Search Results

Search found 14567 results on 583 pages for 'document converter'.

Page 497/583 | < Previous Page | 493 494 495 496 497 498 499 500 501 502 503 504  | Next Page >

  • deep linking in Excel sheets exported to html

    - by pomarc
    hello everybody, I am working on a project where I must export to html a lot of Excel files. This is pretty straightforward using automation and saving as html. The problem is that many of these sheets have links to worksheets of some other files. I must find a way to write a link to a single inner worksheet. When you export a multisheet excel file to html, excel creates a main htm file, a folder named filename_file, and inside this folder it writes down several files: a css, an xml list of files, a file that creates the tab bar and several html files named sheetxxx.htm, each one representing a worksheet. When you open the main file, you can click the menu bar at the bottom which lets you select the appropriate sheet. This is in fact a link, which replaces a frame content with the sheetxxx.htm file. When this file is loaded a javascript function that selects the right tab gets called. The exported files will be published on a web site. I will have to post process each file and replace every link to the other xls files to the matching htm file, finding a way to open the right worksheet. I think that I could add a parameter to the processed htm file link url, such as myfile.htm?sh=sheet002.htm if I want to link to the second worksheet of myfile.htm (ex myfile.xls). After I've exported them, I could inject a simple javascript into each of the main files which, when they are loaded, could retrieve the sh parameter with jQuery (this is easy) and use this to somehow replace the frSheet frame contents (where the sheets get loaded), opening the right inner sheet and not the default sheet (this is what I call deep linking) mimicking what happens when a user clicks on a tab. This last step is missing... :) I am considering different options, such as replacing the source of the $("frSheet") frame after document.ready. I'd like to hear from you any advice on what could be the best way to realize that in your opinion. any help is greately appreciated, many thanks.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Divs, flash and doctype :(

    - by nick
    I have a web-site, that uses colorbox, it also has flash header. Everything works fine in both ff and ie. Before ive started to use colorbox, i had little div that covered small part of flash header for menu purposes. Now, since im using colorbox, i had to declare doctype, and set wmode on flash to 'opaque', in order everything to work right way.But now i cant get that little div, to appear on top of my flash header. If anyone can help me with this, please do so.... or atleast tell me what should i read : ( im will be very gratefull for any solution. current html document structure: ... all the js and css files ... heres that div's style from corresponding css file: .cell_r0_c0{position: absolute;left: 61%;width:260;height:69; background-color: #000000; vertical-align: bottom;} I think i've allready tried all the combinations of position attribute, also tried diff z-index values, and i can't get it work the way i want. Maybe ive missed something idk. Please help me :(

    Read the article

  • Display X divs randomly out of a possible Y.

    - by Jordan
    How do I randomly display 3 divs out of a possible 10 in total? This is what I have tried so far: HTML: <div id="1">Content 1</div> <div id="2">Content 2</div> <div id="3">Content 3</div> <div id="4">Content 4</div> <div id="5">Content 5</div> <div id="6">Content 6</div> Javascript: function randomiseDiv() { // Define how many divs we have var divCount = 6; // Get our random ID (based on the total above) var randomId = Math.floor(Math.random()*divCount+1); // Get the div that's been randomly selectted var chosenDiv= document.getElementById(randomId); // If the content is available on the page if (chosenDiv) { // Update the display chosenDiv.style.display = 'block'; } } window.onload = randomiseDiv; I would prefer a PHP solution, although anything at this stage would be beneficial.

    Read the article

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • Choosing a W3C valid DOCTYPE and charset combination?

    - by George Carter
    I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

    Read the article

  • Validate a XDocument against schema without the ValidationEventHandler (for use in a HTTP handler)

    - by Vaibhav Garg
    Hi everyone, (I am new to Schema validation) Regarding the following method, System.Xml.Schema.Extensions.Validate( ByVal source As System.Xml.Linq.XDocument, ByVal schemas As System.Xml.Schema.XmlSchemaSet, ByVal validationEventHandler As System.Xml.Schema.ValidationEventHandler, ByVal addSchemaInfo As Boolean) I am using it as follows inside a IHttpHandler - Try Dim xsd As XmlReader = XmlReader.Create(context.Server.MapPath("~/App_Data/MySchema.xsd")) Dim schemas As New XmlSchemaSet() : schemas.Add("myNameSpace", xsd) : xsd.Close() myXDoxumentOdj.Validate(schemas, Function(s As Object, e As ValidationEventArgs) SchemaError(s, e, context), True) Catch ex1 As Threading.ThreadAbortException 'manage schema error' Return Catch ex As Exception 'manage other errors' End Try The handler- Function SchemaError(ByVal s As Object, ByVal e As ValidationEventArgs, ByVal c As HttpContext) As Object If c Is Nothing Then c = HttpContext.Current If c IsNot Nothing Then HttpContext.Current.Response.Write(e.Message) HttpContext.Current.Response.End() End If Return New Object() End Function This is working fine for me at present but looks very weak. I do get errors when I feed it bad XML. But i want to implement it in a more elegant way. This looks like it would break for large XML etc. Is there some way to validate without the handler so that I get the document validated in one go and then deal with errors? To me it looks Async such that the call to Validate() would pass and some non deterministic time later the handler would get called with the result/errors. Is that right? Thanks and sorry for any goofy mistakes :).

    Read the article

  • Making a jQuery plugin to feed Tumblr to site

    - by tylorreimer
    I have some experience with PHP and a little with JS but I'm far from anything proficient. I'm trying to make a jQuery plugin for my site that I can call in my HTML via something like this: $('.new').tumble({username: "tylor", count: 9}); Which would basically put the Tumblr list the code should make into the DIV with class 'new' in this case. Here is my code so far; the problem seems to be how to get it to pick up class/id from the original call (in the HTML) and use that in the jQuery. Here's the code so far: (function($) { $.fn.tumble = function(options){ var settings = $.extend({ username: null, // [string or array] required to get url for tumblr account count: 3, // [integer] how many posts to display? }, options); //url construction var url = "http://" + settings.username + ".tumblr.com"; var jsonurl = url + "/api/read/json?num=" + settings.count + "&callback=?"; $.getJSON(jsonurl, function(data) { var items = []; $.each(data.posts, function(id, url) { // Goes over each post in the JSON document retrieved from data URL var url = this.url; // Just assigns a variable to the url to avoid constantly writing "this.whatever" var photourl = this['photo-url-250']; // photo-url-xxx needs to be called this way due to integers in the name items.push('<li><a href="' + url + '">' + photourl + '</a></li>'); }); $('<ul/>', { // Creates an empty list html: items.join('') // Takes the values in the item array and puts 'em together }).appendTo('.new'); // I don't want this to have the class set in the jQuery itself }); //end json }; })( jQuery ); Any help you can lend would be wonderful. Thank you

    Read the article

  • ASP.NET - Webservice not being called from javascript

    - by Robert
    Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

    Read the article

  • Problem executing trackPageview with Google Analytics.

    - by dmrnj
    I'm trying to capture the clicks of certain download links and track them in Google Analytics. Here's my code var links = document.getElementsByTagName("a"); for (var i = 0; i < links.length; i++) { linkpath = links[i].pathname; if( linkpath.match(/\.(pdf|xls|ppt|doc|zip|txt)$/) || links[i].href.indexOf("mode=pdf") >=0 ){ //this matches our search addClickTracker(links[i]); } } function addClickTracker(obj){ if (obj.addEventListener) { obj.addEventListener('click', track , true); } else if (obj.attachEvent) { obj.attachEvent("on" + 'click', track); } } function track(e){ linkhref = (e.srcElement) ? e.srcElement.pathname : this.pathname; pageTracker._trackPageview(linkhref); } Everything up until the pageTracker._trackPageview() call works. In my debugging linkhref is being passed fine as a string. No abnormal characters, nothing. The issue is that, watching my http requests, Google never makes a second call to the tracking gif (as it does if you call this function in an "onclick" property). Calling the tracker from my JS console also works as expected. It's only in my listener. Could it be that my listener is not deferring the default action (loading the new page) before it has a chance to contact Google's servers? I've seen other tracking scripts that do a similar thing without any deferral.

    Read the article

  • pdf external streams in Max OS X Preview

    - by olpa
    According to the specification, a part of a PDF document can reside in an external file. An example for an image: 2 0 obj << /Type /XObject /Subtype /Image /Width 117 /Height 117 /BitsPerComponent 8 /Length 0 /ColorSpace /DeviceRGB /FFilter /DCTDecode /F (pinguine.jpg) >> stream endstream endobj I found that this functionality does work in Adobe Acrobat 5.0 for Windows (sample PDF with the image), also I managed to view this file in Adobe Acrobat Reader 8.1.3 for Mac OS X after I found the setting "Allow external content". Unfortunately, it seems that non-Adobe tools ignore the external stream feature. I hope I'm wrong, therefore ask the question: How to enable external streams in Mac OS X? (I think that all the system Mac OS X tools use the same library, therefore say "Mac OS X" instead of "Preview".) Or maybe there could be a programming hook to emulate external streams? My task is: store a big set of images (total ˜300Mb) outside of a small PDF (˜1Mb). At some moment, I want to filter PDF through a quartz filter and get a PDF with the images embedded. Any suggestions are welcome.

    Read the article

  • Fixed div once page is scrolled is flickering

    - by jasondavis
    I am trying to have an advertisement block/div that will be hald way down the page, once you scroll do the page to this point it will stick to the top. Here is a demo of what I am trying to do and the code I am using to do it with... http://jsfiddle.net/jasondavis/6vpA7/3/embedded/result/ In the demo it works perfectly how I am wanting it to be, however when I implement it on my live site, http://goo.gl/zuaZx it works but when you scroll down the div flickers in and out of view on each scroll or down key press. On my site to see the problem live it is the blokc on the right sidebar that says "Recommended Books" Here is the code I am using... $(document).ready( function() { $(window).scroll( function() { if ($(window).scrollTop() > $('#social-container').offset().top) $('#social').addClass('floating'); else $('#social').removeClass('floating'); } ); } );? css #social.floating { position: fixed; top: 0; }? My demo jsfiddle where it works correctly http://jsfiddle.net/jasondavis/6vpA7/3/ The only thing different on my live site is the div/id name is different. As you can see it is somewhat working on my live site except the flickering in and out of view as you scroll down the page. Anyone have any ideas why this would happen on my live site and not on my jsfiddle demo?

    Read the article

  • Calling jQuery method from onClick attribute in HTML

    - by Russell
    I am relatively new to implementing JQuery throughout an entire system, and I am enjoying the opportunity. I have come across one issue I would love to find the correct resolve for. Here is a simple case example of what I want to do: I have a button on a page, and on the click event I want to call a jquery function I have defined. Here is the code I have used to define my method (Page.js): (function($) { $.fn.MessageBox = function(msg) { alert(msg); }; }); And here is my HTML page: <HTML> <head> <script type="text/javascript" src="C:\Sandpit\jQueryTest\jquery-1.3.2.js"></script> <script language="javascript" src="Page.js"></script> </head> <body> <div class="Title">Welcome!</div> <input type="button" value="ahaha" onclick="$().MessageBox('msg');" /> </body> </HTML> (The above code displays the button, but clicking does nothing.) I am aware I could add the click event in the document ready event, however it seems more maintainable to put events in the HTML element instead. However I have not found a way to do this. Is there a way to call a jquery function on a button element (or any input element)? Or is there a better way to do this? Thanks

    Read the article

  • jQuery noobie can't make a checked checkbox show an alert.

    - by Kyle Sevenoaks
    I found this answer before, to fire an alert if the button is pressed but the checkbox isn't checked. Why won't this work? <input value="1" type="checkbox" name="salgsvilkar" ID="checkbox2" style="float:left;" onclick="document.getElementById('scrollwrap').style.cssText='border-color:#85c222; background-color:#E5F7C7;';" /><label for="checkbox2" class="akslabel">Salgs og leveringsvilkår er lest og akseptert</label> </span> {literal} <script type="text/javascript"> $(function() { //checkbox $("#checkbox2").click(function(){ //if this... //alert("this")... if($("#checkbox2").is(':checked')) { alert("im checked"); } }); //button $("#fullfor_btn").click(function(e){ if(!$("#checkbox2").is(':checked')) { alert("you did not check the agree to terms..."); e.preventDefault(); } }); } </script> {/literal} This on another .tpl: <label></label> <button type="submit" class="submit" name="{$method}" id="fullfor_btn" title="Fullfør bestillingen nå" value="">&nbsp;</button> What could be going wrong? The jQuery doesn't fire anything at all.

    Read the article

  • increase number of photos from flickr using json

    - by Andrew Welch
    Hi this is my code: Is is possible to get more photos from flickr. What is the standard / default number? $(document).ready(function(){ $.getJSON("http://api.flickr.com/services/feeds/photos_public.gne?id=48719970@N07&lang=en-us&format=json&jsoncallback=?", function(data){ $.each(data.items, function(i, item){ var newurl = 'url(' + item.media.m + ')'; $("<div class='images'/>").css('background', newurl).css('backgroundPosition','top center').css('backgroundRepeat','no-repeat').appendTo("#images").wrap("<a target=\"_blank\ href='" + item.link + "'></a>"); }) $("#title").html(data.title); $("#description").html(data.description); $("#link").html("<a href='" + data.link + "' target=\"_blank\">Visit the Viget Inspiration Pool!</a>"); //Notice that the object here is "data" because that information sits outside of "items" in the JSON feed $('.jcycleimagecarousel').cycle({ fx: 'fade', speed: 300, timeout: 3000, next: '#next', prev: '#prev', pause: 1, random: 1 }); }); });

    Read the article

  • Trouble determining onclick's target

    - by pwseo
    I've tried and tried... and I can't seem to make this work in IE (tested version 6) Can anybody help me? IE complains about an error but refuses to tell which error it is... var a = document.getElementsByTagName("a"); for (i = 0; i < a.length; i++) { if (a[i].getAttribute("class") == "info-link") { a[i].onclick = function(e) { e = e || window.event; var target = e.srcElement || e.target; var info = target.parentNode.getElementsByTagName("div")[0]; if (info.style.display == "none" || info.style.display == "") { info.style.display = "block"; } else { info.style.display = "none"; } return false; } } } <div class="auxdata"> <a href="#" class="info-link">Esta questão possuí dados anexos. Clique para ver.</a> <div style="display: none;" class="info-inner"> <!-- variable stuff here --> </div> </div>

    Read the article

  • How do I get NHibernate to work with .NET Framework 2.0?

    - by Daniel Dolz
    I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

    Read the article

  • Start with remoting or with WCF

    - by Sheldon
    Hi. I'm just starting with distributed application development. I need to create (all by myself) an enterprise application for document management. That application will run on an intranet (within the firewall, no internet access is required now, BUT is probably that will be later). The application needs to manage images that will be stored within MySQL Server (as blobs) and those images will be then recovered by the app and eventually one or more of them will be converted to PDF. Performance is the most important non-functional requirement. I have a couple of doubts. What do you suggest to use, .NET Remoting or WCF over TCP-IP (I think second one is the best for the moment I need to expose the business logic over internet, changing the protocol). Where do you suggest to make the transformation of the images to pdf files, I'm using iText. (I have thought to have the business logic stored within the IIS and exposed via WCF, and that business logic to be responsible of getting the images and transforming them to PDF, that because the IIS and the MySQL Server are the same physical machine). I ask about where to do the transformation because the app must be accessible from multiple devices, and for example, for mobile devices, the pdf maybe is not necessary. Thank you very much in advance.

    Read the article

  • Making a Javascript game, Having a little problem with scrolling.

    - by RobertWHurst
    I have a #wrapper div and a #grid div nested inside. currently I can scroll around with this function below. getCursorPos : function(){ // set the empty cursor object var cursor = {}; //get the offset from the left of the grid container var grid //offset loop $(function getCursorPos(){ grid = $('#grid').offset(); setTimeout(getCursorPos, game.loopSpeed); }); //continuosly get the position var that = this; $(document).mousemove(function(e){ //if game mode is menu exit if(game.mode === 'menu'){ return; } // NOTE: this looks a litle over done but don't remove anything // its like this because javascript uses floating points // and so in order to line up to the nearest hunderedth I // had to make the cursor and div position intergers by // muliplying by ten. one the two are added I reduced them // and rounded them. that.x = Math.round(((e.pageX * 10) - (grid.left * 10)) / 10); that.y = Math.round(((e.pageY * 10) - (grid.top * 10)) / 10); }); }, the problem is that the mouse coordinates only update when the mouse moves. is there any way to get the coordinates with out moving the mouse?

    Read the article

  • Can someone tell me why this JavaScript code isn't lining up an array in order?

    - by DarkLightA
    Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

    Read the article

  • jeditable table cell

    - by user666262
    Hi all, I am having an issue when using jeditable to edit a cell in a table. The project is the MVC 2 web application and the table has been put on the standard about page. How do i tell the script to call a specific method in the controller ? because it is currently just loading the entire page into the cell. This is the javascript: $(document).ready(function () { $('.editable').editable('http://localhost:2196/Home/About', { type: 'text', cancel: 'Cancel', event: 'dblclick', submit: 'OK', tooltip: 'double Click to edit...' }); }); This is the table : <% foreach (DataTableEditable.Models.Company item in (IEnumerable<DataTableEditable.Models.Company>)Model) {%> <tr id="<%= Html.Encode(item.ID) %>"> <td class="editable"><%= Html.Encode(item.Name) %> </td> <td><%= Html.Encode(item.Address) %> </td> <td><%= Html.Encode(item.Town) %> </td> </tr> <% }%> Thanks lots John

    Read the article

  • How can I bind a simple Javascript array to an MVC3 controller action method?

    - by Sergio Tapia
    Here is the javascript code I use to create the array and send it on it's way: <script type="text/javascript" language="javascript"> $(document).ready(function () { $("#update-cart-btn").click(function() { var items = []; $(".item").each(function () { var productKey = $(this).find("input[name='item.ProductId']").val(); var productQuantity = $(this).find("input[type='text']").val(); items[productKey] = productQuantity; }); $.ajax({ type: "POST", url: "@Url.Action("UpdateCart", "Cart")", data: items, success: function () { alert("Successfully updated your cart!"); } }); }); }); </script> The items object is properly constructed with the values I need. What data type must my object be on the backend of my controller? I tried this but the variable remains null and is not bound. [Authorize] [HttpPost] public ActionResult UpdateCart(object[] items) // items remains null. { // Some magic here. return RedirectToAction("Index"); }

    Read the article

  • ASP.net MVC Routing on Postback

    - by Mark Kadlec
    In my ASP.net MVC View I have a dropdown that I want to get details on selection and asynchronously update a div. My aspx is as follows: <% using (Html.BeginForm("Index", "Portal", FormMethod.Post, new { id = "TheForm" })) {%> <h2>Index</h2> <% using (Ajax.BeginForm("Details", new AjaxOptions { UpdateTargetId = "mpkResults" })) { %> <%=Html.DropDownList("Docs", (IEnumerable<SelectListItem>)ViewData["Docs"], new { onchange = "document.getElementById('TheForm').submit();" })%> <p><input type="submit" value="Details" /></p> <% } %> <div id="mpkResults" style="margin:10px 0px 0px 0px;"></div> ... The onchange event fires correctly on selection of the dropdown, but instead of the Details method in my code behind firing, it hits my Index method. Why is the details method not getting hit on the onchange event? My Details() method in the controller is: public ActionResult Details() { ... < It never gets here, just goes to the index() method } It's a little frustrating right now since I'm sure it is a simple mistake but not sure what it could be. I looked at the Source of my page and sure enough, the form looks like it should be routing to the Details Action: <form action="/Portal/Details" method="post" ... Any help would be appreciated.

    Read the article

  • Can't get jQuery to wokr with Prototype - tried everything....

    - by thinkfuture
    Ok so here is the situation. Been pulling my hair out on this one. I'm a noob at this. Only been using rails for about 6 weeks. I'm using the standard setup package, and my code leverages prototype helpers heavily. Like I said, noob ;) So I'm trying to put in some jQuery effects, like PrettyPhoto. But what happens is that when the page is first loaded, PrettyPhoto works great. However, once someone uses a Prototype helper, like a link created with link_to_remote, Prettyphoto stops working. I've tried jRails, all of the fixes proposed on the JQuery site to stop conflicts... http://docs.jquery.com/Using_jQuery_with_Other_Libraries ...even done some crazy things likes renaming all of the $ in prototype.js to $$$ to no avail. Either the prototype helpers break, or jQuery breaks. Seems nothing I do can get these to work together. Any ideas? Here is part of my application.html.erb <%= javascript_include_tag 'application' %> <%= javascript_include_tag 'tooltip' %> <%= javascript_include_tag 'jquery' %> <%= javascript_include_tag 'jquery-ui' %> <%= javascript_include_tag "jquery.prettyPhoto" %> <%= javascript_include_tag 'prototype' %> <%= javascript_include_tag 'scriptalicious' %> </head> <body> <script type="text/javascript" charset="utf-8"> jQuery(document).ready( function() { jQuery("a[rel^='prettyPhoto']").prettyPhoto(); }); </script> If I put prototype before jquery, the prototype helpers don't work If I put the noconflict clause in, neither works. Thanks in advance! Chris

    Read the article

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

< Previous Page | 493 494 495 496 497 498 499 500 501 502 503 504  | Next Page >