Search Results

Search found 14037 results on 562 pages for 'alter index'.

Page 496/562 | < Previous Page | 492 493 494 495 496 497 498 499 500 501 502 503  | Next Page >

• How to DRY on CRUD parts of my Rails app?

  - by kolrie

  I am writing an app which - similarly to many apps out there - is 90% regular CRUD things and 10% "juice", where we need nasty business logic and more flexibility and customization. Regarding this 90%, I was trying to stick to the DRY principle as much as I can. As long as controllers go, I have found resource_controller to really work, and I could get rid of all the controllers on that area, replacing them with a generic one. Now I'd like to know how to get the same with the views. On this app I have an overall, application.html.erb layout and then I must have another layout layer, common for all CRUD views and finally a "core" part: On index.html.erb all I need to generate a simple table with the fields and labels I indicate. For new and edit, also generic form edition, indicating labels and fields (with a possibility of providing custom fields if needed). I am not sure I will need show, but if I do it would be the same as new and edit. What plugins and tools (or even articles and general pointer) would help me to get that done? Thanks, Felipe.

  Read the article

• Getting unhandled error and connection get lost when a client tries to communicate with chat server in twisted

  - by user2433888

  from twisted.internet.protocol import Protocol,Factory from twisted.internet import reactor class ChatServer(Protocol): def connectionMade(self): print "A Client Has Connected" self.factory.clients.append(self) print"clients are ",self.factory.clients self.transport.write('Hello,Welcome to the telnet chat to sign in type aim:YOUR NAME HERE to send a messsage type msg:YOURMESSAGE '+'\n') def connectionLost(self,reason): self.factory.clients.remove(self) self.transport.write('Somebody was disconnected from the server') def dataReceived(self,data): #print "data is",data a = data.split(':') if len(a) > 1: command = a[0] content = a[1] msg="" if command =="iam": self.name + "has joined" elif command == "msg": ma=sg = self.name + ":" +content print msg for c in self.factory.clients: c.message(msg) def message(self,message): self.transport.write(message + '\n') factory = Factory() factory.protocol = ChatServer factory.clients = [] reactor.listenTCP(80,factory) print "Iphone Chat server started" reactor.run() The above code is running succesfully...but when i connect the client (by typing telnet localhost 80) to this chatserver and try to write message ,connection gets lost and following errors occurs : Iphone Chat server started A Client Has Connected clients are [<__main__.ChatServer instance at 0x024AC0A8>] Unhandled Error Traceback (most recent call last): File "C:\Python27\lib\site-packages\twisted\python\log.py", line 84, in callWithLogger return callWithContext({"system": lp}, func, *args, **kw) File "C:\Python27\lib\site-packages\twisted\python\log.py", line 69, in callWithContext return context.call({ILogContext: newCtx}, func, *args, **kw) File "C:\Python27\lib\site-packages\twisted\python\context.py", line 118, in callWithContext return self.currentContext().callWithContext(ctx, func, *args, **kw) File "C:\Python27\lib\site-packages\twisted\python\context.py", line 81, in callWithContext return func(*args,**kw) --- --- File "C:\Python27\lib\site-packages\twisted\internet\selectreactor.py", line 150, in _doReadOrWrite why = getattr(selectable, method)() File "C:\Python27\lib\site-packages\twisted\internet\tcp.py", line 199, in doRead rval = self.protocol.dataReceived(data) File "D:\chatserverultimate.py", line 21, in dataReceived content = a[1] exceptions.IndexError: list index out of range Where am I going wrong?

  Read the article

• ASP.NET MVC (VB) error when publishing to test server

  - by Colin

  I have an ASP.NET MVC project that works fine on my local machine (no build errors, server errors or anything). However, when I publish the project to a test server, I get an "Object reference not set to an instance of an object" error on a For Each I have in my view. I have a function within a model that returns a DataRowCollection. I'm calling that function in my controller and passing the DataRowCollection to my View, which then iterates over the rows and displays the necessary information: In the Controller I have: Function Index() As ActionResult Dim MyModel As New Model ViewData("MyDataRowCollection") = MyModel.GetDataRowCollection() Return View() End Function And then in the View, which is throwing the error: <%@ Page Language="VB" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage" %> <asp:Content ID="indexTitle" ContentPlaceHolderID="TitleContent" runat="server"> My Page Title </asp:Content> <asp:Content ID="indexContent" ContentPlaceHolderID="MainContent" runat="server"> <% For Each MyDataRow In ViewData("MyDataRowCollection") ' do stuff with each MyDataRow Next %> I'm pretty new to ASP.NET MVC so I'm sure there might be a better way to do what I'm doing (I'd be happy to hear if there is), but my main concern is why this works fine on my local machine but throws an error on the For Each on the test server? Please let me know if I can clarify any of the above, and thanks in advance for any information.

  Read the article

• ASP.NET MVC - hiding id in URL?

  - by mcfroob

  I'm building a basic blog application just now, for viewing data I'm just using the default route, i.e. - routes.MapRoute ( "Default", // Route name "{controller}/{action}/{id}", new { controller = "Blog", action = "Index", id = UrlParameter.Optional } ); So that when you go to mysite.com/View/12 it displays the blog with id 12. I want to modify the URLs so that they look as follows: mysite.com/View/2010/06/01/this-is-the-title. I could have a URL mapping like - routes.MapRoute( "View", "View/{year}/{month}/{day}/{title}", new { controller = "Blog", action = "View" } ); But then I'm not passing the ID into the Controller action so I would have to search on the date and title which doesn't feel right. On the other hand, if I pass the ID in it will show up in the URL which isn't what I'm aiming for either. Is there any way to redirect to the URL I want in the controller action after passing only the ID in as a paramter, or to pass the ID into the a Map Route but hide it in the URL? Thanks for your help!

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• how to redirect user depending on user type at time of login (codeignitor)

  - by Anam Tahir

  im facing problem while redirecting my user according to its type. how can do it here's my code plz suggest how to do it. <?php if ( ! defined('BASEPATH')) exit('No direct script access allowed'); class VerifyLogin extends CI_Controller { function __construct() { parent::__construct(); } function index() { $this->load->model('user','',TRUE); //This method will have the credentials validation $this->load->library('form_validation'); $this->load->library('session'); $this->form_validation->set_rules('username', 'Username','trim|required|xss_clean'); $this->form_validation->set_rules('password', 'Password' 'trim|required|xss_clean|callback_check_database'); if($this->form_validation->run() == FALSE) { //Field validation failed.&nbsp; User redirected to login page validation_errors(); $this->load->view('error'); } else { //Go to private area basically here i want to redirect if user is admin then redirect to admin page else redirect to home how can i do this ??? redirect('home', 'refresh'); } } function check_database($password) { //Field validation succeeded.&nbsp; Validate against database $username = $this->input->post('username'); //query the database $result = $this->user->login($username, $password); if($result) { $sess_array = array(); foreach($result as $row) { $sess_array = array( 'id' => $row->id, 'username' => $row->username ); $this->session->set_userdata('logged_in', $sess_array); } return TRUE; } else { $this->form_validation->set_message('check_database', 'Invalid username or password'); return false; } } } ?>

  Read the article

• asp.net mvc 2 - return JavaScript with View

  - by Tomaszewski

  Hi, using ASP.NET MVC 2 I have a navigation menu inside my Master Page. In the navigation menu, I am trying add a class to the that the current page relates to (i.e., home page will add class="active" to the Home button). I'm trying to consider scalability and the fact that I don't want to change individual pages if the navigation changes later. The only way I can think of doing this is: Add JavaScript to each individual View that will add the class when the DOM is ready Return JavaScript when return View() occurs on point (2), I am unsure how to do. Thusfar I have been doing the following in my controller: public ActionResult Index() { ViewData["messege"] = JavaScript("<script type='text/javascript' language='javascript'> $(document).ready(function () { console.log('hi hi hi'); }); </script>"); return View(); } but in my view, when I call: <%: ViewData["messege"] %> I get: System.Web.Mvc.JavaScriptResult as the result Would you guys have any ideas on How to solve the navigation menu probelem, other than the solutions I've listed return JavaScript along with your view from the Controller Thanks, in advanced!

  Read the article

• Recursive code Sorting in VB

  - by Peter

  Ages old question: You have 2 hypothetical eggs, and a 100 story building to drop them from. The goal is to have the least number of guaranteed drops that will ensure you can find what floor the eggs break from the fall. You can only break 2 eggs. Using a 14 drop minimum method, I need help writing code that will allow me to calculate the following: Start with first drop attempt on 14th floor. If egg breaks then drop floors 1-13 to find the floor that causes break. ElseIf egg does not break then move up 13 floors to floor number 27 and drop again. If egg breaks then drop floors 15-26 starting on 15 working up to find the floor egg breaks on. ElseIf egg does not break then move up 12 floors to floor number 39 and drop again. etc. etc. The way this increases is as follows 14+13+12+11+10+9+8+7+6+5+4+3+2+1 So always adding to the previous value, by one less. I have never written a sorting algorithm before, and was curious how I might go about setting this up in a much more efficient way than a mile long of if then statements. My original idea was to store values for the floors in an array, and pull from that, using the index to move up or down and subtract or add to the variables. The most elegant solution would be a recursive function that handled this for any selected floor, 1-100, and ran the math, with an output that shows how many drops were needed in order to find that floor. Maximum is always 14, but some can be done in less.

  Read the article

• Have something loaded only when JList item is visibile

  - by elvencode

  Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

  Read the article

• Is a control's OnInit called even when attaching it during parent's OnPreRender?

  - by Xerion

  My original understanding was that the asp.net page lifecycle is run once for all pages and controls under normal circumstances. When I attached a control during a container's OnPreRender, I encountered a situation where the control's OnInit was not called. OK, I considered that a bug in my code and fixed as such, by attaching the control earlier. But just today, I encountered a situation where OnInit for a control seems to be called after the normal OnInit has been done for everyone else. See stack below. It seems that during the page's PreRender, the control's OnInit is called as it is being dynamically added. So I just want to confirm exactly what ASP.NET's behavior is? Does it actually keep track of the stage of each control's lifecycle, and upon adding a new control, it will run from the very beginning? [HttpException (0x80004005): The control collection cannot be modified during DataBind, Init, Load, PreRender or Unload phases.] System.Web.UI.ControlCollection.Add(Control child) +8678663 MyCompany.Web.Controls.SetStartPageWrapper.Initialize() MyCompany.Web.Controls.SetStartPageWrapper.OnInit(EventArgs e) System.Web.UI.Control.InitRecursive(Control namingContainer) +333 System.Web.UI.Control.InitRecursive(Control namingContainer) +210 System.Web.UI.Control.AddedControl(Control control, Int32 index) +198 System.Web.UI.ControlCollection.Add(Control child) +80 MyCompany.Web.Controls.PageHeader.OnPreRender(EventArgs e) in System.Web.UI.Control.PreRenderRecursiveInternal() +80 System.Web.UI.Control.PreRenderRecursiveInternal() +171 System.Web.UI.Control.PreRenderRecursiveInternal() +171 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +842

  Read the article

• How can I embed images within my application and use them in HTML control?

  - by Atara

  Is there any way I can embed the images within my exe (as resource?) and use it in generated HTML ? Here are the requirements: A. I want to show dynamic HTML content (e.g. using webBrowser control, VS 2008, VB .Net, winForm desktop application) B. I want to generate the HTML on-the-fly using XML and XSL (file1.xml or file2.xml transformed by my.xsl) C. The HTML may contain IMG tags (file1.gif and or file2.gif according to the xml+xsl transformation) and here comes the complicated one: D. All these files (file1.xml, file2.xml, my.xsl, file1.gif, file2.gif) should be embedded in one exe file. I guess the XML and XSL can be embedded resources, and I can read them as stream, but what ways do I have to reference the image within the HTML ? <IMG src="???" /> I do not want to use absolute path and external files. If the image files are resources, can I use relative path? Relative to what? (I can use BASE tag, and then what?) Can I use stream as in email messages? If so, where can I find the format I need to use? http://www.websiteoptimization.com/speed/tweak/inline-images/ are browser dependent. What is the browser used by webBrowser control? IE? what version? Does it matter if I use GIF or JPG or BMP (or any other image format) for the images? Does it matter if I use mshtml library and not the regular webBrowser control? (currently I use http://www.itwriting.com/htmleditor/index.php ) Does it matter if I upgrade to VS 2010 ? Thanks, Atara

  Read the article

• grails question (sample 1 of Grails To Action book) problem with Controller and Service

  - by fegloff

  Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

  Read the article

• Some sonatype nexus questions.

  - by smallufo

  I deployed a sonatype nexus server inside my LAN , mapping some remote repositories to my public repositories : First question is , why these repositories not sync with the "real" repositories ? For example , I mapped maven central (http://repo1.maven.org/maven2) to "central" , but when I browse http://smallufo:8081/nexus/content/repositories/central/org/springframework/ , the packages are not complete , in http://repo2.maven.org/maven2/org/springframework/ , there are tons of artifacts , but I only have some of them : And versions are old ... ex : spring-core is only 2.5.6.SEC01 , but the latest version is 3.0.2.RELEASE. And my maven client seems can only find the old artifacts ... "central" is a proxy directory , it should be the same with the remote server. I tried to "Expire Cache" , "ReIndex" , "Incremental ReIndex" the whole "central" : After a long time with almost 100% java process load , the situation seems not better , just add some artifacts ... not reflecting the real "Maven Central" data... Second question , what's difference with "Expire Cache" , "ReIndex" , "Incremental ReIndex" ? Even I can "search" spring-core.3.0.2.RELEASE , my m2eclipse still cannot find it : I can also see the spring-core-3.0.2.RELEASE in the "index" , (but not available in "storage") : But why m2eclipse cannot make use of it ? it seems m2eclipse can only install artifacts in the storage , if this is how nexus works , how do I "force" download spring-core-3.0.2.RELEASE to nexus's storage ? How do I solve these strange incompatibilities ? Thanks a lot !

  Read the article

• Pointing to array element

  - by regular

  What I'm trying to achieve is say i have an array, i want to be able to modify a specific array element throughout my code, by pointing at it. for example in C++ i can do this int main(){ int arr [5]= {1,2,3,4,5}; int *c = &arr[3]; cout << arr[3] <<endl; *c = 0; cout << arr[3]<<endl; } I did some googling and there seems to be a way to do it through 'unsafe', but i don't really want to go that route. I guess i could create a variable to store the indexes, but I'm actually dealing with slightly more complexity (a list within a list. so having two index variables seems to add complexity to the code.) C# has a databinding class, so what I'm currently doing is binding the array element to a textbox (that i have hidden) and modifying that textbox whenever i want to modify the specific array element, but that's also not a good solution (since i have a textbox that's not being used for its intended purpose - a bit misleading).

  Read the article

• How to handle duplicate values in d3.js

  - by Mario

  First I'm a d3.js noob :) How you can see from the title I've got a problem with duplicated data and aggregate the values is no option, because the name represent different bus stops. In this example maybe the stops are on the fron side and the back side of a building. And of course I like to show the names on the x-axis. If i created an example and the result is a bloody mess, see jsFiddel. x = index name = bus stop name n = value I've got a json e.g.: [{ "x": 0, "name": "Corniche St / Abu Dhabi Police GHQ", "n": 113 }, { "x": 1, "name": "Corniche St / Nation Towers", "n": 116 }, { "x": 2, "name": "Zayed 1st St / Al Khalidiya Public Garden", "n": 146 }, ... { "x": 49, "name": "Hamdan St / Tariq Bin Zeyad Mosque", "n": 55 }] The problem: It is possible that the name could appear more then once e.g. { "x": 1, "name": "Corniche St / Nation Towers", "n": 116 } and { "x": 4, "name": "Corniche St / Nation Towers", "n": 105 } I like to know is there a way to tell d3.js not to use distinct names and instead just show all names in sequence with their values. Any ideas or suggestions are very welcome :) If you need more information let me know. Thanks in advanced Mario

  Read the article

• div with absolute position behind the normal flow

  - by vasion

  i am trying to get a div to be my background and am using absolute positioning to achieve it. everything works fine except for the fact that it appears above anything in the normal flow and fiddling with z-indexes does absolutely nothing. <div id="blind"> <div id="blindbackground"></div> <div id="blindcontainer"><div class="loader"><img class='loader' src="/img/loader.gif"/></div></div> <div id="blindclosecontainer"><img id='blindclose' src="/img/close.gif"/></div> </div> and this is the css: #blind{ position :absolute; width:100%; z-index: 2; border-bottom: 1px silver solid; } #blindclosecontainer{ text-align: right; } #blindbackground{ position:absolute; top:0; width:100%; height:100%; background-color: white; filter:alpha(opacity=60); opacity:0.6; } #blindcontainer{ margin:auto; width:500px; background-color: white; padding:10px; } .loader{ margin: auto; width:18px; margin-top:10px; margin-bottom: 5px; }

  Read the article

• mongoose updating a field in a MongoDB not working

  - by Masiar

  I have this code var UserSchema = new Schema({ Username: {type: String, index: true}, Password: String, Email: String, Points: {type: Number, default: 0} }); [...] var User = db.model('User'); /* * Function to save the points in the user's account */ function savePoints(name, points){ if(name != "unregistered user"){ User.find({Username: name}, function(err, users){ var oldPoints = users[0].Points; var newPoints = oldPoints + points; User.update({name: name}, { $inc: {Points: newPoints}}, function(err){ if(err){ console.log("some error happened when update"); } else{ console.log("update successfull! with name = " + name); User.find({Username: name}, function(err, users) { console.log("updated : " + users[0].Points); }); } }); }); } } savePoints("Masiar", 666); I would like to update my user (by finding it with its name) by updating his/her points. I'm sure oldPoints and points contain a value, but still my user keep being at zero points. The console prints "update successful". What am I doing wrong? Sorry for the stupid / noob question. Masiar

  Read the article

• ASP.NET MVC twitter/myspace style routing

  - by Astrofaes

  Hi guys, This is my first post after being a long-time lurker - so please be gentle :-) I have a website similar to twitter, in that people can sign up and choose a 'friendly url', so on my site they would have something like: mydomain.com/benjones I also have root level static pages such as: mydomain.com/about and of course my homepage: mydomain.com/ I'm new to ASP.NET MVC 2 (in fact I just started today) and I've set up the following routes to try and achieve the above. public static void RegisterRoutes(RouteCollection routes) { routes.IgnoreRoute("{resource}.axd/{*pathInfo}"); routes.IgnoreRoute("content/{*pathInfo}"); routes.IgnoreRoute("images/{*pathInfo}"); routes.MapRoute("About", "about", new { controller = "Common", action = "About" } ); // User profile sits at root level so check for this before displaying the homepage routes.MapRoute("UserProfile", "{url}", new { controller = "User", action = "Profile", url = "" } ); routes.MapRoute("Home", "", new { controller = "Home", action = "Index", id = "" } ); } For the most part this works fine, however, my homepage is not being triggered! Essentially, when you browser to mydomain.com, it seems to trigger the User Profile route with an empty {url} parameter and so the homepage is never reached! Any ideas on how I can show the homepage?

  Read the article

• string auto splitting in each loop - jquery

  - by sluggerdog

  I have the following jquery code that is looping through the returned json data, for some reason is it splitting the suburb by a space when being assigned as the value but not as the text, I cannot work out why this is happening. MY CODE $.each(data , function( index, obj ) { $.each(obj, function( key, value ) { var suburb = $.trim(value['mcdl01']); var number = $.trim(value['mcmcu']); $("#FeedbackBranchName").append("<option value=" + suburb + ">" + suburb + " (" + number + ")</option>"); }); }); SAMPLE RETURNED RESULTS <option **value="AIRLIE" beach=""**>AIRLIE BEACH (4440)</option> <option value="ASHMORE">ASHMORE (4431)</option> <option **value="BANYO" commercial=""**>BANYO COMMERCIAL (4432)</option> <option value="BEENLEIGH">BEENLEIGH (4413)</option> <option value="BERRIMAH">BERRIMAH (4453)</option> <option **value="BOWEN" hills=""**>BOWEN HILLS (4433)</option> Notice how for AIRLEE BEACH, BANYO COMMERICAL AND BOWN HILLS the second word has been separated out from the value attribute but it's fine at the text level. Anyone have any idea why this might happen? Thanks

  Read the article

• AJAX: Permission denied to access property in iframe

  - by Muhammad Sajid

  Hi I created an php website which uses for AJAX post and was live at http://sprook.com.au/ but my client change it's domain to http://www.sprookit.net/ from his service provider Godaddy and now the firebug says: Permission denied to access property 'stopAjax' here stopAjax is my method name. script is there: <div class="post_area"> <form action="post.php" method="post" id="addVideo" enctype="multipart/form-data" target="post" onsubmit="return startAjax(this);"> <iframe id="post" name="post" src="#" style="width:0;height:0;border:0px solid #fff;"></iframe> <table width="860" border="0" cellspacing="0" cellpadding="0"> <tr> <td width="435">POST YOUR AD FREE<br /> <em>Paste embed code from YouTube</em></td> <td width="322"><input type="text" id="videoLink" name="videoLink" class="input_textbox" /> </td> <td width="95"><input type="submit" name="set_video_link" id="set_video_link" value="" class="submt_post" /> </td> </tr> <tr> <td>&nbsp;</td> <td><div id="process"> Connecting please wait <img src="images/loading.gif" /><br/> </div></td> </tr> </table> </form> </div> And all content comes from old domain i removed index file and it stoped working, therefore it is cleared that scripts run from old domain.

  Read the article

• Modify passed, nested dict/list

  - by Gerenuk

  I was thinking of writing a function to normalize some data. A simple approach is def normalize(l, aggregate=sum, norm_by=operator.truediv): aggregated=aggregate(l) for i in range(len(l)): l[i]=norm_by(l[i], aggregated) l=[1,2,3,4] normalize(l) l -> [0.1, 0.2, 0.3, 0.4] However for nested lists and dicts where I want to normalize over an inner index this doesnt work. I mean I'd like to get l=[[1,100],[2,100],[3,100],[4,100]] normalize(l, ?? ) l -> [[0.1,100],[0.2,100],[0.3,100],[0.4,100]] Any ideas how I could implement such a normalize function? Maybe it would be crazy cool to write normalize(l[...][0]) Is it possible to make this work?? Or any other ideas? Also not only lists but also dict could be nested. Hmm... EDIT: I just found out that numpy offers such a syntax (for lists however). Anyone know how I would implement the ellipsis trick myself?

  Read the article

• Problem in UITableViewDelegate - RowSelected gives wrong NSIndexPath

  - by vlad259

  I have a UITableViewSource which I have subclassed. I'm overriding GetCell and using my own subclassed cells, like so: public override UITableViewCell GetCell(UITableView tableView, NSIndexPath indexPath) { MarketItem item=_tableItems[indexPath.Section].Items[indexPath.Row]; MarketCell cell=tableView.DequeueReusableCell(_cellIdentifier) as MarketCell; if (cell==null) { cell=new MarketCell(UITableViewCellStyle.Subtitle,_cellIdentifier,item); } // decorate the cell // ... return cell; } This works but when I get events in my UITableViewDelegate, the index path gets me the wrong cell (events like AccessoryButtonTapped, WillSelectRow etc). The Section and Row numbers look correct but when I do a tableView.CellAt(indexPath) I get the wrong cell. (The row and section numbers again look correct.) Things to note: The table is constantly being updated - items arrive in a different thread which are then InvokeOnMainThread'd Although the table is constantly updated, rows and sections are only added - nothing is re-ordered or deleted If I pause the updates when I get a 'WillSelectRow', it doesn't help Most interestingly (but not a shippable solution) if I make a new cell each time rather than doing DequeueReusableCell, it works correctly. I can't help thinking it's a stupid bug of my own making but can't find it. Any help would be most gratefully received!

  Read the article

• What is the purpose of the Html "no-js" class?

  - by Swader

  I notice that in a lot of template engines, in the HTML5 Boilerplate, in various frameworks and in plain php sites there is the no-js class added onto the html element. Why is this done? Is there some sort of default browser behavior that reacts to this class? Why include it always? Does that not render the class itself obsolete, if there is no no-"no-js" case and html can be addressed directly? Here is an example from the HTML5 Boilerplate index.html: <!--[if lt IE 7 ]> <html lang="en" class="no-js ie6"> <![endif]--> <!--[if IE 7 ]> <html lang="en" class="no-js ie7"> <![endif]--> <!--[if IE 8 ]> <html lang="en" class="no-js ie8"> <![endif]--> <!--[if IE 9 ]> <html lang="en" class="no-js ie9"> <![endif]--> <!--[if (gt IE 9)|!(IE)]><!--> <html lang="en" class="no-js"> <!--<![endif]--> As you can see, the html element will always have this class. Can someone explain why this is done so often?

  Read the article

• in Rails, with check_box_tag, how do I keep the checkboxes checked after submitting query?

  - by Sebastien Paquet

  Ok, I know this is for the Saas course and people have been asking questions related to that as well but i've spent a lot of time trying and reading and I'm stuck. First of all, When you have a model called Movie, is it better to use Ratings as a model and associate them or just keep Ratings in an array floating in space(!). Second, here's what I have now in my controller: def index @movies = Movie.where(params[:ratings].present? ? {:rating => (params[:ratings].keys)} : {}).order(params[:sort]) @sort = params[:sort] @ratings = Ratings.all end Now, I decided to create a Ratings model since I thought It would be better. Here's my view: = form_tag movies_path, :method => :get do Include: - @ratings.each do |rating| = rating.rating = check_box_tag "ratings[#{rating.rating}]" = submit_tag "Refresh" I tried everything that is related to using a conditional ternary inside the checkbox tag ending with " .include?(rating) ? true : "" I tried everything that's supposed to work but it doesn't. I don't want the exact answer, I just need guidance.Thanks in advance!

  Read the article

• WPF - Dynamically access a specific item of a collection in XAML

  - by Andy T

  Hi, I have a data source ('SampleAppearanceDefinitions'), which holds a single collection ('Definitions'). Each item in the collection has several properties, including Color, which is what I'm interested in here. I want, in XAML, to display the Color of a particular item in the collection as text. I can do this just fine using this code below... Text="{Binding Source={StaticResource SampleAppearanceDefinitions}, Path=Definitions[0].Color}" The only problem is, this requires me to hard-code the index of the item in the Definitions collection (I've used 0 in the example above). What I want to do in fact is to get that value from a property in my current DataContext ('AppearanceID'). One might imagine the correct code to look like this.... Text="{Binding Source={StaticResource SampleAppearanceDefinitions}, Path=Definitions[{Binding AppearanceID}].Color}" ...but of course, this is wrong. Can anyone tell me what the correct way to do this is? Is it possible in XAML only? It feels like it ought to be, but I can't work out or find how to do it. Any help would be greatly appreciated! Thanks! AT

  Read the article

< Previous Page | 492 493 494 495 496 497 498 499 500 501 502 503  | Next Page >