Search Results

Search found 19606 results on 785 pages for 'the thing'.

Page 494/785 | < Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501  | Next Page >

• Java Wicket - Calling javascript ( JQuery ) before AJAX

  - by user1428051

  I got this thing i'm trying to solve: I got a ListView created using Wicket ( 1.5 ) with a lot of elements and a scroll. When new items are available, the user is asked if he would like to refresh the list via a message backed by an AjaxLink: public void onClick(AjaxRequestTarget ajaxTarget) { /* do something ... */ ajaxTarget.addComponent(_list); } So on click the list gets reloaded and the scroll position is reset to zero. Is there any way i can call JavaScript before the list reloads the save the scroll position? (I know how to get/save the scroll position ( .scrollTop() ) , i just don't know how to call a function right before AJAX ).

  Read the article

• Submit multiple forms as one

  - by Stephen Sarcsam Kamenar

  I have two forms on the page. To the user it looks like 1 form, and I actually wish it was one form. But the way I'm trying to reuse code and include things, I can't avoid two forms in the source code... trying to act as one. I don't want to do ajax submit, I want a normal post submit, my form handler has redirects in it. How can I submit both of these, and get values that make sense on the server side. something like $_POST['form1]['whatever'] $_POST['form2]['thing'] Maybe take all the inputs from form 2, rename all of them with a prefix, and append them to form 1? I can't find a non-messy way of doing this. I don't think I need code, just a plan. Least messy idea wins.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Making a Png Image transparent in older versions of Internet Explorer...

  - by GUNNOO

  Hello People i have a problem with the png formatted images, i used some PNG images in my mock. when i view the mock in I.E the background of the images are not transparent. i got one solution for making it trasparent in "I.E" from the previous POSTS in the Forum. But my Problem is, i want that image to be tiled horizantlly...using that Filter thing. can any one solve this plz....plz.... i need a solution for making a png in I.E and at the same time it shud be tiled horizontally.

  Read the article

• Need Regex for to match special situations

  - by Daniel

  I'm desperately searching for regular expressions that match these scenarios: 1) Match alternating chars I've a string like "This is my foobababababaf string" - and I want to match "babababa" Only thing I know is the length of the fragment to search - I don't know what chars/digits that might be - but they are alternating. I've really no clue where to start :( 2) Match combined groups In a string like "This is my foobaafoobaaaooo string" - and I want to match "aaaooo". Like in 1) I don't know what chars/digits that might be. I only know that they will appear in two groups. I experimented using (.)\1\1\1(.)\1\1\1 and things like this...

  Read the article

• Loading Nested JS Files on the Page

  - by Aidin

  Hi, I have a JS file that is dependent to another Js file. this Js file is something like this (Common.js) //Some codes here window.onload = PageLoad; //some codes here and then I implement PageLoad function in another Js file. ( I do this because every page has its own PageLoad implementation) and I Load these files like this on my Main.aspx : `<asp:Content ID="Content1" ContentPlaceHolderID="ContentPlaceHolder1" Runat="Server">` `<\script language="javascript" type="text/javascript" src="PagesJS/pgeMain.js"></script>` `<\script language="javascript" type="text/javascript" src="JS/Common.js"></script>` ... ... `</asp:Content>` Every thing works fine on local but when I deploy it, sometimes I get PageLoad undefined Error! Can any one tells me what is wrong with this? Thanks. Aidin

  Read the article

• jUnit same exception in different cases

  - by coubeatczech

  Hi, I'm writing a jUnit test for a constructor that parses a String and then check numerous things. When there's wrong data, for every thing, some IllegalArgumentException with different message is thrown. So I would like to write tests for it, but how can i recognize what error was thrown? This is how can I do it: @Test(expected=IllegalArgumentException.class) public void testRodneCisloRok(){ new RodneCislo("891415",dopocitej("891415")); } and this is how I would like to be, but I don't know if it is possible to write it somehow: @Test(expected=IllegalArgumentException.class("error1")) public void testRodneCisloRok(){ new RodneCislo("891415",dopocitej("891415")); }

  Read the article

• Constructor initialising an array of subobjects?

  - by ojw

  Say I have several objects within a class, each of which needs constructing with a different value. I can write something like this: class b { public: b(int num) { // 1 for a.b1, and 2 for a.b2 } }; class a { public: b b1; b b2; a() : b1(1), b2(2) { } }; However, is it possible to do the same thing if those multiple objects are stored in an array? My first attempt at it doesn't compile: class a { public: b bb[2]; a() : bb[0](1), bb[1](2) { } };

  Read the article

• How to set up Node server for production on own machine?

  - by Matt Hintzke

  This must be a pretty basic thing to do, but I cannot find any good guide on how to do it on the internet. I only find how to set up a development environment for Node. I want to be able to forward my R-Pi's port 80 to my Node server, which I want to obviously listen on port 80. How can I close the native port 80 so that I can let me Node server listen on that port. Ultimately, I want to be able to access my pi from any remote location. I know how to set up a static IP and forward the port on my router, but now how do I allow Node into port 80?

  Read the article

• how to make PHP lists all Linux Users?

  - by Data-Base

  Hello I want to build a php based site that (automate) some commands on my Ubuntu Server first thing I did was going to the file (sudoers) and add the user www-data so I can execute php commands with root privileges! # running the web apps with root power!!! www-data ALL=(ALL) NOPASSWD: ALL then my PHP code was <?php $command = "cat /etc/passwd | cut -d\":\" -f1"; echo 'running the command: <b>'.$command."</b><br />"; echo exec($command); ?> it returns only one user (the last user) !!! how to make it return all users? thank you

  Read the article

• What is the best way to deal with address inputs that can be from multiple countries?

  - by Andrew.S

  Most of my websites in the past have been rather limited to the United States when it came to displaying addresses. On a project I'm working on right now, however, users can add events from all over the world. My problem is how to go about dealing with the different way in which addresses are displayed across the world. For example, City/State/Zip is just a US thing. I was figuring I would alter the inputs displayed based on the country selected but I have no idea how I'm supposed to know the way every single country does addresses. Ideas?

  Read the article

• out-of-the-box way to get an idmap from hibernate for a given entity?

  - by Geert-Jan

  Over and over again I notive myself getting a list from hibernate, and the first thing next is put it in an idmap like: List<House> entities = s.createCriteria(House.class).list(); Map<String,House> entitymap = new HashMap<String,House>(); for(TA_entity e:entities){ entitymap.put(e.getId(), e); } Is there a way to get this directly out of hibenerate? afterall Hibernate is familiar with the id.

  Read the article

• Knowledge mining using Hadoop.

  - by Anurag

  Hello there, I want to do a project Hadoop and map reduce and present it as my graduation project. To this, I've given some thought,searched over the internet and came up with the idea of implementing some basic knowledge mining algorithms say on a social websites like Facebook or may stckoverflow, Quora etc and draw some statistical graphs, comparisons frequency distributions and other sort of important values.For searching purpose would it be wise to use Apache Solr ? I want know If such thing is feasible using the above mentioned tools, if so how should I build up on this little idea? Where can I learn about knowledge mining algorithms which are easy to implement using java and map reduce techniques? In case this is a wrong idea please suggest what else can otherwise be done on using Hadoop and other related sub-projects? Thank you

  Read the article

• How do customize the g:sortableColumn?

  - by kakaotalk

  Well, I have one column in my list that I need to customize, the thing is grails' own g:sortable doesn't work. For instance, my first column shows employee ids, then my second column, shows the employees full name where full name is a combination of first name and last name. I got it to work, sorting and all, but when I try to place it in a table with g:sortable, the g:sortable just wouldn't work. I'm thinking about passing params around but it's a bit tricky. Any suggestions? I've looked around the internet, and seems like nothing. :\

  Read the article

• Magento: Product List Override

  - by Andrea

  Thanks for taking a look at this. I’ve been looking and looking for a solution to what seems like a simple thing to do but nothing yet. Here goes: When you click on "Specialty" in the main menu it goes here: Home /Specialty When you click one of the product images on the home page it goes here: Home /Specialty /Holiday Satin Stocking (Full product description page) I need all products with full product information to end up at Home /Specialty Page set-up would be: Click on Menu item or an image to show like this: |||Product1||| Product Description Add to cart |||Product2||| Product Description Add to cart |||Product3||| Product Description Add to cart I would like to override going "Home /Specialty /Holiday Satin Stocking" all together with listing all the information here: Home /Specialty "Specialty" is set up as an anchor and all products types are simple. Thanks so much!

  Read the article

• formatting and converting in java

  - by mike_hornbeck

  I have few small basic problems : How to format : int i = 456; to give output : ""00000456" ? I've tried %08d but it's not working. Next thing is a problem with conversion and then formatting. I have side and height of triangle, let's say int's 4,7, and 7 is the height. From formula for field we know that F=1/2(a*h). So how to get F as float, with precision up to 10 places ? float f = a*h; works fine, but multiplying it by 0.5 gives error and by 1/2 returns 0.

  Read the article

• how i insert values from list of Data Grid View,current time ,EmployeeID using button click event (C

  - by Six fourty

  hi, it show me this error Incorrect syntax near the keyword 'Select' to make to clear Employee ID in this case is FK in the table (Attendance detail) and the other thing is i am using Data Grid View from another table(Employee information) to Show the list of the staff in my form. then i want to transfer each selected cell value from Data Grid View to attendance detail table. 10q private void time_in_Click(object sender, EventArgs e) { employee_InformationDataGridView.SelectedCells[0].Style.ForeColor = Color.Green; time_in.Enabled = false; time_out.Enabled = true; con = new SqlConnection(GlobalClass.conn); con.Open(); SqlCommand cmd = new SqlCommand("Insert into Attendancedetail Values(" + "Select from EmployeeInformation(EmployeeID)" + ",'" + employee_InformationDataGridView.SelectedCells[0] + "','" + DateTime.Now.ToLongDateString() + "','" + null + "','" + null + "','" + DateTime.Now.ToLongTimeString() + "'," + null + ")", con); int i = cmd.ExecuteNonQuery(); MessageBox.Show(i.ToString() + " record inserted"); }

  Read the article

• Intent resolution in Android

  - by Saksham

  Hello community, If I want to create custom address book (which overrides my phone's default address book), and if I want it to be used by all applications, what should be my intent filter? Does Android allow me to do such a thing considering the fact that such a third-party app could potentially be malicious?! And, if I want to have yet another address book application, I suppose the second app also has same intent-filter, isn't it? How does the framework decide which app to pick if I click on Contacts button when making a call? In other words, how does the framework resolve intents in case there is a conflict between multiple intent-filters? I'm new to android, so please excuse me if this question is stupid. I would like to get some feedback in any case! Thanks in advance, Saksham

  Read the article

• Call OnDraw in another method, then "refresh" that call in ANOTHER method.

  - by Aidan

  Hey guys, Hopefully this will actually make sense and sorry if its a stupid / obvious question. Basically I'm calling the onDraw method like so... requestWindowFeature(Window.FEATURE_NO_TITLE); Preview mPreview = new Preview(this); DrawOnTop mDraw = new DrawOnTop(this); setContentView(mPreview); addContentView(mDraw, new LayoutParams (LayoutParams.WRAP_CONTENT, LayoutParams.WRAP_CONTENT)); You see I'm drawing it on top of a Camera view and the information being drawn is subject to change. I have a listener setup which will update the variables being drawn at the appropriate time but I now want to "refresh" this draw in that listener. How would I do such a thing?

  Read the article

• How to use the sum the value of 2 totals in different table (Reporting Services)?

  - by dewacorp.alliances

  Hi there In report design, I have 2 tables (Current and Proposed) the structure like this: Current Parameter | Value | Rate | Total Value ... Proposed Parameter | Value | Rate | Total Value ... Each bottom of the table (Table Footer), I have something called: "Total: " which is a sum of Total field. I called these textboxes are txtbxCurrent and txtbxProposed and the format is in currency already. This thing is running well. But now I need to get a total of these txtbxCurrent and txtbxProposed. How do I do this? Can I take the value of this or not? BTW .. I am using Ms SQL Server 2005 (ReportViewer - client) Also here my dataset looks like: RecID | Type | Parameter | Value | Rate | Total 1, CURRENT, 'Param1', 100, 0.1, 10 1, CURRENT, 'Param2', 200, 0.2, 10 1, PROPOSED, 'Param1', 100, 0.2, 20 1, PROPOSED, 'Param2', 200, 0.2, 20 Thanks

  Read the article

• Return the difference between the lowest and highest key

  - by stan

  This is a past exam paper i am attempting and have no way to check if the out put is correct as i am not capable of building one of these things the question is in the title class Tree{ Tree left; Tree right; int key; public static int span(Tree tree) { if ( tree == null ){ return null; } if( tree.left != null) int min = span(tree.left); } if( tree.right != null){ int max = span(tree.right); } return max - min; } } Could anyone suggest what i need to change to get 5/5 marks :D - the only thing we have to do is write the span method, the header was given for us Thanks

  Read the article

• hook to save action in eclipse plugin

  - by 4485670

  I want to create a Google Closure Compiler plugin for eclipse. I already have a popup menu entry to compile a Javascript file to its minified version. But it would be more than helpful if every time you save a *.js that minified version would be generated automatically. I read/heard about natures and builders, extension points and IResourceChangeListener. But I did not manage to figure out what I should use and especially how to get it to work. Is there a working example of a plugin that does "the same kind of thing" so I can work from that or a tutorial to write such? With the answer below I searched for projects that use the IResourceChangeListener and came up with this code: manifest: http://codepaste.net/3yahwe plugin.xml: http://codepaste.net/qek3rw activator: http://codepaste.net/s7xowm DummyStartup: http://codepaste.net/rkub82 MinifiedJavascriptUpdater: http://codepaste.net/koweuh There in the MinifiedJavascriptUpdater.java which holds the code for the IResourceChangeListener the "resourceChanged" function is never reached.

  Read the article

• absolutely positioned divs that don't move when page is scrolled...

  - by Kyle

  I've done this in the past using a method similar to this: http://javascriptkit.com/javatutors/static3.shtml but I don't like the "flicker" effect as the page is scrolled and the div needs to move with the scrolling. Lately I've seen a lot of site that have an element (a div or the like I presume) that don't move when the page is scrolled but it's seemless...they're just there and it's a beautiful thing. Unfortunately I can't seem to recall where I've seen it lately to view the source and try to figure it out so I figured I'd turn here and see what all of you experts can provide as far as assistance / suggestions. TIA

  Read the article

• JDBC Pagination

  - by Zeeshan

  Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

  Read the article

• Using php to create a password system with chinese characters

  - by WillDonohoe

  Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

  Read the article

< Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501  | Next Page >