Search Results

Search found 34110 results on 1365 pages for 'gdata python client'.

Page 495/1365 | < Previous Page | 491 492 493 494 495 496 497 498 499 500 501 502  | Next Page >

  • asyncore callbacks launching threads... ok to do?

    - by sbartell
    I'm unfamiliar with asyncore, and have very limited knowledge of asynchronous programming except for a few intro to twisted tutorials. I am most familiar with threads and use them in all my apps. One particular app uses a couchdb database as its interface. This involves longpolling the db looking for changes and updates. The module I use for couchdb is couchdbkit. It uses an asyncore loop to watch for these changes and send them to a callback. So, I figure from this callback is where I launch my worker threads. It seems a bit crude to mix asynchronous and threaded programming. I really like couchdbkit, but would rather not introduce issues into my program. So, my question is, is it safe to fire threads from an async callback? Here's some code... {{{ def dispatch(change): global jobs, db_url # jobs is my queue db = Database(db_url) work_order = db.get(change['id']) # change is an id to the document that changed. # i need to get the actual document (workorder) worker = Worker(work_order, db) # fire the thread jobs.append[worker] worker.start() return main() . . . consumer.wait(cb=dispatch, since=update_seq, timeout=10000) #wait constains the asyncloop. }}}

    Read the article

  • Preserving the dimensions of a slice from a Numpy 3d array

    - by Brendan
    I have a 3d array, a, of shape say a.shape = (10, 10, 10) When slicing, the dimensions are squeezed automatically i.e. a[:,:,5].shape = (10, 10) I'd like to preserve the number of dimensions but also ensure that the dimension that was squeezed is the one that shows 1 i.e. a[:,:,5].shape = (10, 10, 1) I have thought of re-casting the array and passing ndmin but that just adds the extra dimensions to the start of the shape tuple regardless of where the slice came from in the array a.

    Read the article

  • How to save one role implementing a client/server pattern in Azure?

    - by Alfredo Delsors
    Sometimes you need to have an instance performing a server role when other instances are playing the client role. An example can be a file sharing like in this great post: http://blogs.msdn.com/b/mariok/archive/2011/02/11/sharing-folders-in-azure.aspx, one instance shares a folder that all other instances are using to write files that the server processes. The problem is that there is not discovering mechanism in Azure that allows one instance to know where the instance acting as a server is located. A first approach can be having a server role and a client role like in the previous post. This means more instances, more money. A solution to save this "server" role is to use Instance 0, always available, to act as a server. An instance can know that it should act as the server checking RoleEnvironment.CurrentRoleInstance.Id.EndsWith(".0"). Other instances can iterate the RoleEnvironment Instances collection to find the instance whose name ends with ".0", getting its endpoints and acting as its clients.

    Read the article

  • How small is *too small* for an opensource project?

    - by Adam Lewis
    I have a fair number of smaller projects / libraries that I have been using over the past 2 years. I am thinking about moving them to Google Code to make it easier to share with co-workers and easier to import them into new projects on my own environments. The are things like a simple FSMs, CAN (Controller Area Network) drivers, and GPIB drivers. Most of them are small (less than 500 lines), so it makes me wonder are these types of things too small for a stand alone open-source project? Note that I would like to make it opensource because it does not give me, or my company, any real advantage.

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • etree.findall: 'OR'-lookup?

    - by piquadrat
    I want to find all stylesheet definitions in a XHTML file with lxml.etree.findall. This could be as simple as elems = tree.findall('link[@rel="stylesheet"]') + tree.findall('style') But the problem with CSS style definitions is that the order matters, e.g. <link rel="stylesheet" type="text/css" href="/media/css/first.css" /> <style>body:{font-size: 10px;}</style> <link rel="stylesheet" type="text/css" href="/media/css/second.css" /> if the contents of the style tag is applied after the rules in the two link tags, the result may be completely different from the one where the rules are applied in order of definition. So, how would I do a lookup that inlcudes both link[@rel="stylesheet"] and style?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • How to build a Django form which requires a delay to be re-submitted ?

    - by pierre-guillaume-degans
    Hey, In order to avoid spamming, I would like to add a waiting time to re-submit a form (i.e. the user should wait a few seconds to submit the form, except the first time that this form is submitted). To do that, I added a timestamp to my form (and a security_hash field containing the timestamp plus the settings.SECRET_KEY which ensures that the timestamp is not fiddled with). This look like: class MyForm(forms.Form): timestamp = forms.IntegerField(widget=forms.HiddenInput) security_hash = forms.CharField(min_length=40, max_length=40, widget=forms.HiddenInput) # + some other fields.. # + methods to build the hash and to clean the timestamp... # (it is based on django.contrib.comments.forms.CommentSecurityForm) def clean_timestamp(self): """Make sure the delay is over (5 seconds).""" ts = self.cleaned_data["timestamp"] if not time.time() - ts > 5: raise forms.ValidationError("Timestamp check failed") return ts # etc... This works fine. However there is still an issue: the timestamp is checked the first time the form is submitted by the user, and I need to avoid this. Any idea to fix it ? Thank you ! :-)

    Read the article

  • Attribute Error in django

    - by itsandy
    Hi all, I am having an attribute error while working with django-registration it says 'NoneType' object has no attribute 'strip' I dropped my db table and created again but the error doesnt go..can anyone help..

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • Django: Geocoding an address on form submission?

    - by User
    Trying to wrap my head around django forms and the django way of doing things. I want to create a basic web form that allows a user to input an address and have that address geocoded and saved to a database. I created a Location model: class Location(models.Model): address = models.CharField(max_length=200) city = models.CharField(max_length=100) state = models.CharField(max_length=100, null=True) postal_code = models.CharField(max_length=100, null=True) country = models.CharField(max_length=100) latitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) longitude = models.DecimalField(max_digits=18, decimal_places=10, null=True) And defined a form: class LocationForm(forms.ModelForm): class Meta: model = models.Location exclude = ('latitude','longitude') In my view I'm using form.save() to save the form. This works and saves an address to the database. I created a module to geocode an address. I'm not sure what the django way of doing things is, but I guess in my view, before I save the form, I need to geocode the address and set the lat and long. How do I set the latitude and longitude before saving?

    Read the article

  • Web2py controllers with parameters?

    - by nickfranceschina
    I am building an app using Web2py framework... I don't want to have to use the request object to get all of the querystring parameters, instead I'd like to build my controller with named parameters and have the router unpack the querystring (or form data) dictionary into the named parameters and call my controller. so instead of a controller method of create_user(): where I would use the global request() object and look through the vars list... I would prefer instead to have create_user(first_name, last_name, email): like I see in other MVC platforms. is this possible in Web2py already? or is there a plugin for it? or do I need to add that myself?

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • basic unique ModelForm field for Google App Engine

    - by Alexander Vasiljev
    I do not care about concurrency issues. It is relatively easy to build unique form field: from django import forms class UniqueUserEmailField(forms.CharField): def clean(self, value): self.check_uniqueness(super(UniqueUserEmailField, self).clean(value)) def check_uniqueness(self, value): same_user = users.User.all().filter('email', value).get() if same_user: raise forms.ValidationError('%s already_registered' % value) so one could add users on-the-fly. Editing existing user is tricky. This field would not allow to save user having other user email. At the same time it would not allow to save a user with the same email. What code do you use to put a field with uniqueness check into ModelForm?

    Read the article

< Previous Page | 491 492 493 494 495 496 497 498 499 500 501 502  | Next Page >