Search Results

Search found 1481 results on 60 pages for 'student'.

Page 49/60 | < Previous Page | 45 46 47 48 49 50 51 52 53 54 55 56  | Next Page >

  • Working for Web using open-source Technologies

    - by anirudha
    As a Web Developer we all have own dream to make a great web application. a great application was built upon high discipline and best practice on the process of development then we can make modification easier in future as if we want. the user feedback also have a matter because they tell us what they want or expected with the application we make day and night. sometime they report a nice story , experience or a problem they got with our application. so that's matter because they telling about our application much more because they use our software and a part of process of future development or next version of application we make. so the Web have a good thing that they updated as soon as possible. in desktop application their is a numbers of trouble client have when they want to use our application. first thing that installation of software never goes right on every system. big company spent a big amount of money to troble these problem the user have with their software.   Web application is nice implementation of application because their is no trouble with installation all have same experience and if something goes wrong patch come soon and no waiting for new version. Chrome even a desktop application [browser] but they automatically update themselves so their is no trouble for user to get next version now hasseles.    Web application development in Microsoft way have their own rule , pattern practice to make better application in less time. the technologies i want to show you here is some great opensource example like MySQL jQuery and ASP.NET MVC a framework based on ASP.NET server side language.   For going to next step we need to show you a list of software you need to have to fully experience this tutorial.   Visual Web Developer 2010 Express Edition  MySQL [open-source RDBMS]   Query [open-source javascript library]   for getting these software you need to pay nothing.   Visual Web Developer can obtained from Microsoft.com/Express or if you are student or Web Developer you are eligible to get the Visual studio professional and many other great software from Microsoft through their Dreamspark or WebsiteSpark programmes.   MySQL is a great Relational Database management software who are freely available from MySQL.com as a database monitorting tool you can use MySQL workbrench who can be freely get from MySQL official website or many other free tool are available for begining development with MySQL   jQuery is a great library for making javascipt development easier and faster.you can obtained jQuery from jQuery.com their official website.

    Read the article

  • The type of programmer I want to be [closed]

    - by Aventinus_
    I'm an undergraduate Software Engineer student, although I've decided that pure programming is what I want to do for the rest of my life. The thing is that programming is a vast field and although most of its aspects are extremely interesting, soon or later I'll have to choose one (?) to focus on. I have several ideas on small projects I'd like to develop this summer, having in mind that this will gain me some experience and, in the best scenario, some cash. But the most important reason I'd like to develop something close to “professional” is to give myself direction on what I want to do as a programmer. One path is that of the Web Programmer. I enjoy PHP and MySQL, as well as HTML and CSS, although I don't really like ASP.NET. I can see myself writing web apps, using the above technologies, as well as XML and Javascript. I also have a neat idea on a Facebook app. The other path is that of the Desktop Programmer. This is a little more complicated cause I really-really enjoy high level languages such as Java and Python but not the low level ones, such as C. I use both Linux and Windows for the last 6 years and I like their latest DEs (meaning Gnome Shell and Metro). I can see myself writing desktop applications for both OSs as long as it means high level programming. Ideally I'd like being able to help the development of GNOME. The last path that interests me is the path of the Smartphone Programmer. I have created some sample applications on Android and due to Java I found it a quite interesting experience. I can also see myself as an independent smartphone developer. These 3 paths seem equally interesting at the moment due to the shallowness of my experience, I guess. I know that I should spend time with all of them and then choose the right one for me but I'd like to know what are the pros and cons in terms of learning curve, fun, job finding and of course financial rewards with each of these paths. I have fair or basic understanding of the languages/technologies I described earlier and this question will help me choose where to focus, at least for now.

    Read the article

  • Weird routing issue

    - by Joel Coel
    I'm having some weird internet problems on campus. I know it's something simple, but it's a case where I need another set of eyes. I think I can explain the problem best by posting a tracert: Tracing route to google.com [74.125.45.147] over a maximum of 30 hops: 1 3 ms 3 ms 3 ms 192.168.8.1 2 1 ms 1 ms 1 ms elissaemily-pc.york.edu [192.168.10.5] 3 2 ms 2 ms 2 ms rrcs-76-79-19-33.west.biz.rr.com [76.79.19.33] 4 31 ms 3 ms 2 ms ge-1-1-0.lnclne00-mx41.neb.rr.com [76.85.220.109] 5 20 ms 17 ms 17 ms ge-7-3-0.chcgill3-rtr1.kc.rr.com [76.85.220.137] 6 20 ms 20 ms 19 ms ae-5-0.cr0.chi30.tbone.rr.com [66.109.6.112] 7 19 ms 19 ms 24 ms ae-1-0.pr0.chi10.tbone.rr.com [66.109.6.155] 8 26 ms 24 ms 24 ms 74.125.48.109 9 23 ms 24 ms 21 ms 216.239.46.246 10 39 ms 39 ms 55 ms 209.85.242.215 11 39 ms 39 ms 39 ms 209.85.254.243 12 39 ms 40 ms 96 ms 209.85.253.145 13 39 ms 39 ms 39 ms yx-in-f147.1e100.net [74.125.45.147] Trace complete. Note the second entry in there. Not only is the host name a student's computer, but the ip address doesn't exist. Dhcp shows that host as having a different address and you can't ping any 192.168.10.5. Yet somehow it's routing packets for us (and not very well, either — things are slow right now). The basic network routing table looks like this: Destination Subnet Mask Gateway --------------------------------------- Default Route -- 10.1.1.5 (our firewall) 10.0.0.0 255.0.0.0 -- 192.168.8.0 255.255.252.0 --

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Apache / PHP Begins to Deny SQL Requests after about 2000

    - by Daniel Stern
    We have a web page on our server that we use to run administrative scripts. For example, we might run the script "unenrolStudents()" which runs 5,000 SQL SET commands one after another and sets 5000 student entries in an SQL database to unenrolled. However, we are finding that after running a few thousand queries (it is not totally consistent) we will be "locked out" by our server. SYMPTOMS OF LOCKING OUT: - unable to connect to server with winSCP - opening putty with that connection shows a blank screen (no login / pass) - clearing cookies / cache in chrome does NOT fix locking out - other computers in the office ALSO become locked out - locking out can be triggered with a high frequency of requests (10000 in 1 second) or by less over time (10000 in 500 seconds - this will still cause a lockout even though the frequency is much less) We believe this is a security feature of our own Apache. I know we are using Suhosin but I didn't configure it so I don't know. How can I disable this locking effect so that I can confidently run all my SQL requests and they will go through? Has anyone else dealt with this and found workarounds? Thanks DS

    Read the article

  • Windows Server 2008 R2 RAS VPN: access server on internal interface ip

    - by Mathias
    short question: I'm usually a linux admin but need to setup a Win2k8 R2 server for a student project. The server is running as VM on a root server and has a public internet IP assigned. Additionally I need a VPN server to access some services running on the server. I managed to set up a working VPN gateway via the Routing and RAS service which assigns clients an IP in the private subnet 192.168.88.0/24 with the Interface "Internal" listening on 192.168.88.1. Additionally I set up the external interface as NAT interface. So I can connect to the VPN server, get an IP assigned and the server additionally does NAT and I can access the internet over the VPN connection. The only thing I additionally need, is that I can access the server itself over that internal IP (e.g. client 192.168.88.2, server 192.168.88.1) as I want to access some services which I don't like to expose to the internet and restrict them to connected VPN clients. Does anybody have a hint, which configuration I'm missing here to be able to access the server over the VPN connection? EDIT: VPN clients get assigned the IP from the private subnet with subnetmask 255.255.255.255, I guess that might be the reason I can't access the server on the private IP address although it's in the same network range. Any ideas how to change this? I defined a static address pool in the Routing and RAS service, but I can't change the netmask there. EDIT2: I can't access the server from the client, but I can fully access the client from the server (ping, HTTP). I guess it has to do with firewall configuration. Thanks in advance, Mathias

    Read the article

  • Internet Radio Station for University

    - by ryan
    I am trying to help my University Student Radio station rethink the setup of the way they stream music, but I have some questions regarding the use of Ubuntu to stream music. Currently, the radio station uses two windows machines: one of which is used to stream the radio station and serve the website, and the other is used by rotating djs to select songs and create playlists. The computer used by djs feeds mono into the sound card of the server and the server streams the feed online. -Ideally I would like to maintain a two-computer setup: One computer as server, and another that is used to select and play music by rotating djs. -I would like to use Ubuntu for the server. -I would like to use Windows for the other machine. -The server should be able to stream song information. First, is there a way to somehow get the song information from an analog feed? Second, what is the best streaming server for radio? I have encountered shoutcast, icecast, and darwin, but I don't know where to begin in attempting to gauge them. Finally, if anyone has any tips or pointers about small internet radio station management/ setup they would be appreciated as this is my first radio station, and I am eager to hear of past experiences.

    Read the article

  • Windows Server 2008 R2 RAS VPN: access server on internal interface ip

    - by Mathias
    Hey, short question: I'm usually a linux admin but need to setup a Win2k8 R2 server for a student project. The server is running as VM on a root server and has a public internet IP assigned. Additionally I need a VPN server to access some services running on the server. I managed to set up a working VPN gateway via the Routing and RAS service which assigns clients an IP in the private subnet 192.168.88.0/24 with the Interface "Internal" listening on 192.168.88.1. Additionally I set up the external interface as NAT interface. So I can connect to the VPN server, get an IP assigned and the server additionally does NAT and I can access the internet over the VPN connection. The only thing I additionally need, is that I can access the server itself over that internal IP (e.g. client 192.168.88.2, server 192.168.88.1) as I want to access some services which I don't like to expose to the internet and restrict them to connected VPN clients. Does anybody have a hint, which configuration I'm missing here to be able to access the server over the VPN connection? EDIT: VPN clients get assigned the IP from the private subnet with subnetmask 255.255.255.255, I guess that might be the reason I can't access the server on the private IP address although it's in the same network range. Any ideas how to change this? I defined a static address pool in the Routing and RAS service, but I can't change the netmask there. EDIT2: I can't access the server from the client, but I can fully access the client from the server (ping, HTTP). I guess it has to do with firewall configuration. Thanks in advance, Mathias

    Read the article

  • Cheap desktop computer in 19" rack-mountable form-factor?

    - by Alex Basson
    I'm a high school teacher at a small private school. As of this year, we have SMARTBoards in every classroom (though I've had one in the class I share for two years now). The classrooms themselves don't have computers in them, so we teachers bring our laptops to class and connect them to the boards. This has several disadvantages: This takes a few minutes while we wait for the board to boot up and then orient the board to our individual laptop -- we have to do this every time b/c different teachers have different laptops requiring different orientations. This isn't ideal because when you only have 43 minutes per class period, waiting five minutes just to get started is a real waste. Carrying your laptop to class doesn't sound so bad until you consider that we're also carrying textbooks and piles of student papers, and we're carrying it all through crowded high school hallways. More than one laptop has fallen THUNK to the floor, with dire consequences. We feel we could eliminate the need to use our laptops with the SMARTBoards if we had a dedicated computer in each classroom hooked up to the board at all times. Each board set-up is connected to a podium with a standard 19" rack in it, currently housing a power supply and DVD player. There're plenty of rack spaces available. So I'm thinking: maybe we could get some inexpensive computers in a 19" rack-mountable form factor, install them in the podiums, and connect them to the boards on a permanent basis. Any suggestions?

    Read the article

  • Software to automate website screenshot capture

    - by Leniel Macaferi
    Do you know any software that can automate the process of getting screenshots of every page of a website? It would act like a spider/crawler/robot. You name it... For example: I developed a website and now I'd like to get a screenshot of every page of the site. I of course could do it manually (a lot of work). For each module of the site (Student, Payment, etc) I have different pages (Create, Edit, Details, Delete, etc) forms. The thing I'm looking for is a software that can visit every link of the site and then capture the screen - a software that can automate the whole process. It would also be good if the software allowed the user to pass a list of URLs to capture screenshots allowing even more fine grained configuration. EDIT: I tried Selenium mentioned by Aaron in his answer but I managed to find an app that does exactly what I needed. It's called Paparazzi!. I wrote a blog post to showcase my attempt at Selenium and the findings regarding Paparazzi!'s batch capture functionality: Software to automate website screenshot capture

    Read the article

  • open source solution to a gateway for a network of a housing cooperative of 150 people

    - by SirDinosaur
    i just inherited a barely functioning network for a student housing cooperative of about 150 people. in it's current state, as i understand it from the previous person in charge of the network, we have working wireless access points and working ethernet cords going to working gigabit switches going to a barely functioning gateway (right now a simple home router) to one of three possible outbound connections. it is possible to connect to the network through the wireless or ethernet, but especially during peak hours, packets / connections are likely dropped or otherwise get no response. my intuition tells me to replace the gateway with something that can handle multiple outbound connections (WAN) and one inbound connection (LAN), while the rest of the network seems suitable for now. i'm somewhat knowledgable in Linux (been using Debian after first Arch Linux) and i want to use as much open source as possible, but i'm confused whether or not a simple server that i could easily understand will work for this situation. do i need specialized hardware to handle the switching more effectively? if so, what are my options? (i found this, thoughts?) or if a Debian server would work, anything else i should about the specs required for this type of server? also links to any useful information on using open source to maintain this type of network would be most appreciated. <3 P.S. crossposted http://redd.it/yybp2.

    Read the article

  • Word 2007 won't run, tries to reinstall, fails with error 1402.

    - by eidylon
    Okay, this problem has been plaguing this computer for a while now. We tried googling, and none of the answers found helped to solve the problem. So, I am now posting the answer here for posterity. Office 2007 Home/Student edition was installed on the computer, running Vista (32-bit). One day, Word just up and stopped working. All the other programs continued to operate as expected. But every time you would click the icon for Word, it would pop up an install dialog, with a message reading "Preparing to install...". After a few minutes of the little progress bar going and going, it errors out, and gives error 1402, something to the effect of unable to access registry key HKEY_Local_Machine\Software\Classes\.wll\.... Searching around, every answer i found had to do with reassigning the permissions on this key, giving full rights to SYSTEM or to Everyone, and propagating the changes down to all sub-keys. When ever this was attempted though, it would tell us that we were unable to access the key due to permissions, even though we had run regedit as Administrator and are logged on with an administrative account. We also tried uninstalling Office and reinstalling it, as well as doing a repair install. Both these attempts also threw the same 1402 error. Also of note was that the executable for Word (winword.exe) was MIA and no longer to be found in the Office install directory.

    Read the article

  • Running Visual Studio 2010 in a University Campus

    - by Woondows
    We have just installed Windows 7 Enterprise x64 in one of our computer labs being used by students for programming. However, when we installed Visual Studio 2010 Ultimate on the machines, we found that to even launch the application (devenv.exe), required the student to enter the administrator password (the usual UAC prompt). Of course, we could just turn off UAC, but that would defeat the purpose of having it in Windows 7. On the other hand, we cannot really give the students local administrator privilege, as we are concerned that they will do some malicious stuff on the computers. Previously when we used Windows XP Professional running Visual Studio 2005, we had no problems. Kindly advise if there's any workaround for this. EDIT: Thanks for the answer guys. Mayank, your links may work for Visual Studio .Net, but it doesn't seem to work for Visual Studio 2010. Ryan, Tieson, I'm intrigued that you guys managed to get it working easily. FYI I don't manage the Group Policies, but I can get them changed if necessary. Any particular GP that I should be looking at? Suggestions to how to troubleshoot further why UAC is being invoked? At least now I know for sure that this is not supposed to be the default behaviour for Visual Studio 2010 so I'm going to keep digging for a solution. Will try running Procmon and see if i can find something..

    Read the article

  • Excel data representation: show me all people who did not pass the exam

    - by dreftymac
    Background I have an excel spreadsheet with the results of a pass/no-pass exam. Students are allowed to take the exam as often as they want until they either pass, or give up trying. student ;; result ;; date [email protected] ;; no-pass ;; 2000-06-07 [email protected] ;; pass ;; 2000-06-07 [email protected] ;; pass ;; 2000-06-07 [email protected] ;; no-pass ;; 2000-06-07 [email protected] ;; pass ;; 2000-06-07 [email protected] ;; pass ;; 2000-06-08 [email protected] ;; no-pass ;; 2000-06-08 Question Using a pivot-table or something else, how can I get excel to show me a clean report or representation of this data on another sheet that answers the question: Who are all the people who took the exam, but never got a passing grade? In the above example it would just show me [email protected] ;; no-pass ;; with all the dates that delta took the exam. I know excel is not a database nor a reporting tool per-se, but it would be great if I could get it to do this.

    Read the article

  • Connecting to unsecured wireless network

    - by Sanchez
    I would like to know what information is public and can be intercepted in a non-open, but unsecured wireless network. Moreover, is there anything I can do to make it more "secure", other than using https connection whenever possible. In more details, I recently discovered (with surprise) that the wireless network in my school is actually unsecured. Although not everyone can connect to it (you need a student ID), I am told that certain softwares like Wireshark would be able to intercept the data. Since I have been using the network for all private purposes (email, facebook etc), I do feel quite insecure now and would like to understand the situation a bit better. I installed Wireshark and tried to play with it but all I can see are something alien to me. In any case, all I see seems to come directly/indirectly from my IP address, and I have long thought that usually different computers in the same wireless network would be assigned different addresses. Am I wrong? If not, then I feel very confused about what information is actually being captured (potentially by other users in the network, since I don't think I could capture activities of others in the same network anyway), and whether it's safe to use the network at all. (Gambling on others in the same network showing good behaviour is apparently not an option.) Thank you.

    Read the article

  • How to create a static IP on Windows Server 2008 R2 so I can access the server remotely

    - by Aesir
    I have just purchased a HP Proliant N40L which I am intending to use as a NAS, learning tool and just in general something to mess around with. As a student via the Microsoft dreamspark program I can get a free copy of Windows Server 2008 R2 which I am using as the OS. So that I can remote to the box from outside of my local network and so that I can stream media from it to my PS3, I have read that I need to create a static IP for the server and use port forwarding to forward to this IP so I can remote in. Is this correct? I am not really sure how to do this and if I need to make these changes on my router configuration, on the OS or both. I am a novice when it comes to networking however most resources for Windows server 2008 R2 seem to assume a fair amount of experience already. I realise that using this particular OS may seem like overkill for what I currently wish to do with it (stream content to other devices and backup) but as I can get a copy for free it seems sensible. Edit: From reading answers posted I feel I should give more information. I have now tried to add a static IP address using my router configuration settings. I have used the getmac command to get the mac address of the server. My ISP is Virgin Media and I have gone to the LAN IP section and I have added an IP address to the DHCP Reservation Lease Info. I can now use remote desktop connection internally to remote to the server (so I am assuming assigning this IP has worked). How do I configure this on the OS as well? I am also unsure on how I would remote to this machine outside of my local network?

    Read the article

  • Steps to deploy a custom routing protocol

    - by user134589
    I'm a Ph.D Student and I'm researching a Service Centric Networking architecture with resourceallocation on a large scale. What I'm looking to do is expand an existing routing protocol like OSPF with extra fields and some new message types that I need for communication between Nodes. I want to manipulate the cost of a network link and I want paths to be calculated like in OSPF V2/v3, but using the cost that my algorithms have calculated. What I have I have the source code of OSPF from Quagga. I am assuming I can edit this code how I want, including packet structures and creating new types. Yes, I am aware it won't be easy but this is a 6 years research project and I am eager to develop something new, to move forward. What I need I would like to know how I can deploy the edited OSPF source files I have (written in C) on any type of server. I have a large testbed environment available with hundreds of virtual nodes and pretty much any OS out there. So if I want to test my extended protocol, how do I make all the nodes in a network use this to communicate? I do not understand what parts of the kernel I need to edit here. I tried searching for days now and I am unable to find how to deploy a non-existing routing protocol, without the use of an application-level framework. If somebody could push me in the right direction that'd be awesome. note: I need this to be a routingprotocol and not an application, since I want this to work on op of the network layer for performance reasons. Thanks!

    Read the article

  • Creating a Logical network diagram

    - by user273284
    Im a student and I have been assigned the task of creating a logical network diagram for the following scenario There are 2 buildings, the first is the head office and the second is the branch. The data centre is in the head office, it contains domain controller, mail server, file server and a web server. it provides wired and wireless access to the staff. the branch building is new and it does not have a network. The two buildings must be connected using a VPN connection. The branch building will not have any servers but just network devices that will provide the connectivity, the users in the branch building will be connected to the head office over the VPN. I had created a diagram based on this scenario, but my teacher rejected it saying that it does not follow Cisco hierarchical Model and the servers were not placed correctly in the diagram. I just wanted some help in this matter so that I Can create my network diagram correctly. If anyone could upload a picture of how the logical diagram should be for this scenario will be helpful, any other resources would also be great.

    Read the article

  • Am I safe on Windows if I continue like this?

    - by max
    Of all the available tons of anti-malware software for Windows all over the internet, I've never used any paid solution(I am a student, I have no money). Since the last 10 years, my computers running Windows have never been hacked/compromised or infected so badly that I had to reformat them(of course I did reformat them for other reasons). The only program I have for security is Avast Home Edition, which is free, installed on my computers. It has never caused any problems; always detected malware, updated automatically, has an option to sandbox programs and everything else I need. Even if I got infected, I just did a boot-time scan with it, downloaded and ran Malwarebytes, scanned Autoruns logs, checked running processes with Process Explorer and did some other things and made sure I cleaned my computer. I am quite experienced and I've always taken basic precautions like not clicking suspicious executables, not going to sites which are suspicious according to WOT, and all that blah. But recently I've been doing more and more online transactions and since its 2012 now, I'm doubtful whether I need more security or not. Have I been just lucky, or do my computing habits obviate the need to use any more(or paid) security software?

    Read the article

  • Clean installation of RHEL 5.5 claims package "desktops" is missing

    - by TKguru42
    Hi all, I'm a student worker in the CS department of my university, so please forgive me for any unprofessional descriptions. Simplified explanations are appreciated. I recently replaced some bad graphics cards in a few public workstations. The machines are all the same model. Before putting them back on the network I did fresh installs of RHEL---first I tried 5.4, but yum update ran into all sorts of ugly dependency errors and if I tried to remove any of the problematic packages, the whole operating system FUBAR'd. Using RHEL 5.5 gave me the same errors during install saying that "java.1.5.1-sun*" and "desktops" were missing, but yum update didn't have any dependency problems. Now that I tried logging in through the GUI, I encounter no GUI past the standard RHEL login page. The desktop is a uniform light teal and there's no system tray. An xclock window and an xterm window are open, and Firefox opens automatically, but that's it. Nothing else. What's REALLY confusing is that the computer claims that gnome is already installed, except it clearly isn't working. Any help or advice is greatly appreciated. If it helps, our department uses kickstart to run our standard Linux installs. I can try to get the script if that would be of use. Thank you!

    Read the article

  • Winodws server 2003 Setup

    - by Barracksbuilder
    I work at a university maintaining the computer science department server. I am looking for a more economical way to stream line the set up of student accounts. CS students are granted a Username and password an IIS virtual directory, FTP virtual directory, and a mysql database. Server is running windows server 2003R2 (Possibly migrating to 2008R2) The server is running a domain though no students physically log a terminal into it (No computers are part of my domain.) Creating the account is a manual process. I did right a PHP script to query the Universities AD and copy the information and write it to my AD. I then have to create basically the users home directory. I tried having AD do it but since the user never physically logs in it never creates the directory. Permissions on this folder are set to User - full, Instructors (group) - full, Users (group) - read, IUSER - read. Inside of the users folder their is a "Private" folder with permissions User - full, instructors (group) - full. Next step is IIS I create a virtual directory in the default web site pointed to the users home directory so they have a website. Same goes for FTP virtual directory in the default ftp configuration to allow the users to upload files to their website. Mysql I have to create a user and password then create a mysql scheme (database) full access for the user and full access to the instructors account to be able to access the students database. All of this is done manually and takes me a week to do. The closest description is maybe a shared hosting environment. Is there a better way to do this? Scripting wise, or better structure setup?

    Read the article

  • Microsoft Word 2008 on the Mac sometimes "Disappears" documents, really.

    - by Ross Charette
    This happens in a computer lab environment, has happened at least 3 times. We are running Microsoft Office 2008 for mac on Leopard, everything is updated. Our user's home directories are on a network drive, but the /Library/Cache folder is running locally. Typically a student will have a Word file that they have been working on, it's been saved before they even logged onto the computer that day. They log on, open the document, click the save icon (not go to File Save), sometimes even save multiple times, then close Word. The document is now gone. It's not hidden, there are no autosaves or anything in the Cache folder. Definitely not in the trash or trashes folder. It can't find it when you click on it in 'recent documents'. Searching meticulously though every folder in their home drive turns up nothing. They look using Finder, I look ssh'd as root into their home using ls -la. I look for similar files in case they renamed it by mistake. It's gone. Disappeared. Vaporized. It's happened to at least 3 different users in the past year. Much whining. Any idea?

    Read the article

  • How to manage enterprise network of Linux machines?

    - by killy9999
    I work at the university. In my institute we have six computer laboratories used for teaching. Each lab has almost 20 computers, which gives over 100 machines total. Computers have either Windows XP or Windows 7 Eneterprise operating system. We use Symantec Ghost to manage all the computers. Each computer has a Ghost client installed, which allows to control computers over network. Every six months we restore a master image on one of the computers in a lab, update that image and distribute it over the network to all computers in a laboratory. Thanks to Ghost client this is done automatically with just a few clicks. Recently I suggested that it would be good to have Linux installed in the laboratories. The administrators were concerned that we would not be able to manage that many computers if each would have to be updated manually. The question is: how to manage such a huge network of Linux machines in an automated way? To make the description of our network more complete I'll add that all students have their accounts (about few thousand users) on a central server. These are accessed via LDAP. To use a computer in laboratory each student has to log in using his own account.

    Read the article

  • SQL SERVER – Merge Operations – Insert, Update, Delete in Single Execution

    - by pinaldave
    This blog post is written in response to T-SQL Tuesday hosted by Jorge Segarra (aka SQLChicken). I have been very active using these Merge operations in my development. However, I have found out from my consultancy work and friends that these amazing operations are not utilized by them most of the time. Here is my attempt to bring the necessity of using the Merge Operation to surface one more time. MERGE is a new feature that provides an efficient way to do multiple DML operations. In earlier versions of SQL Server, we had to write separate statements to INSERT, UPDATE, or DELETE data based on certain conditions; however, at present, by using the MERGE statement, we can include the logic of such data changes in one statement that even checks when the data is matched and then just update it, and similarly, when the data is unmatched, it is inserted. One of the most important advantages of MERGE statement is that the entire data are read and processed only once. In earlier versions, three different statements had to be written to process three different activities (INSERT, UPDATE or DELETE); however, by using MERGE statement, all the update activities can be done in one pass of database table. I have written about these Merge Operations earlier in my blog post over here SQL SERVER – 2008 – Introduction to Merge Statement – One Statement for INSERT, UPDATE, DELETE. I was asked by one of the readers that how do we know that this operator was doing everything in single pass and was not calling this Merge Operator multiple times. Let us run the same example which I have used earlier; I am listing the same here again for convenience. --Let’s create Student Details and StudentTotalMarks and inserted some records. USE tempdb GO CREATE TABLE StudentDetails ( StudentID INTEGER PRIMARY KEY, StudentName VARCHAR(15) ) GO INSERT INTO StudentDetails VALUES(1,'SMITH') INSERT INTO StudentDetails VALUES(2,'ALLEN') INSERT INTO StudentDetails VALUES(3,'JONES') INSERT INTO StudentDetails VALUES(4,'MARTIN') INSERT INTO StudentDetails VALUES(5,'JAMES') GO CREATE TABLE StudentTotalMarks ( StudentID INTEGER REFERENCES StudentDetails, StudentMarks INTEGER ) GO INSERT INTO StudentTotalMarks VALUES(1,230) INSERT INTO StudentTotalMarks VALUES(2,255) INSERT INTO StudentTotalMarks VALUES(3,200) GO -- Select from Table SELECT * FROM StudentDetails GO SELECT * FROM StudentTotalMarks GO -- Merge Statement MERGE StudentTotalMarks AS stm USING (SELECT StudentID,StudentName FROM StudentDetails) AS sd ON stm.StudentID = sd.StudentID WHEN MATCHED AND stm.StudentMarks > 250 THEN DELETE WHEN MATCHED THEN UPDATE SET stm.StudentMarks = stm.StudentMarks + 25 WHEN NOT MATCHED THEN INSERT(StudentID,StudentMarks) VALUES(sd.StudentID,25); GO -- Select from Table SELECT * FROM StudentDetails GO SELECT * FROM StudentTotalMarks GO -- Clean up DROP TABLE StudentDetails GO DROP TABLE StudentTotalMarks GO The Merge Join performs very well and the following result is obtained. Let us check the execution plan for the merge operator. You can click on following image to enlarge it. Let us evaluate the execution plan for the Table Merge Operator only. We can clearly see that the Number of Executions property suggests value 1. Which is quite clear that in a single PASS, the Merge Operation completes the operations of Insert, Update and Delete. I strongly suggest you all to use this operation, if possible, in your development. I have seen this operation implemented in many data warehousing applications. Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: Pinal Dave, SQL, SQL Authority, SQL Joins, SQL Query, SQL Scripts, SQL Server, SQL Tips and Tricks, T SQL, Technology Tagged: Merge

    Read the article

  • JavaScript Browser Hacks

    Recently during one of my client side scripting classes, I was trying to show my students some basic examples of JavaScript as an introduction to the language.  My first basic example was to show an alert box using JavaScript via the address bar. The student’s reaction to my browser hack example really caught me off guard in a good way. After programming with a language for close to 10 years you start to lose the "Awe Cool!" effect that new learners of a language experience when writing code. New learns of JavaScript are the reason why I created this post. Please enjoy. Note: Place JavaScript in to address bar and then press the enter key. Example 1: JavaScript Alert box displaying My name: John Doe Javascript:alert('My name: \n John Doe') ; Example 2: JavaScript alert box displaying name entered by user. javascript:alert('My name: \n ' + prompt('Enter Name','Name')) ; Example 3: JavaScript alert box displaying name entered by user, and then displays the length of the name. javascript:var name= prompt('Enter Name','Name'); alert('My name: \n ' + name); alert(name.length); If you notice, the address bar will execute JavaScript on the current page loaded in the browser using the Document Object Model (DOM). Additionally, the address bar will allow multiple lines to be executed sequentially even though all of the code is contained within one line due to the fact that the JavaScript interpreter uses the “;” to indicate where a line of ends and a new one begins. After doing a little more research on the topic of JavaScript Browser Hacks I found a few other cool JavaScript hacks which I will list below. Example 4: Make any webpage editableSource: http://www.openjason.com/2008/09/02/browser-hack-make-any-web-page-editable/ javascript:document.body.contentEditable='true'; document.designMode='on'; void 0; Example 5: CHINESE DRAGON DANCING Source: http://nzeyi.wordpress.com/2009/06/01/dwrajaxjavascript-hacks-the-secrets-of-javascript-in-the-adress-bar/ javascript:R=0;x1=0.1;y1=0.05;x2=0.25;y2=0.24;x3=1.6; y3=0.24;x4=300;y4=200;x5=300;y5=200;DI=document.links; DIL=DI.length;A=function(){for(i=0;i-DIL;i++){DI[i].style. position='absolute';DI[i].style.left=Math.sin(R*x1+i*x2+x3)*x4+ x5;DI[i].style.top=Math.cos(R*y1+i*y2+y3)*y4+y5}R++;}; setInterval('A()',5);void(0); Example 6: Reveal content stored in password protected fields javascript:(function(){var s,F,j,f,i; s = “”; F = document.forms; for(j=0; j Example 7: Force user to close browser windowSource: http://forums.digitalpoint.com/showthread.php?t=767053 javascript:while(1){alert('Restart your brower to close this box!')} Learn more about JavaScript Browser Hacks.

    Read the article

< Previous Page | 45 46 47 48 49 50 51 52 53 54 55 56  | Next Page >