Search Results

Search found 34110 results on 1365 pages for 'gdata python client'.

Page 501/1365 | < Previous Page | 497 498 499 500 501 502 503 504 505 506 507 508  | Next Page >

  • How can I load a sql "dump" file into sql alchemy

    - by JudoWill
    I have a large sql dump file ... with multiple CREATE TABLE and INSERT INTO statements. Is there any way to load these all into a SQLAlchemy sqlite database at once. I plan to use the introspected ORM from sqlsoup after I've created the tables. However, when I use the engine.execute() method it complains: sqlite3.Warning: You can only execute one statement at a time. Is there a way to work around this issue. Perhaps splitting the file with a regexp or some kind of parser, but I don't know enough SQL to get all of the cases for the regexp. Any help would be greatly appreciated. Will EDIT: Since this seems important ... The dump file was created with a MySQL database and so it has quite a few commands/syntax that sqlite3 does not understand correctly.

    Read the article

  • Encoding with url and api

    - by user2950824
    So I have this web app set up and running and it works fine for any username that you request, but when i try http://mrcastelo.pythonanywhere.com/lol/euw/Nazaré, it simply doesnt work - the error that I get on the server is the following: iddata= getJSON(urllolbase+region+urlid+username) #SummonerID UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 5: ordinal not in range(128) It is annoying me greatly, I've tried some other threads but none of them came to a fix. The api that I am using (www.legendaryapi.com) does accept this because this works. Any idea on how to fix this?

    Read the article

  • When to use \A in regex?

    - by S.Mark
    End of line anchor $ match even there is extra trailing \n in matched string, so we use \Z instead of $ For example ^\w+$ will match the string abcd\n but ^\w+\Z is not How about \A and when to use?

    Read the article

  • Django choking oddly on some static media

    - by Edan Maor
    My situation: I'm serving static media via Django on my dev machine. On some files that I try and load, I get back this error: Traceback: File "c:\Program Files\Python26\Lib\site-packages\django\core\handlers\base.py" in get_response 92. response = callback(request, *callback_args, **callback_kwargs) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\views.py" in userpage 71. so_user = site.user(userid) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in user 476. u, = self.users((nid,), **kw) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in users 481. return self._get(User, ids, 'users', kw) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in _get 471. return self.build(root, typ, coll, kw) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in build 448. json = self._request(url, kw) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in _request 422. dump = json.load(data) File "c:\Program Files\Python26\lib\json\__init__.py" in load 264. return loads(fp.read(), Exception Type: AttributeError at /userpage/362498 Exception Value: 'str' object has no attribute 'read' I've traced it to specific files which don't work (by going to their specific urls). Here's the odd part: changing the filename of the files makes them suddenly work. For example, I had a file called 'post.jpg', which gave this error. I renamed it to 'pos.jpg' and it worked. Back to 'post.jpg' and it gives the same error.

    Read the article

  • How to convert string "0671" or "0x45" into integer form with 0 and 0x in the beginning.

    - by Harshit Sharma
    I wanted to make my own encryption algorithm and decryption algorithm , encryption algorithm works fine and converts ascii value of the characters into alternate hexadecimal and octal representations. But when I tried decryption, problem occured as it return int('0671') = 671, as 0671 is string type in the following code. Is there a method to convert "ox56" into integer form?????? NOTE: Following string is alternate octal and hexa of ascii value of char. ///////////////DECRYPTION/////// l="01630x7401620x6901560x67" f=len(l) k=0 d=0 x=[] for i in range(0,f,4): g=l[i:i+4] print g k=k+1 if(k%2==0): p=g print p else: p=int(g) print p

    Read the article

  • Union on ValuesQuerySet in django

    - by Wuxab
    I've been searching for a way to take the union of querysets in django. From what I read you can use query1 | query2 to take the union... This doesn't seem to work when using values() though. I'd skip using values until after taking the union but I need to use annotate to take the sum of a field and filter on it and since there's no way to do "group by" I have to use values(). The other suggestions I read were to use Q objects but I can't think of a way that would work. Do I pretty much need to just use straight SQL or is there a django way of doing this? What I want is: q1 = mymodel.objects.filter(date__lt = '2010-06-11').values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) q2 = mymodel.objects.values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) query = q1|q2 But this doesn't work and as far as I know I need the "values" part because there's no other way for Sum to know how to act since it's a 15 column table.

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • Executing a jquery effect on demand. Is it possible?

    - by Chocol8
    I was looking the Highlight effect of Jquery's. That effect is really the one i would like to add in my webpage. By looking at the the source code, i noticed that the effect will be reproduced on user's click of the div. $("div").click(function () { $(this).effect("highlight", {}, 3000); }); In my webpage i have an ImageButton <asp:ImageButton ID="btnFavorite" runat="server" ImageUrl="~/Images/Favorite.png"/> I would love to perform the highlight effect to the div, when the user clicks on the image button. Is it possible? UPDATE: If it is possible, could i use something like "OnClientClick=" of the ImageButton, since the imagebutton controls are added dynamically to the webpage?

    Read the article

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • Setting up repoze.who with make_redirecting_plugin

    - by Timmy
    my file is: [plugin:form] use = repoze.who.plugins.form:make_redirecting_plugin login_form_url = /account/signin login_handler_path = /account/login logout_handler_path = /account/logout [identifiers] plugins = form;browser auth_tkt i created a form on /account/signin, but it doesnt find the identity? what has to be on the form?

    Read the article

  • methods of metaclasses on class instances.

    - by Stefano Borini
    I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

    Read the article

  • pyramid traversal resource url no attribute __name__

    - by Santana
    So I have: resources.py: def _add(obj, name, parent): obj.__name__ = name obj.__parent__ = parent return obj class Root(object): __parent__ = __name__ = None def __init__(self, request): super(Root, self).__init__() self.request = request self.collection = request.db.post def __getitem__(self, key): if u'profile' in key: return Profile(self.request) class Profile(dict): def __init__(self, request): super(Profile, self).__init__() self.__name__ = u'profile' self.__parent__ = Root self.collection = request.db.posts def __getitem__(self, name): post = Dummy(self.collection.find_one(dict(username=name))) return _add(post, name, self) and I'm using MongoDB and pyramid_mongodb views.py: @view_config(context = Profile, renderer = 'templates/mytemplate.pt') def test_view(request): return {} and in mytemplate.pt: <p tal:repeat='item request.context'> ${item} </p> I can echo what's in the database (I'm using mongodb), but when I provided a URL for each item using resource_url() <p tal:repeat='item request.context'> <a href='${request.resource_url(item)}'>${item}</a> </p> I got an error: 'dict' object has no attribute '__name__', can someone help me?

    Read the article

  • Efficient way to store tuples in the datastore

    - by Drew Sears
    If I have a pair of floats, is it any more efficient (computationally or storage-wise) to store them as a GeoPtProperty than it would be pickle the tuple and store it as a BlobProperty? If GeoPt is doing something more clever to keep multiple values in a single property, can it be leveraged for arbitrary data? Can I store the tuple ("Johnny", 5) in a single entity property in a similarly efficient manner?

    Read the article

  • how can i set the key 'blob-key' about BlobStore?

    - by pyleaf
    I use the jquery plugin "uploadify" to upload multiple files to My App(GAE), and then save them with blobstore, but it failed. I debug the code into get_uploads, it seems field.type_options is empty and of course has 'blob-key'. Q: where does the key 'blob-key' come from? thank you!

    Read the article

  • SQLAlchemy: who is in charge of the "session"? ( and how to unit-test with sessions )

    - by Nick Perkins
    I need some guidance on how to use session objects with SQLAlchemy, and how to organize Unit Tests of my mapped objects. What I would like to able to do is something like this: thing = BigThing() # mapped object child = thing.new_child() # create and return a related object thing.save() # will also save the child object In order to achieve this, I was thinking of having the BigThing actually add itself ( and it's children ) to the database -- but maybe this not a good idea? One reason to add objects as soon as possible is Automatic id values that are assigned by the database -- the sooner they are available, the fewer problems there are ( right? ) What is the best way to manage session objects? Who is in charge of the session? Should it be created only when required? or saved for a long time? What about Unit Tests for my mapped objects?...how should the session be handled? Is it ever OK to have mapped objects just automatically add themselves to a database? or is that going to lead to trouble?

    Read the article

  • Estimating the boundary of arbitrarily distributed data

    - by Dave
    I have two dimensional discrete spatial data. I would like to make an approximation of the spatial boundaries of this data so that I can produce a plot with another dataset on top of it. Ideally, this would be an ordered set of (x,y) points that matplotlib can plot with the plt.Polygon() patch. My initial attempt is very inelegant: I place a fine grid over the data, and where data is found in a cell, a square matplotlib patch is created of that cell. The resolution of the boundary thus depends on the sampling frequency of the grid. Here is an example, where the grey region are the cells containing data, black where no data exists. OK, problem solved - why am I still here? Well.... I'd like a more "elegant" solution, or at least one that is faster (ie. I don't want to get on with "real" work, I'd like to have some fun with this!). The best way I can think of is a ray-tracing approach - eg: from xmin to xmax, at y=ymin, check if data boundary crossed in intervals dx y=ymin+dy, do 1 do 1-2, but now sample in y An alternative is defining a centre, and sampling in r-theta space - ie radial spokes in dtheta increments. Both would produce a set of (x,y) points, but then how do I order/link neighbouring points them to create the boundary? A nearest neighbour approach is not appropriate as, for example (to borrow from Geography), an isthmus (think of Panama connecting N&S America) could then close off and isolate regions. This also might not deal very well with the holes seen in the data, which I would like to represent as a different plt.Polygon. The solution perhaps comes from solving an area maximisation problem. For a set of points defining the data limits, what is the maximum contiguous area contained within those points To form the enclosed area, what are the neighbouring points for the nth point? How will the holes be treated in this scheme - is this erring into topology now? Apologies, much of this is me thinking out loud. I'd be grateful for some hints, suggestions or solutions. I suspect this is an oft-studied problem with many solution techniques, but I'm looking for something simple to code and quick to run... I guess everyone is, really! Cheers, David

    Read the article

  • Iterate with binary structure over numpy array to get cell sums

    - by Curlew
    In the package scipy there is the function to define a binary structure (such as a taxicab (2,1) or a chessboard (2,2)). import numpy from scipy import ndimage a = numpy.zeros((6,6), dtype=numpy.int) a[1:5, 1:5] = 1;a[3,3] = 0 ; a[2,2] = 2 s = ndimage.generate_binary_structure(2,2) # Binary structure #.... Calculate Sum of result_array = numpy.zeros_like(a) What i want is to iterate over all cells of this array with the given structure s. Then i want to append a function to the current cell value indexed in a empty array (example function sum), which uses the values of all cells in the binary structure. For example: array([[0, 0, 0, 0, 0, 0], [0, 1, 1, 1, 1, 0], [0, 1, 2, 1, 1, 0], [0, 1, 1, 0, 1, 0], [0, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 0]]) # The array a. The value in cell 1,2 is currently one. Given the structure s and an example function such as sum the value in the resulting array (result_array) becomes 7 (or 6 if the current cell value is excluded). Someone got an idea?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Validating key/certificate pairs with M2Crypto when a certificate chain is needed

    - by Charles Duffy
    M2Crypto.X509.X509 objects have a verify(pkey) method, which provide a means of testing that a given certificate does in fact sign a specified key. This is a good and useful thing -- except that sometimes the certificate I want to verify in this way is invalid without the use of an intermediate certificate, which this API does not appear to allow a way to specify. Is there an alternate means of validating a certificate / private key pair which will work even when the certificate is unable to stand alone?

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

< Previous Page | 497 498 499 500 501 502 503 504 505 506 507 508  | Next Page >