S 0 0.0 0:00.00 scsi_eh_3 [0;10m[39;49m [0;10m 43 root 20 0 0 0 0 S 0 0.0 0:00.00 kworker/u:3 [0;10m[39;49m [0;10m 44 root 20 0 0 0 0 S 0 0.0 0:00.00 kworker/u:4 [0;10m[39;49m [0;10m 45 root 20 0 0 0 0 S 0 0.0 0:00.00 kworker/u:5 [0;10m[39;49m[6;1H[K Sorry about the horrible formatting. Thanks for any suggestions... Edit: I notice that my virtual computer (win7 64 on virtualbox) continues to respond most of the time during these 'freezes' Edit2: I suspect this is something to do with UI priority being too low... but I don't know enough about linux to know how to address that.

    Read the article

  • Installed nvidia driver, activated it, and now Unity is gone. No bars, menus, nothing

    - by Noel
    I installed the nvidia driver (installed the ubuntu-x-swat ones, updated them, got the updates for them, installed bumblebee. I restarted everytime I did those steps, so no, i don't simply need to 'restart X'. I tried to run things using bumblebee, but bumblebee was like "can't access GPU driver". So I ran nvidia-settings, it said the drivers weren't in use, so I ran "sudo nvidia-xconfig", then restarted. Now, my login screen looks differently than it did before: it asks me if I want to load: "GNOME, GNOME - no effects, Cairo Dock - GNOME, System Default, or Ubuntu" when I log in, but WORST OF ALL: i no longer have any kind of GNOME/unity GUI. There are no title bars above any windows, no close/minimize/maximize buttons. The unity bar is gone, and will not show up when I call it. And the top status bar is also no longer there.

    Read the article

< Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >