Search Results

Search found 14037 results on 562 pages for 'alter index'.

Page 498/562 | < Previous Page | 494 495 496 497 498 499 500 501 502 503 504 505  | Next Page >

  • Added CAGradientLayer, getting this in my UIView dealloc: [CALayer release]: message sent to deallocated instance

    - by developerdoug
    Here there, I have a custom UIView. This view acts as a activity indicator but as label above the UIActivityIndicatorView. In the init, I add a CAGradientLayer. I allocate and initialize it and insert it at index 0 as a sublayer of the UIView layer property. In my dealloc method was called, I received a message in the console: - [CALayer release]: message sent to deallocated instance. My code: @interface LabelActivityIndicatorView () { UILabel *_label; UIActivityIndicatorView *_activityIndicatorView; CAGradientLayer *_gradientLayer; } @end @implementation LabelActivityIndicatorView //dealloc - (void) dealloc { [_label release]; [_activityIndicatorView release]; //even tried to remove the layer [_gradientLayer removeFromSuperLayer]; [_gradientLayer release]; [super dealloc]; } // init - (id) initWithFrame:(CGRect)frame { if ( (self = [super initWithFrame:frame]) ) { // init the label // init the gradient layer _gradientLayer = [[CAGradientLayer alloc] init]; [_gradientLayer setBounds:[self bounds]]; [_gradientLayer setPosition:CGPointMake(frame.size.width/2, frame.size.height/2)]; [[self layer] insertSublayer:_gradientLayer atIndex:0]; [[self layer] setNeedsDisplay]; } return self; } @end Anyone have any ideas. Since I'm allocating and initializing the gradient layer I'm responsible for releasing it. I should be able to alloc and init and assign to some ivar. Perhaps I should create a property with retain on it. Thanks,

    Read the article

  • Issue with transparent texture on 3D primitive, XNA 4.0

    - by Bevin
    I need to draw a large set of cubes, all with (possibly) unique textures on each side. Some of the textures also have parts of transparency. The cubes that are behind ones with transparent textures should show through the transparent texture. However, it seems that the order in which I draw the cubes decides if the transparency works or not, which is something I want to avoid. Look here: cubeEffect.CurrentTechnique = cubeEffect.Techniques["Textured"]; Block[] cubes = new Block[4]; cubes[0] = new Block(BlockType.leaves, new Vector3(0, 0, 3)); cubes[1] = new Block(BlockType.dirt, new Vector3(0, 1, 3)); cubes[2] = new Block(BlockType.log, new Vector3(0, 0, 4)); cubes[3] = new Block(BlockType.gold, new Vector3(0, 1, 4)); foreach(Block b in cubes) { b.shape.RenderShape(GraphicsDevice, cubeEffect); } This is the code in the Draw method. It produces this result: As you can see, the textures behind the leaf cube are not visible on the other side. When i reverse index 3 and 0 on in the array, I get this: It is clear that the order of drawing is affecting the cubes. I suspect it may have to do with the blend mode, but I have no idea where to start with that.

    Read the article

  • How to change CSS style of nested list items?

    - by Yasir
    I have a style for styling <a> elements in list items in a #navigation container. This is working fine. #navigation li a { text-decoration:none; background:#bfe5ff; color:#045e9f; width:125px; height:35px; padding-top:11px; display:block; float:left; margin-left:2px; text-align:center; font-size:18px; font-weight:bold; } Now in some <li>s I am inserting <div>s. In these I am again using a list again, but it should be different in style or have no style. When I put in <li>s, their style matches the outer <li> elements, but it should not. I am trying to use this: #newnavigation li a { font-size:12px; margin-left:20px; } but it's not working - it applies the "outer" styles. This is my markup: <ul id="navigation"> <li><a href="index.html">Home</a></li> <li><a href="about.html">About</a></li> <li><a href="contact.html">Contact</a></li> <li class="browse"> <a href="#">Browse</a> <div id="browsecontainer"> <h3>Browse By Category</h3> <li><a href="#"></a></li> </div> </li> </ul>

    Read the article

  • Iphone - cannot grant permission for publishing on a Facebook page that i administer

    - by user323817
    I want to open a dialog on the IPhone so a user can grant my application permission to post on a Facebook page that the user administers. Following the docs, I can grant permissions for the user's stream and I can even post on a page that he is a fan of. However, the post on the page is listed as from the username, not on behalf of the page itself, even though he is an administrator of the page. According to the Prompting for Permissions section at: http://wiki.developers.facebook.com/index.php/Authorization_and_Authentication_for_Desktop_Applications I should be able to create a prompt on the IPhone for granting permission to publish_stream on a Facebook page that he administers. The sample url they give for a web "popup" dialog is: http://www.facebook.com/connect/prompt_permissions.php?api_key=YOURAPIKEY&v=1.0&next=http://www.facebook.com/connect/login_success.html?xxRESULTTOKENxx&display=popup&ext_perm=read_stream,publish_stream&enable_profile_selector=1&profile_selector_ids=1234%2C5454 This works as expected and a drop down of the pages is displayed. However, since my application is on the IPhone, I change the display=popup to display=touch. This does not seem to work and I've tried fiddling with the parameters several ways but the drop down never comes up. Anyone find a way around this? The popup option doesn't seem to work since I get an error trying to display it.

    Read the article

  • using facelet1.1.15 (external facelet) in JSF2

    - by Odelya
    Hi! I have upgrated to JSF2 but still running with facelet1.1.15. I have these parameters in web.xml: <context-param> <param-name>org.ajax4jsf.VIEW_HANDLERS</param-name> <param-value>com.sun.facelets.FaceletViewHandler</param-value> </context-param> <context-param> <param-name>javax.faces.DISABLE_FACELET_JSF_VIEWHANDLER</param-name> <param-value>true</param-value> </context-param> I am trying to create my own componet step by step of this example : http://www.ibm.com/developerworks/java/library/j-jsf2fu2/index.html#tip3 everything looks fine but i get an error that it doesn't recognize the tag. Has it got to do with the facelet 1.1.15? and it works only with VDL? it there a way to use 1.1.15 and custom components in JSF2? As well - I use tomcat 6

    Read the article

  • Windows Phone - failing to get a string from a website with login information

    - by jumantyn
    I am new to accessing web services with Windows Phone 7/8. I'm using a WebClient to get a string from a php-website. The site returns a JSON string but at the moment I'm just trying to put it into a TextBox as a normal string just to test if the connection works. The php-page requires an authentication and I think that's where my code is failing. Here's my code: WebClient client = new WebClient(); client.Credentials = new NetworkCredential("myUsername", "myPassword"); client.DownloadStringCompleted += new DownloadStringCompletedEventHandler(client_DownloadStringCompleted); client.DownloadStringAsync(new Uri("https://www.mywebsite.com/ba/php/jsonstuff.php")); void client_DownloadStringCompleted(object sender, DownloadStringCompletedEventArgs e) { try { string data = e.Result; this.jsonText.Text = data; } catch (Exception ex) { System.Diagnostics.Debug.WriteLine(ex.Message); } } This returns first a WebException and then a TargetInvocationException. If I replace the Uri with for example "http://www.google.com/index.html" the jsonText TextBox gets filled with html text from Google (oddly enough, this also works even when the WebClient credentials are still set). So is the problem in the setting of the credentials? I couldn't find any good results when searching for guides on how to access php-pages with credentials, only without them. Then I found a short mention somewhere to use the WebClient.Credentials property. But should it work some other way? Update: here's what I can get out of the WebException (sorry for the bad formatting): System.Net.WebException: The remote server returned an error: NotFound. ---System.Net.WebException: The remote server returned an error: NotFound. at System.Net.Browser.ClientHttpWebRequest.InternalEndGetResponse(IAsyncResult asyncResult) at System.Net.Browser.ClientHttpWebRequest.<c_DisplayClasse.b_d(Object sendState) at System.Net.Browser.AsyncHelper.<c_DisplayClass1.b_0(Object sendState) --- End of inner exception stack trace --- at System.Net.Browser.AsyncHelper.BeginOnUI(SendOrPostCallback beginMethod, Object state) at System.Net.Browser.ClientHttpWebRequest.EndGetResponse(IAsyncResult asyncResult) at System.Net.WebClient.GetWebResponse(WebRequest request, IAsyncResult result) at System.Net.WebClient.DownloadBitsResponseCallback(IAsyncResult result)

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • Android 2.1 How to get Phone Numbers of contacts.

    - by Brandon Delany
    Hi, I am new to Android and have been working on an app that needs to get all of the user's contact's phone numbers. Apparently the code I have does not work with the 2.1 SDK. So far here is the code I am using: String[] projection = new String[] { Phone.NUMBER }; Cursor c = managedQuery( Phone.CONTENT_URI, projection, null, null, null ); int colIndex = -1; try { colIndex = c.getColumnIndexOrThrow( Phone.NUMBER ); } catch( Exception e ) { print( e.getMessage() ); } print( "Column Index = " + colIndex ); //count is equal to 3 for( int i = 0; i < count; i++ ){ try { print( c.getString( 2 ) ); //the 2 used to be colIndex } catch ( Exception e ) { print( e.getMessage() ); } } It seems that no matter what I pass into c.getString() it keeps telling me that I passed in -1. But I even hardcoded the 2, and it says the same thing. Any help would be much appreciated.

    Read the article

  • PHP include doesn't work

    - by Chris
    I'm not sure how simple is this to solve, but I assume I'm doing something wrong. I'm new to PHP, so bear with me, please. When I started learning PHP, I always placed all my project files into the same folder along with index.php and thus included everything like this: <?php include('./translation.php'); ?> Later on in the process of learning as I gained experience and my skill increased, I had to start using folders and place my files into sub folders. I ended up successfully including my files with the following: <?php include('../translation.php'); ?> My trouble-free coding took an unexpected turn when I decided to start using sub-sub folders. After placing all the files even deeper into the file structure I was shocked to find out that I cannot include them anymore, using: <?php include('.../translation.php'); ?> Now I'm lost. What did I do wrong? Am I to understand that I cannot include files deeper than 2 directories in the project? Should I start using a different file system?

    Read the article

  • jQuery preventing RedirectToAction from working?

    - by DaveDev
    I'm trying to redirect the user if they login successfully but the code I have on my page seems to be preventing the redirection from working. If I remove the jQuery below the redirection works. Can somebody tell me tell me if there's something I'm doing wrong? Thanks I have the following Action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Login(User user) { var myErrors = new Dictionary<string, string>(); try { if (ModelState.IsValid) { if (userRepository.ValidUser(user)) { return RedirectToAction("Index", "Group", new {page = (int?)null}); } else { return Json("Username or password seems to be incorrect"); } } else { foreach (KeyValuePair<string, ModelState> keyValuePair in ViewData.ModelState) { if (keyValuePair.Value.Errors.Count > 0) { List<string> errors = new List<string>(); myErrors.Add(keyValuePair.Key, keyValuePair.Value.Errors[0].ErrorMessage); } } return Json(myErrors); } } catch (Exception) { return Json("Invalid"); } } and the following code on my page: <script language="javascript" type="text/javascript"> $(document).ready(function() { $("#SaveSuccess").hide(); $("#btnLogin").click(function() { $("form").submit(function(event) { var formData = $(this).serialize(); $.post($(this).attr("action"), formData, function(res) { ShowErrors(res); if (res == true) { $("#SaveSuccess").text("Saved"); } else { $("#divError").html(res); } $("#SaveSuccess").fadeIn(100); }, "json"); return false; }); }); }); </script>

    Read the article

  • C header file won't compile with C, but will with C++.

    - by Leif Andersen
    I have the following chunk of a header file BKE_mesh.h: /* Connectivity data */ typedef struct IndexNode { struct IndexNode *next, *prev; int index; } IndexNode; void create_vert_face_map(ListBase **map, IndexNode **mem, const struct MFace *mface, const int totvert, const int totface); void create_vert_edge_map(ListBase **map, IndexNode **mem, const struct MEdge *medge, const int totvert, const int totedge); Note that the header file was prepared for the possibility of being used in a C++ file, as it had: #ifdef __cplusplus extern "C" { #endif at the top of the file, and the needed finish at the bottom. But the class implementing it was written in C. Next, whenever I try to #include the header file, I get an odd error. If the file has a .cpp extension, it compiles just fine, no complaints whatsoever. However, if I do: #include "BKE_mesh.h" inside of a file with a .c extension, I get the following errors: expected ')' before '*' token for the two last functions, in specific, the variable: ListBase **map in both classes. (Note that earlier in the header file, it declared, but not defined ListBase). So, my question is: why is this valid C++ code, but not C code? Thank you.

    Read the article

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • Get Browser to send both If-None-Match and If-Modified-Since

    - by Glen
    My Browser isn't sending back an If-Modified-Since Header for PHP generated Content on the first request my script sends: (Status-Line) HTTP/1.1 200 OK Date Thu, 21 Jan 2010 08:55:25 GMT Server Apache/2.2.11 (Win32) PHP/5.2.9-1 X-Powered-By PHP/5.2.9-1 Pragma no-cache x-ua-compatible IE=8;FF=3;OtherUA=4 Last-Modfied Sat, 02 Jan 2010 02:02:20 GMT Content-Length 28453 Etag b98e0795b509be20146f58e06fbb624f Keep-Alive timeout=5, max=90 Connection Keep-Alive Content-Type image/png it on the second request it sends: (Request-Line) GET /kincumberunitingchurch/banner_image.php?id=1 HTTP/1.1 Host localhost User-Agent Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.0.17) Gecko/2009122116 Firefox/3.0.17 Accept image/png,image/*;q=0.8,*/*;q=0.5 Accept-Language en-us,en;q=0.5 Accept-Encoding gzip,deflate Accept-Charset ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive 300 Connection keep-alive Referer http://localhost/kincumberunitingchurch/index.php?sid=tgl9jq3f71nau3cj9vps6pna03 Cookie sid=tgl9jq3f71nau3cj9vps6pna03; PHPSESSID=m0jvven6d7l65pl6odm9ecfnt4 If-None-Match b98e0795b509be20146f58e06fbb624f Cache-Control max-age=0 for other files the sever sends first: (Status-Line) HTTP/1.1 200 OK Date Thu, 21 Jan 2010 08:55:25 GMT Server Apache/2.2.11 (Win32) PHP/5.2.9-1 Last-Modified Wed, 30 Dec 2009 02:40:58 GMT Etag "1000000013d35-40d9-47be9117f6280" Accept-Ranges bytes Content-Length 16601 Keep-Alive timeout=5, max=84 Connection Keep-Alive Content-Type image/png and my browser send the following on the next request: (Request-Line) GET /kincumberunitingchurch/img/cbuttons.png HTTP/1.1 Host localhost User-Agent Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.0.17) Gecko/2009122116 Firefox/3.0.17 Accept image/png,image/*;q=0.8,*/*;q=0.5 Accept-Language en-us,en;q=0.5 Accept-Encoding gzip,deflate Accept-Charset ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive 300 Connection keep-alive Referer http://localhost/kincumberunitingchurch/mystyle.css Cookie sid=tgl9jq3f71nau3cj9vps6pna03; PHPSESSID=m0jvven6d7l65pl6odm9ecfnt4 If-Modified-Since Wed, 30 Dec 2009 02:40:58 GMT If-None-Match "1000000013d35-40d9-47be9117f6280" Cache-Control max-age=0 why would it send the If-Modified-Since header

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • Show iPad keyboard on select, focus or always (jQuery)

    - by Ryan
    I have a web app that is using jQuery to replace the RETURN key with TAB so that when I user presses return the form is not submitted but rather the cursor moves to the next text field. This works in all browsers but only 1/2 works on the iPad. On the iPad the next field is highlighted but the keyboard is hidden. How can I keep the keyboard visible or force it somehow? Here's my code (thanks to http://thinksimply.com/blog/jquery-enter-tab): function checkForEnter (event) { if (event.keyCode == 13) { currentBoxNumber = textboxes.index(this); if (textboxes[currentBoxNumber + 1] != null) { nextBox = textboxes[currentBoxNumber + 1] nextBox.focus(); nextBox.select(); event.preventDefault(); return false; } } } Drupal.behaviors.formFields = function(context) { $('input[type="text"]').focus(function() { $(this).removeClass("idleField").addClass("focusField"); }); $('input[type="text"]').blur(function() { $(this).removeClass("focusField").addClass("idleField"); }); // replaces the enter/return key function with tab textboxes = $("input.form-text"); if ($.browser.mozilla) { $(textboxes).keypress (checkForEnter); } else { $(textboxes).keydown (checkForEnter); } };

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • Codeigniter only loads the default controller

    - by fh47331
    I am very new to CodeIgniter, but have been programming PHP for ages. I'm writing some software at the moment and using CI for the first time with it. The default controller is set to the first controller I want to action call 'login' (the controller is login.php, the view is login.php. When the form is submitted it calls the 'authenticate' controller. This executes fine, process the login data correctly and then does a redirect command (without any output to the screen prior) to the next page in this case 'newspage'. The problem is that the redirect, never reaches 'newspage' but the default controller runs again. It doesn't matter what I put ... ht tp://domain.name/anything ... (yes im using .htaccess to remove the index.php) the anything never gets called, just the default controller. I have left the standard 'welcome.php' controller and 'welcome_message.php' in the folders and even putting ht tp://domain.name/welcome all I get is the login screen! (Obviously there shouldn't be a space between the http - thats just done so it does not show as a hyperlink!) Can anyone tell me what i've done wrong!

    Read the article

  • integrating jquery with AJAX using MVC for ddl/html.dropdownlist

    - by needhelp
    the situation: a user on the page in question selects a category from a dropdown which then dynamically populates all the users of that category in a second dropdown beside it. all the data is being retrieved using LinqtoSQL and i was wondering if this can be done a) using html.dropdownlist in a strongly typed view? b) using jquery to trigger the ajax request on selected index change instead of a 'populate' button trigger? sorry i dont have code as what i was trying really wasnt working at all. I am having trouble with how to do it conceptually and programatically! will appreciate any links to examples etc greatly! thanks in advance! EDIT: this is kind of what i was trying to achieve.. first the ViewPage: <script type="text/javascript"> $(document).ready function TypeSearch() { $.getJSON("/Home/Type", null, function(data) { //dont know what to do here }); } </script> <p> <label for="userType">userType:</label> <%= Html.DropDownList("userType") %> <%= Html.ValidationMessage("userType", "*") %> <input type="submit" runat="server" onclick="TypeSearch()" /> <label for="accountNumber">accountNumber:</label> <%= Html.DropDownList("accountNumber") %> <%= Html.ValidationMessage("accountNumber", "*") %> </p> Then home controller action: public ActionResult Type() { string accountType = dropdownvalue; List<Account> accounts = userRep.GetAccountsByType(accountType).ToList(); return Json(accounts); }

    Read the article

  • Echoing users by group name in PHP

    - by BobSapp
    What I want to do is click a name of a group(every group what I create other than poweruser and admin groups) and that will echo all of the users in that group from the database. I have figured out the code so far but now my problem is how will I print it all out when clicking the name of the group? My code so far is: <h3>Groups</h3> <?php include('db.php'); if (isset($_GET["groupID"])) { $sql="SELECT `group`.*, `user`.* FROM `user` inner join `group` on group.groupID=user.groupID where group.groupID= " . mysql_real_escape_string($_GET["groupID"]) ; } else { $sql="SELECT * FROM `group` WHERE groupName <> 'admin' AND groupName <> 'poweruser'" ; } $result=mysql_query($sql,$connection); while($line=mysql_fetch_array($result)){ echo "<a href='index.php?page=groups&group=".$line['groupID']."'>".$line['groupName'].'</a><br />'; } mysql_free_result($result); mysql_close($connection); ?>

    Read the article

  • get path of Array (PHP)

    - by Kawah Grafis
    i have an array input like this .. Array ( [0] => Array ( [0] => 42 ) [**42**] => Array ( [0] => 12 [1] => 14 ) [**14**] => Array ( [0] => 317 ) [317] => Array ( [0] => 319 ) [**12**] => Array ( [0] => 306 [1] => 307 ) [307] => Array ( [0] => 311 ) [306] => Array ( [0] => 309 ) ) and i want to get result array like bellow : $paths[]=array(42,12,306,309); $paths[]=array(42,12,307,311); $paths[]=array(42,14,317,319); see array input root in array input = 42 (index of array 0) 42 have child = 12, 14 12 have child = 306, 307 14 have child = 317 306 have child = 309 307 have child = 311 317 have child = 319 like this.. and output array insert into $paths $paths[0]=array(42,12,306,309); $paths[1]=array(42,12,307,311); $paths[2]=array(42,14,317,319);

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 494 495 496 497 498 499 500 501 502 503 504 505  | Next Page >