Search Results

Search found 7034 results on 282 pages for 'inverse match'.

Page 49/282 | < Previous Page | 45 46 47 48 49 50 51 52 53 54 55 56  | Next Page >

  • Matching users based on a series of questions

    - by SeanWM
    I'm trying to figure out a way to match users based on specific personality traits. Each trait will have its own category. I figure in my user table I'll add a column for each category: id name cat1 cat2 cat3 1 Sean ? ? ? 2 Other ? ? ? Let's say I ask each user 3 questions in each category. For each question, you can answer one of the following: No, Maybe, Yes How would I calculate one number based off the answers in those 3 questions that would hold a value I can compare other users to? I was thinking having some sort of weight. Like: No -> 0 Maybe -> 1 Yes -> 2 Then doing some sort of meaningful calculation. I want to end up with something like this so I can query the users and find who matches close: id name cat1 cat2 cat3 1 Sean 4 5 1 2 Other 1 2 5 In the situation above, the users don't really match. I'd want to match with someone with a +1 or -1 of my score in each category. I'm not a math guy so I'm just looking for some ideas to get me started.

    Read the article

  • Shadow mapping with deffered shading for directional lights - shadow map projection problem

    - by Harry
    I'm trying to implement shadow mapping to my engine. I started with directional lights because they seemed to be the easiest one, but I was wrong :) I have implemented deferred shading and I retrieve position from depth. I think that there is the biggest problem but code looks ok for me. Now more about problem: Shadow map projected onto meshes looks bad scaled and translated and also some informations from shadow map texture aren't visible. You can see it on this screen: http://img5.imageshack.us/img5/2254/93dn.png Yelow frustum is light frustum and I have mixed shadow map preview and actual scene. As you can see shadows are in wrong place and shadow of cone and sphere aren't visible. Could you look at my codes and tell me where I have a mistake? // create shadow map if(!_shd)glGenTextures(1, &_shd); glBindTexture(GL_TEXTURE_2D, _shd); glTexImage2D(GL_TEXTURE_2D, 0, GL_DEPTH_COMPONENT, 1024, 1024, 0, GL_DEPTH_COMPONENT, GL_FLOAT,NULL); // shadow map size glTexParameterf(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_NEAREST); glTexParameterf(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_NEAREST); glTexParameterf(GL_TEXTURE_2D, GL_TEXTURE_WRAP_S, GL_CLAMP_TO_EDGE); glTexParameterf(GL_TEXTURE_2D, GL_TEXTURE_WRAP_T, GL_CLAMP_TO_EDGE); glFramebufferTexture2D(GL_DRAW_FRAMEBUFFER, GL_DEPTH_ATTACHMENT, GL_TEXTURE_2D, _shd, 0); glDrawBuffer(GL_NONE); // setting camera Vector dire=Vector(0,0,1); ACamera.setLookAt(dire,Vector(0)); ACamera.setPerspectiveView(60.0f,1,0.1f,10.0f); // currently needed for proper frustum corners calculation Vector min(ACamera._point[0]),max(ACamera._point[0]); for(int i=0;i<8;i++){ max=Max(max,ACamera._point[i]); min=Min(min,ACamera._point[i]); } ACamera.setOrthogonalView(min.x,max.x,min.y,max.y,-max.z,-min.z); glBindFramebuffer(GL_DRAW_FRAMEBUFFER, _s_buffer); // framebuffer for shadow map // rendering to depth buffer glBindFramebuffer(GL_DRAW_FRAMEBUFFER, _g_buffer); Shaders["DirLight"].set(true); Matrix4 bias; bias.x.set(0.5,0.0,0.0,0.0); bias.y.set(0.0,0.5,0.0,0.0); bias.z.set(0.0,0.0,0.5,0.0); bias.w.set(0.5,0.5,0.5,1.0); Shaders["DirLight"].set("textureMatrix",ACamera.matrix*Projection3D*bias); // order of multiplications are 100% correct, everything gives mi the same result as using glm glActiveTexture(GL_TEXTURE5); glBindTexture(GL_TEXTURE_2D,_shd); lightDir(dir); // light calculations Vertex Shader makes nothing related to shadow calculatons Pixel shader function which calculates if pixel is in shadow or not: float readShadowMap(vec3 eyeDir) { // retrieve depth of pixel float z = texture2D(depth, gl_FragCoord.xy/screen).z; vec3 pos = vec3(gl_FragCoord.xy/screen, z); // transform by the projection and view inverse vec4 worldSpace = inverse(View)*inverse(ProjectionMatrix)*vec4(pos*2-1,1); worldSpace /= worldSpace.w; vec4 coord=textureMatrix*worldSpace; float vis=1.0f; if(texture2D(shadow, coord.xy).z < coord.z-0.001)vis=0.2f; return vis; } I also have question about shadows specifically for directional light. Currently I always look at 0,0,0 position and in further implementation I have to move light frustum along to camera frustum. I've found how to do this here: http://www.gamedev.net/topic/505893-orthographic-projection-for-shadow-mapping/ but it doesn't give me what I want. Maybe because of problems mentioned above, but I want know your opinion. EDIT: vec4 worldSpace is position read from depht of the scene (not shadow map). Maybe I wasn't precise so I'll try quick explain what is what: View is camera view matrix, ProjectionMatrix is camera projection,. First I try to get world space position from depth map and then multiply it by textureMatrix which is light view *light projection*bias. Rest of code is the same as in many tutorials. I can't use vertex shader to make something like gl_Position=textureMatrix*gl_Vertex and get it interpolated in fragment shader because of deffered rendering use so I want get it from depht buffer. EDIT2: I also tried make it as in Coding Labs tutorial about Shadow Mapping with Deferred Rendering but unfortunately this either works wrong.

    Read the article

  • PCRE multi line matche problem

    - by Simone Margaritelli
    Hi guys, i have this C++ program (actually it's just a snippet) : #include <iostream> #include <pcre.h> #include <string> using namespace std; int main(){ string pattern = "<a\\s+href\\s*=\\s*\"([^\"]+)\"", html = "<html>\n" "<body>\n" "<a href=\"example_link_1\"/>\n" "<a href=\"example_link_2\"/>\n" "<a href=\"example_link_3\"/>\n" "</body>\n" "</html>"; int i, ccount, rc, *offsets, eoffset; const char *error; pcre *compiled; compiled = pcre_compile( pattern.c_str(), PCRE_CASELESS | PCRE_MULTILINE, &error, &eoffset, 0 ); if( !compiled ){ cerr << "Error compiling the regexp!!" << endl; return 0; } rc = pcre_fullinfo( compiled, 0, PCRE_INFO_CAPTURECOUNT, &ccount ); offsets = new int[ 3 * (ccount + 1) ]; rc = pcre_exec( compiled, 0, html.c_str(), html.length(), 0, 0, offsets, 3 * (ccount + 1) ); if( rc >= 0 ){ for( i = 1; i < rc; ++i ){ cout << "Match : " << html.substr( offsets[2*i], offsets[2*i+1] - offsets[2*i] ) << endl; } } else{ cout << "Sorry, no matches!" << endl; } delete [] offsets; return 0; } As you can see, i'm trying to match html links inside a buffer with the given regular expression (the \\s is \s escaped for C/C++ strings). But, even if in the buffer there are 3 links and the regexp is compiled with the PCRE_CASELESS and PCRE_MULTILINE flags, i match only one element : Match : example_link_1 Note: I start the loop fro index 1 because the pcre library returns the string that matched (not the match itself) as the first element, and the matches follows. What's wrong with this code? The regexp itself i think it's correct (tried in PHP for instance).

    Read the article

  • JavaScript: How to get text from all descendents of an element, disregarding scripts?

    - by Bungle
    My current project involves gathering text content from an element and all of its descendents, based on a provided selector. For example, when supplied the selector #content and run against this HTML: <div id="content"> <p>This is some text.</p> <script type="text/javascript"> var test = true; </script> <p>This is some more text.</p> </div> my script would return (after a little whitespace cleanup): This is some text. var test = true; This is some more text. However, I need to disregard text nodes that occur within <script> elements. This is an excerpt of my current code: // get text content of all matching elements for (x = 0; x < selectors.length; x++) { matches = Sizzle(selectors[x], document); for (y = 0; y < matches.length; y++) { match = matches[y]; if (match.innerText) { // IE content += match.innerText + ' '; } else if (match.textContent) { // other browsers content += match.textContent + ' '; } } } It's a bit overly simplistic in that it just returns all text nodes within the element (and its descendants) that matches the provided selector. The solution I'm looking for would return all text nodes except for those that fall within script elements. It doesn't need to be especially high-performance, but I do need it to ultimately be cross-browser compatible. I'm assuming that I'll need to somehow loop through all children of the element that matches the selector and accumulate all text nodes other than ones within <script> elements; it doesn't look like there's any way to identify JavaScript once it's already rolled into the string accumulated from all of the text nodes. I can't use jQuery (for performance/bandwidth reasons), although you may have noticed that I do use its Sizzle selector engine, so jQuery's selector logic is available. Thanks in advance for any help!

    Read the article

  • Combinations and Permutations in F#

    - by Noldorin
    I've recently written the following combinations and permutations functions for an F# project, but I'm quite aware they're far from optimised. /// Rotates a list by one place forward. let rotate lst = List.tail lst @ [List.head lst] /// Gets all rotations of a list. let getRotations lst = let rec getAll lst i = if i = 0 then [] else lst :: (getAll (rotate lst) (i - 1)) getAll lst (List.length lst) /// Gets all permutations (without repetition) of specified length from a list. let rec getPerms n lst = match n, lst with | 0, _ -> seq [[]] | _, [] -> seq [] | k, _ -> lst |> getRotations |> Seq.collect (fun r -> Seq.map ((@) [List.head r]) (getPerms (k - 1) (List.tail r))) /// Gets all permutations (with repetition) of specified length from a list. let rec getPermsWithRep n lst = match n, lst with | 0, _ -> seq [[]] | _, [] -> seq [] | k, _ -> lst |> Seq.collect (fun x -> Seq.map ((@) [x]) (getPermsWithRep (k - 1) lst)) // equivalent: | k, _ -> lst |> getRotations |> Seq.collect (fun r -> List.map ((@) [List.head r]) (getPermsWithRep (k - 1) r)) /// Gets all combinations (without repetition) of specified length from a list. let rec getCombs n lst = match n, lst with | 0, _ -> seq [[]] | _, [] -> seq [] | k, (x :: xs) -> Seq.append (Seq.map ((@) [x]) (getCombs (k - 1) xs)) (getCombs k xs) /// Gets all combinations (with repetition) of specified length from a list. let rec getCombsWithRep n lst = match n, lst with | 0, _ -> seq [[]] | _, [] -> seq [] | k, (x :: xs) -> Seq.append (Seq.map ((@) [x]) (getCombsWithRep (k - 1) lst)) (getCombsWithRep k xs) Does anyone have any suggestions for how these functions (algorithms) can be sped up? I'm particularly interested in how the permutation (with and without repetition) ones can be improved. The business involving rotations of lists doesn't look too efficient to me in retrospect. Update Here's my new implementation for the getPerms function, inspired by Tomas's answer. Unfortunately, it's not really any fast than the existing one. Suggestions? let getPerms n lst = let rec getPermsImpl acc n lst = seq { match n, lst with | k, x :: xs -> if k > 0 then for r in getRotations lst do yield! getPermsImpl (List.head r :: acc) (k - 1) (List.tail r) if k >= 0 then yield! getPermsImpl acc k [] | 0, [] -> yield acc | _, [] -> () } getPermsImpl List.empty n lst

    Read the article

  • What Regex can strip e.g. "note:" and "firstName: " from the left of a string?

    - by Edward Tanguay
    I need to strip the "label" off the front of strings, e.g. note: this is a note needs to return: note and this is a note I've produced the following code example but am having trouble with the regexes. What code do I need in the two ???????? areas below so that I get the desired results shown in the comments? using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Text.RegularExpressions; namespace TestRegex8822 { class Program { static void Main(string[] args) { List<string> lines = new List<string>(); lines.Add("note: this is a note"); lines.Add("test: just a test"); lines.Add("test:\t\t\tjust a test"); lines.Add("firstName: Jim"); //"firstName" IS a label because it does NOT contain a space lines.Add("She said this to him: follow me."); //this is NOT a label since there is a space before the colon lines.Add("description: this is the first description"); lines.Add("description:this is the second description"); //no space after colon lines.Add("this is a line with no label"); foreach (var line in lines) { Console.WriteLine(StringHelpers.GetLabelFromLine(line)); Console.WriteLine(StringHelpers.StripLabelFromLine(line)); Console.WriteLine("--"); //note //this is a note //-- //test //just a test //-- //test //just a test //-- //firstName //Jim //-- // //She said this to him: follow me. //-- //description //this is the first description //-- //description //this is the first description //-- // //this is a line with no label //-- } Console.ReadLine(); } } public static class StringHelpers { public static string GetLabelFromLine(this string line) { string label = line.GetMatch(@"^?:(\s)"); //??????????????? if (!label.IsNullOrEmpty()) return label; else return ""; } public static string StripLabelFromLine(this string line) { return ...//??????????????? } public static bool IsNullOrEmpty(this string line) { return String.IsNullOrEmpty(line); } } public static class RegexHelpers { public static string GetMatch(this string text, string regex) { Match match = Regex.Match(text, regex); if (match.Success) { string theMatch = match.Groups[0].Value; return theMatch; } else { return null; } } } }

    Read the article

  • ASP.NET JavaScript Routing for ASP.NET MVC–Constraints

    - by zowens
    If you haven’t had a look at my previous post about ASP.NET routing, go ahead and check it out before you read this post: http://weblogs.asp.net/zowens/archive/2010/12/20/asp-net-mvc-javascript-routing.aspx And the code is here: https://github.com/zowens/ASP.NET-MVC-JavaScript-Routing   Anyways, this post is about routing constraints. A routing constraint is essentially a way for the routing engine to filter out route patterns based on the day from the URL. For example, if I have a route where all the parameters are required, I could use a constraint on the required parameters to say that the parameter is non-empty. Here’s what the constraint would look like: Notice that this is a class that inherits from IRouteConstraint, which is an interface provided by System.Web.Routing. The match method returns true if the value is a match (and can be further processed by the routing rules) or false if it does not match (and the route will be matched further along the route collection). Because routing constraints are so essential to the route matching process, it was important that they be part of my JavaScript routing engine. But the problem is that we need to somehow represent the constraint in JavaScript. I made a design decision early on that you MUST put this constraint into JavaScript to match a route. I didn’t want to have server interaction for the URL generation, like I’ve seen in so many applications. While this is easy to maintain, it causes maintenance issues in my opinion. So the way constraints work in JavaScript is that the constraint as an object type definition is set on the route manager. When a route is created, a new instance of the constraint is created with the specific parameter. In its current form the constraint function MUST return a function that takes the route data and will return true or false. You will see the NotEmpty constraint in a bit. Another piece to the puzzle is that you can have the JavaScript exist as a string in your application that is pulled in when the routing JavaScript code is generated. There is a simple interface, IJavaScriptAddition, that I have added that will be used to output custom JavaScript. Let’s put it all together. Here is the NotEmpty constraint. There’s a few things at work here. The constraint is called “notEmpty” in JavaScript. When you add the constraint to a parameter in your C# code, the route manager generator will look for the JsConstraint attribute to look for the name of the constraint type name and fallback to the class name. For example, if I didn’t apply the “JsConstraint” attribute, the constraint would be called “NotEmpty”. The JavaScript code essentially adds a function to the “constraintTypeDefs” object on the “notEmpty” property (this is how constraints are added to routes). The function returns another function that will be invoked with routing data. Here’s how you would use the NotEmpty constraint in C# and it will work with the JavaScript routing generator. The only catch to using route constraints currently is that the following is not supported: The constraint will work in C# but is not supported by my JavaScript routing engine. (I take pull requests so if you’d like this… go ahead and implement it).   I just wanted to take this post to explain a little bit about the background on constraints. I am looking at expanding the current functionality, but for now this is a good start. Thanks for all the support with the JavaScript router. Keep the feedback coming!

    Read the article

  • Smart Help with UPK

    - by [email protected]
    A short lesson on how awesome Smart Help is. In Oracle UPK speak, there are targeted and non-targeted applications. Targeted applications are Oracle EBS, PeopleSoft, Siebel, JD Edwards, SAP and a few others. Non-targeted applications are either custom built or other third party off the shelf applications. For most targeted applications you'll see better object recognition (during recording) and also Help Integration for that application. Help integration means that someone technical modifies the help link in your application to call up the UPK content that has been created. If you have seen this presented before, this is usually where the term context sensitive help is mentioned and the Do It mode shows off. The fact that UPK builds context sensitive help for its targeted applications automatically is awesome enough, but there is a whole new world out there and it's called "custom and\or third party apps." For the purposes of Smart Help and this discussion, I'm talking about the browser based applications. How does UPK support these apps? It used to be that you had to have your vendor try to modify the Help link to point to UPK or if your company had control over the applications configuration menus, then you get someone on your team to modify this for you. But as you start to use UPK for more than one, two or three applications, the administration of this starts to become daunting. Multiple administrators, multiple player packages, multiple call points, multiple break points, help doesn't always work the same way for every application (picture the black white infomercial with an IT person trying to configure a bunch of wires or something funny like that). Introducing Smart Help! (in color of course, new IT person, probably wearing a blue shirt and smiling). Smart help eliminates the need to configure multiple browser help integration points, and adds a icon to the users browser itself. You're using your browser to read this now correct? Look up at the icons on your browser, you have the home link icon, print icon, maybe an RSS feed icon. Smart Help is icon that gets added to the users browser just like the others. When you click it, it first recognizes which application you're in and then finds the UPK created material for you and returns the best possible match, for (hold on to your seat now) both targeted and non-targeted applications (browser based applications). But wait, there's more. It does this automatically! You don't have to do anything! All you have to do is record content, UPK and Smart Help do the rest! This technology is not new. There are customers out there today that use this for as many as six applications! The real hero here is SMART MATCH. Smart match is the technology that's used to determine which application you're in and where you are when you click on Smart Help. We'll save that for a one-on-one conversation. Like most other awesome features of UPK, it ships with the product. All you have to do is turn it on. To learn more about Smart Help, Smart Match, Targeted and Non-Targeted applications, contact your UPK Sales Consultant or me directly at [email protected]

    Read the article

  • Routes for IIS Classic and Integrated Mode

    - by imran_ku07
         Introduction:             ASP.NET MVC Routing feature makes it very easy to provide clean URLs. You just need to configure routes in global.asax file to create an application with clean URLs. In most cases you define routes works in IIS 6, IIS 7 (or IIS 7.5) Classic and Integrated mode. But in some cases your routes may only works in IIS 7 Integrated mode, like in the case of using extension less URLs in IIS 6 without a wildcard extension map. So in this article I will show you how to create different routes which works in IIS 6 and IIS 7 Classic and Integrated mode.       Description:             Let's say that you need to create an application which must work both in Classic and Integrated mode. Also you have no control to setup a wildcard extension map in IIS. So you need to create two routes. One with extension less URL for Integrated mode and one with a URL with an extension for Classic Mode.   routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults );               Now you have set up two routes, one for Integrated mode and one for Classic mode. Now you only need to ensure that Integrated mode route should only match if the application is running in Integrated mode and Classic mode route should only match if the application is running in Classic mode. For making this work you need to create two custom constraint for Integrated and Classic mode. So replace the above routes with these routes,     routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new ClassicModeConstraint() }// Constraints ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new IntegratedModeConstraint() }// Constraints );            The first route which is for Classic mode adds a ClassicModeConstraint and second route which is for Integrated mode adds a IntegratedModeConstraint. Next you need to add the implementation of these constraint classes.     public class ClassicModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return !HttpRuntime.UsingIntegratedPipeline; } } public class IntegratedModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return HttpRuntime.UsingIntegratedPipeline; } }             HttpRuntime.UsingIntegratedPipeline returns true if the application is running on Integrated mode; otherwise, it returns false. So routes for Integrated mode only matched when the application is running on Integrated mode and routes for Classic mode only matched when the application is not running on Integrated mode.       Summary:             During developing applications, sometimes developers are not sure that whether this application will be host on IIS 6 or IIS 7 (or IIS 7.5) Integrated mode or Classic mode. So it's a good idea to create separate routes for both Classic and Integrated mode so that your application will use extension less URLs where possible and use URLs with an extension where it is not possible to use extension less URLs. In this article I showed you how to create separate routes for IIS Integrated and Classic mode. Hope you will enjoy this article too.   SyntaxHighlighter.all()

    Read the article

  • Enhanced Dynamic Filtering

    - by Ricardo Peres
    Remember my last post on dynamic filtering? Well, this time I'm extending the code in order to allow two levels of querying: Match type, represented by the following options: public enum MatchType { StartsWith = 0, Contains = 1 } And word match: public enum WordMatch { AnyWord = 0, AllWords = 1, ExactPhrase = 2 } You can combine the two levels in order to achieve the following combinations: MatchType.StartsWith + WordMatch.AnyWord Matches any record that starts with any of the words specified MatchType.StartsWith + WordMatch.AllWords Not available: does not make sense, throws an exception MatchType.StartsWith + WordMatch.ExactPhrase Matches any record that starts with the exact specified phrase MatchType.Contains + WordMatch.AnyWord Matches any record that contains any of the specified words MatchType.Contains + WordMatch.AllWords Matches any record that contains all of the specified words MatchType.Contains + WordMatch.ExactPhrase Matches any record that contains the exact specified phrase Here is the code: public static IList Search(IQueryable query, Type entityType, String dataTextField, String phrase, MatchType matchType, WordMatch wordMatch, Int32 maxCount) { String [] terms = phrase.Split(' ').Distinct().ToArray(); StringBuilder result = new StringBuilder(); PropertyInfo displayProperty = entityType.GetProperty(dataTextField); IList searchList = null; MethodInfo orderByMethod = typeof(Queryable).GetMethods(BindingFlags.Public | BindingFlags.Static).Where(m = m.Name == "OrderBy").ToArray() [ 0 ].MakeGenericMethod(entityType, displayProperty.PropertyType); MethodInfo takeMethod = typeof(Queryable).GetMethod("Take", BindingFlags.Public | BindingFlags.Static).MakeGenericMethod(entityType); MethodInfo whereMethod = typeof(Queryable).GetMethods(BindingFlags.Public | BindingFlags.Static).Where(m = m.Name == "Where").ToArray() [ 0 ].MakeGenericMethod(entityType); MethodInfo distinctMethod = typeof(Queryable).GetMethods(BindingFlags.Public | BindingFlags.Static).Where(m = m.Name == "Distinct" && m.GetParameters().Length == 1).Single().MakeGenericMethod(entityType); MethodInfo toListMethod = typeof(Enumerable).GetMethod("ToList", BindingFlags.Static | BindingFlags.Public).MakeGenericMethod(entityType); MethodInfo matchMethod = typeof(String).GetMethod ( (matchType == MatchType.StartsWith) ? "StartsWith" : "Contains", new Type [] { typeof(String) } ); MemberExpression member = Expression.MakeMemberAccess ( Expression.Parameter(entityType, "n"), displayProperty ); MethodCallExpression call = null; LambdaExpression where = null; LambdaExpression orderBy = Expression.Lambda ( member, member.Expression as ParameterExpression ); switch (matchType) { case MatchType.StartsWith: switch (wordMatch) { case WordMatch.AnyWord: call = Expression.Call ( member, matchMethod, Expression.Constant(terms [ 0 ]) ); where = Expression.Lambda ( call, member.Expression as ParameterExpression ); for (Int32 i = 1; i ()); where = Expression.Lambda ( Expression.Or ( where.Body, exp ), where.Parameters.ToArray() ); } break; case WordMatch.ExactPhrase: call = Expression.Call ( member, matchMethod, Expression.Constant(phrase) ); where = Expression.Lambda ( call, member.Expression as ParameterExpression ); break; case WordMatch.AllWords: throw (new Exception("The match type StartsWith is not supported with word match AllWords")); } break; case MatchType.Contains: switch (wordMatch) { case WordMatch.AnyWord: call = Expression.Call ( member, matchMethod, Expression.Constant(terms [ 0 ]) ); where = Expression.Lambda ( call, member.Expression as ParameterExpression ); for (Int32 i = 1; i ()); where = Expression.Lambda ( Expression.Or ( where.Body, exp ), where.Parameters.ToArray() ); } break; case WordMatch.ExactPhrase: call = Expression.Call ( member, matchMethod, Expression.Constant(phrase) ); where = Expression.Lambda ( call, member.Expression as ParameterExpression ); break; case WordMatch.AllWords: call = Expression.Call ( member, matchMethod, Expression.Constant(terms [ 0 ]) ); where = Expression.Lambda ( call, member.Expression as ParameterExpression ); for (Int32 i = 1; i ()); where = Expression.Lambda ( Expression.AndAlso ( where.Body, exp ), where.Parameters.ToArray() ); } break; } break; } query = orderByMethod.Invoke(null, new Object [] { query, orderBy }) as IQueryable; query = whereMethod.Invoke(null, new Object [] { query, where }) as IQueryable; if (maxCount != 0) { query = takeMethod.Invoke(null, new Object [] { query, maxCount }) as IQueryable; } searchList = toListMethod.Invoke(null, new Object [] { query }) as IList; return (searchList); } And this is how you'd use it: IQueryable query = ctx.MyEntities; IList list = Search(query, typeof(MyEntity), "Name", "Ricardo Peres", MatchType.Contains, WordMatch.ExactPhrase, 10 /*0 for all*/); SyntaxHighlighter.config.clipboardSwf = 'http://alexgorbatchev.com/pub/sh/2.0.320/scripts/clipboard.swf'; SyntaxHighlighter.brushes.CSharp.aliases = ['c#', 'c-sharp', 'csharp']; SyntaxHighlighter.all();

    Read the article

  • Find Knowledge Quickly

    - by Get Proactive Customer Adoption Team
    Untitled Document Get to relevant knowledge on the Oracle products you use in a few quick steps! Customers tell us that the volume of search results returned can make it difficult to find the information they need, especially when similar Oracle products exist. These simple tips show you how to filter, browse, search, and refine your results to get relevant answers faster. Filter first: PowerView is your best friend Powerview is an often ignored feature of My Oracle Support that enables you to control the information displayed on the Dashboard, the Knowledge tab and regions, and the Service Request tab based on one or more parameters. You can define a PowerView to limit information based on product, product line, support ID, platform, hostname, system name and others. Using PowerView allows you to restrict: Your search results to the filters you have set The product list when selecting your products in Search & Browse and when creating service requests   The PowerView menu is at the top of My Oracle Support, near the title You turn PowerView on by clicking PowerView is Off, which is a button. When PowerView is On, and filters are active, clicking the button again will toggle Powerview off. Click the arrow to the right to create new filters, edit filters, remove a filter, or choose from the list of previously created filters. You can create a PowerView in 3 simple steps! Turn PowerView on and select New from the PowerView menu. Select your filter from the Select Filter Type dropdown list and make selections from the other two menus. Hint: While there are many filter options, selecting your product line or your list of products will provide you with an effective filter. Click the plus sign (+) to add more filters. Click the minus sign (-) to remove a filter. Click Create to save and activated the filter(s) You’ll notice that PowerView is On displays along with the active filters. For more information about the PowerView capabilities, click the Learn more about PowerView… menu item or view a short video. Browse & Refine: Access the Best Match Fast For Your Product and Task In the Knowledge Browse region of the Knowledge or Dashboard tabs, pick your product, pick your task, select a version, if applicable. A best match document – a collection of knowledge articles and resources specific to your selections - may display, offering you a one-stop shop. The best match document, called an “information center,” is an aggregate of dynamically updated links to information pertinent to the product, task, and version (if applicable) you chose. These documents are refreshed every 24 hours to ensure that you have the most current information at your fingertips. Note: Not all products have “information centers.” If no information center appears as a best match, click Search to see a list of search results. From the information center, you can access topics from a product overview to security information, as shown in the left menu. Just want to search? That’s easy too! Again, pick your product, pick your task, select a version, if applicable, enter a keyword term, and click Search. Hint: In this example, you’ll notice that PowerView is on and set to PeopleSoft Enterprise. When PowerView is on and you select a product from the Knowledge Base product list, the listed products are limited to the active PowerView filter. (Products you’ve previously picked are also listed at the top of the dropdown list.) Your search results are displayed based on the parameters you entered. It’s that simple! Related Information: My Oracle Support - User Resource Center [ID 873313.1] My Oracle Support Community For more tips on using My Oracle Support, check out these short video training modules. My Oracle Support Speed Video Training [ID 603505.1]

    Read the article

  • T-SQL (SCD) Slowly Changing Dimension Type 2 using a merge statement

    - by AtulThakor
    Working on stored procedure recently which loads records into a data warehouse I found that the existing record was being expired using an update statement followed by an insert to add the new active record. Playing around with the merge statement you can actually expire the current record and insert a new record within one clean statement. This is how the statement works, we do the normal merge statement to insert a record when there is no match, if we match the record we update the existing record by expiring it and deactivating. At the end of the merge statement we use the output statement to output the staging values for the update,  we wrap the whole merge statement within an insert statement and add new rows for the records which we inserted. I’ve added the full script at the bottom so you can paste it and play around.   1: INSERT INTO ExampleFactUpdate 2: (PolicyID, 3: Status) 4: SELECT -- these columns are returned from the output statement 5: PolicyID, 6: Status 7: FROM 8: ( 9: -- merge statement on unique id in this case Policy_ID 10: MERGE dbo.ExampleFactUpdate dp 11: USING dbo.ExampleStag s 12: ON dp.PolicyID = s.PolicyID 13: WHEN NOT MATCHED THEN -- when we cant match the record we insert a new record record and this is all that happens 14: INSERT (PolicyID,Status) 15: VALUES (s.PolicyID, s.Status) 16: WHEN MATCHED --if it already exists 17: AND ExpiryDate IS NULL -- and the Expiry Date is null 18: THEN 19: UPDATE 20: SET 21: dp.ExpiryDate = getdate(), --we set the expiry on the existing record 22: dp.Active = 0 -- and deactivate the existing record 23: OUTPUT $Action MergeAction, s.PolicyID, s.Status -- the output statement returns a merge action which can 24: ) MergeOutput -- be insert/update/delete, on our example where a record has been updated (or expired in our case 25: WHERE -- we'll filter using a where clause 26: MergeAction = 'Update'; -- here   Complete source for example 1: if OBJECT_ID('ExampleFactUpdate') > 0 2: drop table ExampleFactUpdate 3:  4: Create Table ExampleFactUpdate( 5: ID int identity(1,1), 3: go 6: PolicyID varchar(100), 7: Status varchar(100), 8: EffectiveDate datetime default getdate(), 9: ExpiryDate datetime, 10: Active bit default 1 11: ) 12:  13:  14: insert into ExampleFactUpdate( 15: PolicyID, 16: Status) 17: select 18: 1, 19: 'Live' 20:  21: /*Create Staging Table*/ 22: if OBJECT_ID('ExampleStag') > 0 23: drop table ExampleStag 24: go 25:  26: /*Create example fact table */ 27: Create Table ExampleStag( 28: PolicyID varchar(100), 29: Status varchar(100)) 30:  31: --add some data 32: insert into ExampleStag( 33: PolicyID, 34: Status) 35: select 36: 1, 37: 'Lapsed' 38: union all 39: select 40: 2, 41: 'Quote' 42:  43: select * 44: from ExampleFactUpdate 45:  46: select * 47: from ExampleStag 48:  49:  50: INSERT INTO ExampleFactUpdate 51: (PolicyID, 52: Status) 53: SELECT -- these columns are returned from the output statement 54: PolicyID, 55: Status 56: FROM 57: ( 58: -- merge statement on unique id in this case Policy_ID 59: MERGE dbo.ExampleFactUpdate dp 60: USING dbo.ExampleStag s 61: ON dp.PolicyID = s.PolicyID 62: WHEN NOT MATCHED THEN -- when we cant match the record we insert a new record record and this is all that happens 63: INSERT (PolicyID,Status) 64: VALUES (s.PolicyID, s.Status) 65: WHEN MATCHED --if it already exists 66: AND ExpiryDate IS NULL -- and the Expiry Date is null 67: THEN 68: UPDATE 69: SET 70: dp.ExpiryDate = getdate(), --we set the expiry on the existing record 71: dp.Active = 0 -- and deactivate the existing record 72: OUTPUT $Action MergeAction, s.PolicyID, s.Status -- the output statement returns a merge action which can 73: ) MergeOutput -- be insert/update/delete, on our example where a record has been updated (or expired in our case 74: WHERE -- we'll filter using a where clause 75: MergeAction = 'Update'; -- here 76:  77:  78: select * 79: from ExampleFactUpdate 80: 

    Read the article

  • Getting Audio from a Zone

    - by bleonard
    Now that I have Firefox and Java Web Start running from a zone, the last piece of the puzzle was audio (essential because most Flash content is accompanied by sound).  In the global zone there's a nice little utility called audiotest for testing your sound: bleonard@solaris:~$ audiotest Sound subsystem and version: SunOS Audio 4.0 (0x00040003) Platform: SunOS 5.11 snv_151a i86pc *** Scanning sound adapter #1 *** /dev/sound/audio810:0dsp (audio engine 0): audio810#0 - Performing audio playback test... <left> ................OK <right> ...............OK <stereo> ..............OK <measured sample rate 47727.00 Hz (-0.57%)> *** All tests completed OK *** Of course, before you can try audiotest in a zone, it must be installed: root@myzone:~# pkg install audio-utilities Packages to install: 1 Create boot environment: No DOWNLOAD PKGS FILES XFER (MB) Completed 1/1 6/6 0.4/0.4 PHASE ACTIONS Install Phase 20/20 PHASE ITEMS Package State Update Phase 1/1 Image State Update Phase 2/2 However, we'll need to do more than just install audiotest: root@myzone:~# audiotest /dev/mixer: No such file or directory The device file is missing from /dev. The audio devices also need to be added to the zone. For this we modify the zone configuration as follows: bleonard@solaris:~$ sudo zonecfg -z myzone Password: zonecfg:myzone> add device zonecfg:myzone:device> set match=/dev/audio* zonecfg:myzone:device> end zonecfg:myzone> add device zonecfg:myzone:device> set match=/dev/sound/* zonecfg:myzone:device> end zonecfg:myzone> add device zonecfg:myzone:device> set match=/dev/mixer* zonecfg:myzone:device> end zonecfg:myzone> add device zonecfg:myzone:device> set match=/dev/sndstat zonecfg:myzone:device> end zonecfg:myzone> verify zonecfg:myzone> exit Then reboot the zone: bleonard@solaris:~$ sudo zoneadm -z myzone reboot After which, audiotest should work: root@myzone:~# audiotest Sound subsystem and version: SunOS Audio 4.0 (0x00040003) Platform: SunOS 5.11 snv_151a i86pc *** Scanning sound adapter #1 *** /dev/sound/audio810:0dsp (audio engine 0): audio810#0 - Performing audio playback test... <left> ................OK <right> ...............OK <stereo> ..............OK <measured sample rate 48208.00 Hz (0.43%)> *** All tests completed OK *** You can also examine /dev/sndstat for additional information: root@myzone:~# cat /dev/sndstat SunOS Audio Framework Audio Devices: 0: audio810#0 Intel AC'97, ICH (DUPLEX) Mixers: 0: audio810#0 Intel AC'97, ICH AC'97 codec: SigmaTel STAC9700 However, when testing the sound from Firefox (from a user account other than root), such as this recent Flash presentation on Solaris availability, you may still be disappointed. This is simply a permissions problem, as the devices only have read and write permissions for root: root@myzone:~# ls -l /dev/audio* crw------- 1 root root 99, 3 Jul 1 10:21 /dev/audio crw------- 1 root root 99, 4 Jul 1 10:21 /dev/audioctl To address this: root@myzone:~# chmod 777 /dev/audio* root@myzone:~# chmod 777 /dev/sound/* And you should be all set.

    Read the article

  • ASP.NET Membership ChangePassword control - Need to check for previous password

    - by Steve
    Hi guys, I have a new table that hold old passwords, I need to check if there is a match. If there is a match I need the ChangePassword contol to NOT change the password. I need to tell the user that this password was used and pic a new one. I can't seem to be able to interrupt the control from changing the password. Maybe I am using the wrong event. Here is a piece of my code, or how I wish it would work. I appreciate all your help. protected void ChangePassword1_ChangedPassword(object sender, EventArgs e) { MembershipUser user = Membership.GetUser(); string usrName = ""; if (user != null) { string connStr = ConfigurationManager.ConnectionStrings["LocalSqlServer"].ConnectionString; SqlConnection mySqlConnection = new SqlConnection(connStr); SqlCommand mySqlCommand = mySqlConnection.CreateCommand(); mySqlCommand.CommandText = "Select UserName from OldPasswords where UserName = 'test'"; mySqlConnection.Open(); SqlDataReader mySqlDataReader = mySqlCommand.ExecuteReader(CommandBehavior.Default); while (mySqlDataReader.Read()) { usrName = mySqlDataReader["UserName"].ToString(); if (usrName == user.ToString()) { Label1.Text = "Match"; } else { Label1.Text = "NO Match!"; } }

    Read the article

  • Convert Javascript Regular Expression to PHP (PCRE) Expression

    - by Matt
    Hi all, I am up to my neck in regular expressions, and I have this regular expression that works in javascript (and flash) that I just can't get working in PHP Here it is: var number = '(?:-?\\b(?:0|[1-9][0-9]*)(?:\\.[0-9]+)?(?:[eE][+-]?[0-9]+)?\\b)'; var oneChar = '(?:[^\\0-\\x08\\x0a-\\x1f\"\\\\]' + '|\\\\(?:[\"/\\\\bfnrt]|u[0-9A-Fa-f]{4}))'; var str = '(?:\"' + oneChar + '*\")'; var varName = '\\$(?:' + oneChar + '[^ ,]*)'; var func = '(?:{[ ]*' + oneChar + '[^ ]*)'; // Will match a value in a well-formed JSON file. // If the input is not well-formed, may match strangely, but not in an unsafe // way. // Since this only matches value tokens, it does not match whitespace, colons, // or commas. var jsonToken = new RegExp( '(?:false|true|null' +'|[\\}]' + '|' + varName + '|' + func + '|' + number + '|' + str + ')', 'g'); If you want it fully assembled here it is: /(?:false|true|null|[\}]|\$(?:(?:[^\0-\x08\x0a-\x1f"\\]|\\(?:["/\\bfnrt]|u[0-9A-Fa-f]{4}))[^ ,]*)|(?:{[ ]*(?:[^\0-\x08\x0a-\x1f"\\]|\\(?:["/\\bfnrt]|u[0-9A-Fa-f]{4}))[^ ]*)|(?:-?\b(?:0|[1-9][0-9]*)(?:\.[0-9]+)?(?:[eE][+-]?[0-9]+)?\b)|(?:"(?:[^\0-\x08\x0a-\x1f"\\]|\\(?:["/\\bfnrt]|u[0-9A-Fa-f]{4}))*"))/g Interestingly enough, its very similar to JSON. I need this regular expression to work in PHP... Here's what I have in PHP: $number = '(?:-?\\b(?:0|[1-9][0-9]*)(?:\\.[0-9]+)?(?:[eE][+-]?[0-9]+)?\\b)'; $oneChar = '(?:[^\\0-\\x08\\x0a-\\x1f\"\\\\]|\\\\(?:[\"/\\\\bfnrt]|u[0-9A-Fa-f]{4}))'; $string = '(?:\"'.$oneChar.'*\")'; $varName = '\\$(?:'.$oneChar.'[^ ,]*)'; $func = '(?:{[ ]*'.$oneChar.'[^ ]*)'; $jsonToken = '(?:false|true|null' .'|[\\}]' .'|'.$varName .'|'.$func .'|'.$number .'|'.$string .')'; echo $jsonToken; preg_match_all($jsonToken, $content, $out); return $out; Here's what happens if I try using preg_match_all(): Warning: preg_match_all() [function.preg-match-all]: Compilation failed: nothing to repeat at offset 0 in /Users/Matt/Sites/Templating/json/Jeeves.php on line 88 Any help would be much appreciated! Thanks, Matt

    Read the article

  • Problem with boost::find_format_all, boost::regex_finder and custom regex formatter (bug boost 1.42)

    - by Nikko
    I have a code that has been working for almost 4 years (since boost 1.33) and today I went from boost 1.36 to boost 1.42 and now I have a problem. I'm calling a custom formatter on a string to format parts of the string that match a REGEX. For instance, a string like: "abc;def:" will be changed to "abc\2Cdef\3B" if the REGEX contains "([;:])" boost::find_format_all( mystring, boost::regex_finder( REGEX ), custom_formatter() ); The custom formatter looks like this: struct custom_formatter() { template< typename T > std::string operator()( const T & s ) const { std::string matchStr = s.match_results().str(1); // perform substitutions return matchStr; } } This worked fine but with boost 1.42 I know have "non initialized" s.match_results() which yield to boost::exception_detail::clone_implINS0_::error_info_injectorISt11logic_errorEEEE - Attempt to access an uninitialzed boost::match_results< class. This means that sometimes I am in the functor to format a string but there is no match. Am I doing something wrong? Or is it normal to enter the functor when there is no match and I should check against something? for now my solution is to try{}catch(){} the exception and everything works fine, but somehow that doesn't feel very good. EDIT1 Actually I have a new empty match at the end of each string to parse. EDIT2 : one solution inspired by ablaeul template< typename T > std::string operator()( const T & s ) const { if( s.begin() == s.end() ) return std::string(); std::string matchStr = s.match_results().str(1); // perform substitutions return matchStr; } *EDIT3 Seems to be a bug in (at least) boost 1.42 *

    Read the article

  • Custumizing Syntax Highlighting in Vim

    - by sixtyfootersdude
    Hey I have defined a few custom file types for vim. I have done this like this: In vimrc: au BufWinEnter,BufRead,BufNewFile *.jak set filetype=jak And then in jak.vim syn match arrows /<-/ syn match arrows /->/ syn match arrows /=>/ syn match arrows /<=/ highlight arrows ctermfg=brown ... This works. (Formatting applies to any file opened with vim with file extension .jak) My question is how I can keep all the current formatting for a file type but add functionality. For example I would like to add this functionality for .vim files: syn keyword yellow yellow highlight yellow ctermfg=yellow ... (so that I can see how my terminal interpenetrates different colors before choosing them.) I have created ~/.vim/syntax/vim.vim (file only contains the above) and put this into my vimrc: au BufWinEnter,BufRead,BufNewFile *.vim set filetype=vim This has no effect. The word yellow is not colored yellow. I have also tried putting my vim.vim file into ~/.vim/after/syntax/vim.vim As suggested here This is the approach that I would like to take. Seems clean and easily maintainable.

    Read the article

  • how to use a regex to search backwards effectively?

    - by Asaf
    hi, i'm searching forward in an array of strings with a regex, like this: for (int j = line; j < lines.length; j++) { if (lines[j] == null || lines[j].isEmpty()) { continue; } matcher = pattern.matcher(lines[j]); if (matcher.find(offset)) { offset = matcher.end(); line = j; System.out.println("found \""+matcher.group()+"\" at line "+line+" ["+matcher.start()+","+offset+"]"); return true; } offset = 0; } return false; note that in my implementation above i save the line and offset for continuous searches. anyway, now i want to search backwards from that [line,offset]. my question: is there a way to search backwards with a regex efficiently? if not, what could be an alternative? 10x, asaf :-) clarification: by backwards i mean finding the previous match. for example, say that i'm searching for "dana" in "dana nama? dana kama! lama dana kama?" and got to the 2nd match. if i do matcher.find() again, i'll search forward and get the 3rd match. but i want to seach backwards and get to the 1st match. the code above should then output something like: found "dana" at line 0 [0,3] // fwd found "dana" at line 0 [11,14] // fwd found "dana" at line 0 [0,3] // bwd

    Read the article

  • Extracting a specific value from command-line output using powershell

    - by Andrew Shepherd
    I've just started learning PowerShell this morning, and I'm grappling with the basics. Here's the problem: I want to query subversion for the revision number of a repository, and then create a new directory with this revision number. The command svn_info outputs a number of label\value pairs, delimited by colons. For example Path: c# URL: file:///%5Copdy-doo/Archive%20(H)/Development/CodeRepositories/datmedia/Development/c%23 Repository UUID: b1d03fca-1949-a747-a1a0-046c2429f46a Revision: 58 Last Changed Rev: 58 Last Changed Date: 2011-01-12 11:36:12 +1000 (Wed, 12 Jan 2011) Here is my current code which solves the problem. Is there a way to do this with less code? I'm thinking that with the use of piping you could do this with one or two lines. I certainly shouldn't have to use a temporary file. $RepositoryRoot = "file:///%5Cdat-ftp/Archive%20(H)/Development/CodeRepositories/datmedia" $BuildBase="/Development/c%23" $RepositoryPath=$RepositoryRoot + $BuildBase # Outputing the info into a file svn info $RepositoryPath | Out-File -FilePath svn_info.txt $regex = [regex] '^Revision: (\d{1,4})' foreach($info_line in get-content "svn_info.txt") { $match = $regex.Match($info_line); if($match.Success) { $revisionNumber = $match.Groups[1]; break; } } "Revision number = " + $revisionNumber;

    Read the article

  • scraping website with javascript cookie with c#

    - by erwin
    Hi all, I want to scrap some things from the following site: http://www.conrad.nl/modelspoor This is my function: public string SreenScrape(string urlBase, string urlPath) { CookieContainer cookieContainer = new CookieContainer(); HttpWebRequest httpWebRequest = (HttpWebRequest)WebRequest.Create(urlBase + urlPath); httpWebRequest.CookieContainer = cookieContainer; httpWebRequest.UserAgent = "Mozilla/6.0 (Windows; U; Windows NT 7.0; en-US; rv:1.9.0.8) Gecko/2009032609 Firefox/3.0.9 (.NET CLR 3.5.30729)"; WebResponse webResponse = httpWebRequest.GetResponse(); string result = new System.IO.StreamReader(webResponse.GetResponseStream(), Encoding.Default).ReadToEnd(); webResponse.Close(); if (result.Contains("<frame src=")) { Regex metaregex = new Regex("http:[a-z:/._0-9!?=A-Z&]*",RegexOptions.Multiline); result = result.Replace("\r\n", ""); Match m = metaregex.Match(result); string key = m.Groups[0].Value; foreach (Match match in metaregex.Matches(result)) { HttpWebRequest redirectHttpWebRequest = (HttpWebRequest)WebRequest.Create(key); redirectHttpWebRequest.CookieContainer = cookieContainer; webResponse = redirectHttpWebRequest.GetResponse(); string redirectResponse = new System.IO.StreamReader(webResponse.GetResponseStream(), Encoding.Default).ReadToEnd(); webResponse.Close(); return redirectResponse; } } return result; } But when i do this i get a string with an error from the website that it use javascript. Does anybody know how to fix this? Kind regards Erwin

    Read the article

  • Perl : get substring which matches regex error

    - by Michael Mao
    I am very new to Perl, so please bear with my simple question: Here is the sample output: Most successful agents in the Emarket climate are (in order of success): 1. agent10896761 ($-8008) 2. flightsandroomsonly ($-10102) 3. agent10479475hv ($-10663) Most successful agents in the Emarket climate are (in order of success): 1. agent10896761 ($-7142) 2. agent10479475hv ($-8982) 3. flightsandroomsonly ($-9124) I am interested only in agent names as well as their corresponding balances, so I am hoping to get the following output: agent10896761 -8008 flightsandroomsonly -10102 agent10479475hv -10663 agent10896761 -7142 agent10479475hv -8982 flightsandroomsonly -9124 For later processes. This is the code I've got so far: #!/usr/bin/perl -w open(MYINPUTFILE, $ARGV[0]); while(<MYINPUTFILE>) { my($line) = $_; chomp($line); # regex match test if($line =~ m/agent10479475/) { if($line =~ m/($-[0-9]+)/) { print "$1\n"; } } if($line =~ m/flightsandroomsonly/) { print "$line\n"; } } The second regex match has nothing wrong, 'cause that is printing out the whole line. However, for the first regex match, I've got some other output such like: $ ./compareResults.pl 3.txt 2. flightsandroomsonly ($-10102) 0479475 0479475 3. flightsandroomsonly ($-9124) 1. flightsandroomsonly ($-8053) 0479475 1. flightsandroomsonly ($-6126) 0479475 If I "escape" the braces like this if($line =~ m/\($-[0-9]+\)/) { print "$1\n"; } Then there is never a match for the first regex... So I'm stuck with a problem of making that particular regex work. Any hints for this? Many thanks in advance.

    Read the article

  • Python - Code snippet not working on Python 2.5.6, using IDLE

    - by Francisco P.
    Hello, everyone I am using a piece of self-modifying code for a college project. Here it is: import datetime import inspect import re import sys def main(): # print the time it is last run lastrun = 'Mon Jun 8 16:31:27 2009' print "This program was last run at ", print lastrun # read in the source code of itself srcfile = inspect.getsourcefile(sys.modules[__name__]) f = open(srcfile, 'r') src = f.read() f.close() # modify the embedded timestamp timestamp = datetime.datetime.ctime(datetime.datetime.now()) match = re.search("lastrun = '(.*)'", src) if match: src = src[:match.start(1)] + timestamp + src[match.end(1):] # write the source code back f = open(srcfile, 'w') f.write(src) f.close() if __name__=='__main__': main() Unfortunately, it doesn't work. Error returned: # This is the script's output This program is last run at Mon Jun 8 16:31:27 2009 # This is the error message Traceback (most recent call last): File "C:\Users\Rui Gomes\Desktop\teste.py", line 30, in <module> main() File "C:\Users\Rui Gomes\Desktop\teste.py", line 13, in main srcfile = inspect.getsourcefile(sys.modules[__name__]) File "C:\Python31\lib\inspect.py", line 439, in getsourcefile filename = getfile(object) File "C:\Python31\lib\inspect.py", line 401, in getfile raise TypeError('{!r} is a built-in module'.format(object)) TypeError: <module '__main__' (built-in)> is a built-in module I'd be thankful for any solutions.

    Read the article

  • PHP PCRE differences on testing and hosting servers

    - by Gary Pearman
    Hi all, I've got the following regular expression that works fine on my testing server, but just returns an empty string on my hosted server. $text = preg_replace('~[^\\pL\d]+~u', $use, $text); Now I'm pretty sure this comes down to the hosting server version of PCRE not being compiled with Unicode property support enabled. The differences in the two versions are as follows: My server: PCRE version 7.8 2008-09-05 Compiled with UTF-8 support Unicode properties support Newline sequence is LF \R matches all Unicode newlines Internal link size = 2 POSIX malloc threshold = 10 Default match limit = 10000000 Default recursion depth limit = 10000000 Match recursion uses stack Hosting server: PCRE version 4.5 01-December-2003 Compiled with UTF-8 support Newline character is LF Internal link size = 2 POSIX malloc threshold = 10 Default match limit = 10000000 Match recursion uses stack Also note that the version on the hosting server (the same version PHP is compiled against) is pretty old. What confuses me though, is that pcretest fails on both servers from the command line with re> ~[^\\pL\d]+~u ** Unknown option 'u' although this regexp works fine when run from PHP on my server. So, I guess my questions are does the regular expression fail on the hosting server because of the lack of Unicode properties? Or is there something else that I'm missing? Thanks all, Gaz.

    Read the article

  • codingBat separateThousands using regex (and unit testing how-to)

    - by polygenelubricants
    This question is a combination of regex practice and unit testing practice. Regex part I authored this problem separateThousands for personal practice: Given a number as a string, introduce commas to separate thousands. The number may contain an optional minus sign, and an optional decimal part. There will not be any superfluous leading zeroes. Here's my solution: String separateThousands(String s) { return s.replaceAll( String.format("(?:%s)|(?:%s)", "(?<=\\G\\d{3})(?=\\d)", "(?<=^-?\\d{1,3})(?=(?:\\d{3})+(?!\\d))" ), "," ); } The way it works is that it classifies two types of commas, the first, and the rest. In the above regex, the rest subpattern actually appears before the first. A match will always be zero-length, which will be replaceAll with ",". The rest basically looks behind to see if there was a match followed by 3 digits, and looks ahead to see if there's a digit. It's some sort of a chain reaction mechanism triggered by the previous match. The first basically looks behind for ^ anchor, followed by an optional minus sign, and between 1 to 3 digits. The rest of the string from that point must match triplets of digits, followed by a nondigit (which could either be $ or \.). My question for this part is: Can this regex be simplified? Can it be optimized further? Ordering rest before first is deliberate, since first is only needed once No capturing group Unit testing part As I've mentioned, I'm the author of this problem, so I'm also the one responsible for coming up with testcases for them. Here they are: INPUT, OUTPUT "1000", "1,000" "-12345", "-12,345" "-1234567890.1234567890", "-1,234,567,890.1234567890" "123.456", "123.456" ".666666", ".666666" "0", "0" "123456789", "123,456,789" "1234.5678", "1,234.5678" "-55555.55555", "-55,555.55555" "0.123456789", "0.123456789" "123456.789", "123,456.789" I haven't had much experience with industrial-strength unit testing, so I'm wondering if others can comment whether this is a good coverage, whether I've missed anything important, etc (I can always add more tests if there's a scenario I've missed).

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 45 46 47 48 49 50 51 52 53 54 55 56  | Next Page >