Search Results

Search found 3247 results on 130 pages for 'erick david ruiz coronel'.

Page 5/130 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Java Oracle Installation /usr/bin/java: cannot execute binary file

    - by Dave
    Hi I've been trying for 1 day to get Oracle Java running on Ubuntu. I have a powermac g5 with Ubuntu 12.04 ppc64. uname -a : Linux LK37 3.2.0-53-powerpc64-smp #81-Ubuntu SMP Thu Aug 22 21:17:14 UTC 2013 ppc64 ppc64 ppc64 GNU/Linux lspci: david@LK37:~$ sudo lspc [sudo] password for david: sudo: lspc: command not found david@LK37:~$ sudo lspci 0000:00:0b.0 PCI bridge: Apple Inc. CPC945 PCIe Bridge 0000:0a:00.0 VGA compatible controller: NVIDIA Corporation NV43 [GeForce 6600 LE] (rev a2) 0001:00:00.0 Host bridge: Apple Inc. U4 HT Bridge 0001:00:01.0 PCI bridge: Broadcom BCM5780 [HT2000] PCI-X bridge (rev a3) 0001:00:02.0 PCI bridge: Broadcom BCM5780 [HT2000] PCI-X bridge (rev a3) 0001:00:03.0 PCI bridge: Broadcom BCM5780 [HT2000] PCI-Express Bridge (rev a3) 0001:00:04.0 PCI bridge: Broadcom BCM5780 [HT2000] PCI-Express Bridge (rev a3) 0001:00:05.0 PCI bridge: Broadcom BCM5780 [HT2000] PCI-Express Bridge (rev a3) 0001:00:06.0 PCI bridge: Broadcom BCM5780 [HT2000] PCI-Express Bridge (rev a3) 0001:00:07.0 PCI bridge: Apple Inc. Shasta PCI Bridge 0001:00:08.0 PCI bridge: Apple Inc. Shasta PCI Bridge 0001:00:09.0 PCI bridge: Apple Inc. Shasta PCI Bridge 0001:01:07.0 Unassigned class [ff00]: Apple Inc. Shasta Mac I/O 0001:01:0b.0 USB controller: NEC Corporation OHCI USB Controller (rev 43) 0001:01:0b.1 USB controller: NEC Corporation OHCI USB Controller (rev 43) 0001:01:0b.2 USB controller: NEC Corporation uPD72010x USB 2.0 Controller (rev 04) 0001:03:0c.0 IDE interface: Broadcom K2 SATA 0001:03:0d.0 Unassigned class [ff00]: Apple Inc. Shasta IDE 0001:03:0e.0 FireWire (IEEE 1394): Apple Inc. Shasta Firewire 0001:05:04.0 Ethernet controller: Broadcom Corporation NetXtreme BCM5780 Gigabit Ethernet (rev 03) 0001:05:04.1 Ethernet controller: Broadcom Corporation NetXtreme BCM5780 Gigabit Ethernet (rev 03) david@LK37:~$ I tried various ways to install Oracle Java but I always end up with: bash: /usr/bin/java: cannot execute binary file At the moment I have Installed jdk-7u25-linux-x64.tar.gz in /usr/lib/jvm/jdk1.7.0/bin/ as said in this post I already tried the web install but I get a 404 error. I hope you can help me. I started using Ubuntu yesterday so please give me the complete terminal code, it will be a lot easier for me. For those who care I want to play Minecraft and with the OpenJDK I got a java.lang error. That's why I want to install Oracle Java.

    Read the article

  • Article Sharing &ndash; Windows Azure Memcached Plugin

    - by Shaun
    I just found that David Aiken, a windows azure developer and evangelist, wrote a cool article about how to use Memcached in Windows Azure through the new feature Azure Plugin. http://www.davidaiken.com/2011/01/11/windows-azure-memcached-plugin/ I think the best solution for distributed cache in Azure would be the Windows Azure AppFabric Caching but since it’s only in CTP and avaiable in the US data center David’s solution would be the best. Only one thing I’m concerning about, is the stability of windows verion Memcached.

    Read the article

  • Java EE@Developer Day Poland

    - by reza_rahman
    Oracle Poland held a Developer Day in Warsaw on November 28. The event was a great success with 100+ attendees thanks to great speakers like Simon Ritter and David Delabassee. David led a lab on JAX-RS, HTML 5 Server-Sent Events and WebSocket using GlassFish (this is the same hands-on lab presented at JavaOne). The lab went extremely well with a full-house, enthusiastic crowd. Read more details here!

    Read the article

  • Jdbc - Connect remote Mysql Database error

    - by Guilherme Ruiz
    I'm using JDBC to connect my program to a MySQL database. I already put the port number and yes, my database have permission to access. When i use localhost work perfectly, but when i try connect to a remote MySQL database, show this error on console. java.lang.ExceptionInInitializerError Caused by: java.lang.NumberFormatException: null at java.lang.Integer.parseInt(Integer.java:454) at java.lang.Integer.parseInt(Integer.java:527) at serial.BDArduino.<clinit>(BDArduino.java:25) Exception in thread "main" Java Result: 1 CONSTRUÍDO COM SUCESSO (tempo total: 1 segundo) Thank you in Advance ! MAIN CODE /* * To change this template, choose Tools | Templates * and open the template in the editor. */ package serial; import gnu.io.CommPort; import gnu.io.CommPortIdentifier; import gnu.io.SerialPort; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import javax.swing.JFrame; import javax.swing.JOptionPane; /** * * @author Ruiz */ public class BDArduino extends JFrame { static boolean connected = false; static int aux_sql8 = Integer.parseInt(Sql.getDBinfo("SELECT * FROM arduinoData WHERE id=1", "pin8")); static int aux_sql2 = Integer.parseInt(Sql.getDBinfo("SELECT * FROM arduinoData WHERE id=1", "pin2")); CommPort commPort = null; SerialPort serialPort = null; InputStream inputStream = null; static OutputStream outputStream = null; String comPortNum = "COM10"; int baudRate = 9600; int[] intArray = {2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13}; /** * Creates new form ArduinoTest */ public BDArduino() { //super("Arduino Test App"); initComponents(); } class Escrita extends Thread { private int i; public void run() { while (true) { System.out.println("Número :" + i++); } } } //public void actionPerformed(ActionEvent e) { // String arg = e.getActionCommand(); public static void writeData(int a) throws IOException { outputStream.write(a); } public void action(String arg) { System.out.println(arg); Object[] msg = {"Baud Rate: ", "9600", "COM Port #: ", "COM10"}; if (arg == "connect") { if (connected == false) { new BDArduino.ConnectionMaker().start(); } else { closeConnection(); } } if (arg == "disconnect") { serialPort.close(); closeConnection(); } if (arg == "p2") { System.out.print("Pin #2\n"); try { outputStream.write(intArray[0]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p3") { System.out.print("Pin #3\n"); try { outputStream.write(intArray[1]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p4") { System.out.print("Pin #4\n"); try { outputStream.write(intArray[2]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p5") { System.out.print("Pin #5\n"); try { outputStream.write(intArray[3]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p6") { System.out.print("Pin #6\n"); try { outputStream.write(intArray[4]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p7") { System.out.print("Pin #7\n"); try { outputStream.write(intArray[5]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p8") { System.out.print("Pin #8\n"); try { outputStream.write(intArray[6]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p9") { System.out.print("Pin #9\n"); try { outputStream.write(intArray[7]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p10") { System.out.print("Pin #10\n"); try { outputStream.write(intArray[8]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p11") { System.out.print("Pin #11\n"); try { outputStream.write(intArray[9]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p12") { System.out.print("Pin #12\n"); try { outputStream.write(intArray[10]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } if (arg == "p13") { System.out.print("Pin #12\n"); try { outputStream.write(intArray[11]); }//end try catch (IOException e12) { e12.printStackTrace(); System.exit(-1); }//end catch } } //******************************************************* //Arduino Connection *************************************** //****************************************************** void closeConnection() { try { outputStream.close(); } catch (Exception ex) { ex.printStackTrace(); String cantCloseConnectionMessage = "Can't Close Connection!"; JOptionPane.showMessageDialog(null, cantCloseConnectionMessage, "ERROR", JOptionPane.ERROR_MESSAGE); } connected = false; System.out.print("\nDesconectado\n"); String disconnectedConnectionMessage = "Desconectado!"; JOptionPane.showMessageDialog(null, disconnectedConnectionMessage, "Desconectado", JOptionPane.INFORMATION_MESSAGE); }//end closeConnection() void connect() throws Exception { String portName = comPortNum; CommPortIdentifier portIdentifier = CommPortIdentifier.getPortIdentifier(portName); if (portIdentifier.isCurrentlyOwned()) { System.out.println("Error: Port is currently in use"); String portInUseConnectionMessage = "Port is currently in use!\nTry Again Later..."; JOptionPane.showMessageDialog(null, portInUseConnectionMessage, "ERROR", JOptionPane.ERROR_MESSAGE); } else { commPort = portIdentifier.open(this.getClass().getName(), 2000); if (commPort instanceof SerialPort) { serialPort = (SerialPort) commPort; serialPort.setSerialPortParams(baudRate, SerialPort.DATABITS_8, SerialPort.STOPBITS_1, SerialPort.PARITY_NONE); outputStream = serialPort.getOutputStream(); } else { System.out.println("Error: Only serial ports are handled "); String onlySerialConnectionMessage = "Serial Ports ONLY!"; JOptionPane.showMessageDialog(null, onlySerialConnectionMessage, "ERROR", JOptionPane.ERROR_MESSAGE); } }//end else //wait some time try { Thread.sleep(300); } catch (InterruptedException ie) { } }//end connect //******************************************************* //*innerclasses****************************************** //******************************************************* public class ConnectionMaker extends Thread { public void run() { //try to make a connection try { connect(); } catch (Exception ex) { ex.printStackTrace(); System.out.print("ERROR: Cannot connect!"); String cantConnectConnectionMessage = "Cannot Connect!\nCheck the connection settings\nand/or your configuration\nand try again!"; JOptionPane.showMessageDialog(null, cantConnectConnectionMessage, "ERROR", JOptionPane.ERROR_MESSAGE); } //show status serialPort.notifyOnDataAvailable(true); connected = true; //send ack System.out.print("\nConnected\n"); String connectedConnectionMessage = "Conectado!"; JOptionPane.showMessageDialog(null, connectedConnectionMessage, "Conectado", JOptionPane.INFORMATION_MESSAGE); }//end run }//end ConnectionMaker /** * This method is called from within the constructor to initialize the form. * WARNING: Do NOT modify this code. The content of this method is always * regenerated by the Form Editor. */ @SuppressWarnings("unchecked") // <editor-fold defaultstate="collapsed" desc="Generated Code"> private void initComponents() { btnp2 = new javax.swing.JButton(); btncon = new javax.swing.JButton(); btndesc = new javax.swing.JButton(); btnp3 = new javax.swing.JButton(); btnp4 = new javax.swing.JButton(); btnp5 = new javax.swing.JButton(); btnp9 = new javax.swing.JButton(); btnp6 = new javax.swing.JButton(); btnp7 = new javax.swing.JButton(); btnp8 = new javax.swing.JButton(); btn13 = new javax.swing.JButton(); btnp10 = new javax.swing.JButton(); btnp11 = new javax.swing.JButton(); btnp12 = new javax.swing.JButton(); setDefaultCloseOperation(javax.swing.WindowConstants.EXIT_ON_CLOSE); btnp2.setText("2"); btnp2.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp2MouseClicked(evt); } }); btncon.setText("Conectar"); btncon.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnconMouseClicked(evt); } }); btndesc.setText("Desconectar"); btndesc.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btndescMouseClicked(evt); } }); btnp3.setText("3"); btnp3.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp3MouseClicked(evt); } }); btnp4.setText("4"); btnp4.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp4MouseClicked(evt); } }); btnp5.setText("5"); btnp5.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp5MouseClicked(evt); } }); btnp9.setText("9"); btnp9.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp9MouseClicked(evt); } }); btnp6.setText("6"); btnp6.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp6MouseClicked(evt); } }); btnp7.setText("7"); btnp7.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp7MouseClicked(evt); } }); btnp8.setText("8"); btnp8.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp8MouseClicked(evt); } }); btn13.setText("13"); btn13.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btn13MouseClicked(evt); } }); btnp10.setText("10"); btnp10.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp10MouseClicked(evt); } }); btnp11.setText("11"); btnp11.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp11MouseClicked(evt); } }); btnp12.setText("12"); btnp12.addMouseListener(new java.awt.event.MouseAdapter() { public void mouseClicked(java.awt.event.MouseEvent evt) { btnp12MouseClicked(evt); } }); javax.swing.GroupLayout layout = new javax.swing.GroupLayout(getContentPane()); getContentPane().setLayout(layout); layout.setHorizontalGroup( layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGroup(layout.createSequentialGroup() .addGap(20, 20, 20) .addGroup(layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING, false) .addGroup(layout.createSequentialGroup() .addComponent(btncon) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED, javax.swing.GroupLayout.DEFAULT_SIZE, Short.MAX_VALUE) .addComponent(btndesc)) .addGroup(layout.createSequentialGroup() .addComponent(btnp6, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btnp7, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btnp8, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btnp9, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE)) .addGroup(layout.createSequentialGroup() .addComponent(btnp10, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btnp11, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btnp12, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btn13, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE)) .addGroup(layout.createSequentialGroup() .addComponent(btnp2, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btnp3, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btnp4, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED) .addComponent(btnp5, javax.swing.GroupLayout.PREFERRED_SIZE, 50, javax.swing.GroupLayout.PREFERRED_SIZE))) .addContainerGap(20, Short.MAX_VALUE)) ); layout.setVerticalGroup( layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addGroup(layout.createSequentialGroup() .addContainerGap() .addGroup(layout.createParallelGroup(javax.swing.GroupLayout.Alignment.BASELINE) .addComponent(btncon) .addComponent(btndesc)) .addPreferredGap(javax.swing.LayoutStyle.ComponentPlacement.RELATED, 20, Short.MAX_VALUE) .addGroup(layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addComponent(btnp2) .addComponent(btnp3) .addComponent(btnp4) .addComponent(btnp5)) .addGap(18, 18, 18) .addGroup(layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addComponent(btnp6) .addComponent(btnp7) .addComponent(btnp8) .addComponent(btnp9)) .addGap(18, 18, 18) .addGroup(layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING) .addComponent(btnp10) .addComponent(btnp11) .addComponent(btnp12) .addComponent(btn13)) .addGap(22, 22, 22)) ); pack(); }// </editor-fold> private void btnp2MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p2"); } private void btnconMouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("connect"); } private void btndescMouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("disconnect"); } private void btnp3MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p3"); } private void btnp4MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p4"); } private void btnp5MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here action("p5"); } private void btnp9MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p9"); } private void btnp6MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p6"); } private void btnp7MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p7"); } private void btnp8MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p8"); } private void btn13MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p13"); } private void btnp10MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p10"); } private void btnp11MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p11"); } private void btnp12MouseClicked(java.awt.event.MouseEvent evt) { // TODO add your handling code here: action("p12"); } /** * @param args the command line arguments */ public static void main(String args[]) throws IOException { /* Set the Nimbus look and feel */ //<editor-fold defaultstate="collapsed" desc=" Look and feel setting code (optional) "> /* If Nimbus (introduced in Java SE 6) is not available, stay with the default look and feel. * For details see http://download.oracle.com/javase/tutorial/uiswing/lookandfeel/plaf.html */ try { for (javax.swing.UIManager.LookAndFeelInfo info : javax.swing.UIManager.getInstalledLookAndFeels()) { if ("Nimbus".equals(info.getName())) { javax.swing.UIManager.setLookAndFeel(info.getClassName()); break; } } } catch (Exception e) { } //</editor-fold> /* Create and display the form */ java.awt.EventQueue.invokeLater(new Runnable() { public void run() { new BDArduino().setVisible(true); } }); //} while (true) { // int sql8 = Integer.parseInt(Sql.getDBinfo("SELECT * FROM arduinoData WHERE id=1", "pin8")); if (connected == true && sql8 != aux_sql8) { aux_sql8 = sql8; if(sql8 == 1){ writeData(2); }else{ writeData(3); } } int sql2 = Integer.parseInt(Sql.getDBinfo("SELECT * FROM arduinoData WHERE id=1", "pin2")); if (connected == true && sql2 != aux_sql2) { aux_sql2 = sql2; if(sql2 == 1){ writeData(4); }else{ writeData(5); } } try { Thread.sleep(500); } catch (InterruptedException e) { e.printStackTrace(); } } } // Variables declaration - do not modify private javax.swing.JButton btn13; private javax.swing.JButton btncon; private javax.swing.JButton btndesc; private javax.swing.JButton btnp10; private javax.swing.JButton btnp11; private javax.swing.JButton btnp12; private javax.swing.JButton btnp2; private javax.swing.JButton btnp3; private javax.swing.JButton btnp4; private javax.swing.JButton btnp5; private javax.swing.JButton btnp6; private javax.swing.JButton btnp7; private javax.swing.JButton btnp8; private javax.swing.JButton btnp9; // End of variables declaration }

    Read the article

  • How to extract specific variables from a string?

    - by David
    Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

    Read the article

  • unicode data with custom font doesn't work properly in ipad

    - by David Ohanyan
    I am using custom font for label and string which I am getting from unicode characters. And the font is not changing. here is the snippet of my code: NSString* str = @"\u05D0\u05D1\u05D2"; [mMatchingLabel setText:str]; mMatchingLabel.font = [UIFont fontWithName:@"David New Hebrew" size:26]; But when I write for example : NSString* str = @"label"; [mMatchingLabel setText:str]; mMatchingLabel.font = [UIFont fontWithName:@"David New Hebrew" size:26]; The font effect is evident. Can someone explain what's here wrong?

    Read the article

  • MaxStartups and MaxSessions configurations parameter for ssh connections?

    - by Webby
    I am copying the files from machineB and machineC into machineA as I am running my below shell script on machineA. If the files is not there in machineB then it should be there in machineC for sure so I will try copying the files from machineB first, if it is not there in machineB then I will try copying the same files from machineC. I am copying the files in parallel using GNU Parallel library and it is working fine. Currently I am copying 10 files in parallel. Below is my shell script which I have - #!/bin/bash export PRIMARY=/test01/primary export SECONDARY=/test02/secondary readonly FILERS_LOCATION=(machineB machineC) export FILERS_LOCATION_1=${FILERS_LOCATION[0]} export FILERS_LOCATION_2=${FILERS_LOCATION[1]} PRIMARY_PARTITION=(550 274 2 546 278) # this will have more file numbers SECONDARY_PARTITION=(1643 1103 1372 1096 1369 1568) # this will have more file numbers export dir3=/testing/snapshot/20140103 find "$PRIMARY" -mindepth 1 -delete find "$SECONDARY" -mindepth 1 -delete do_Copy() { el=$1 PRIMSEC=$2 scp david@$FILERS_LOCATION_1:$dir3/new_weekly_2014_"$el"_200003_5.data $PRIMSEC/. || scp david@$FILERS_LOCATION_2:$dir3/new_weekly_2014_"$el"_200003_5.data $PRIMSEC/. } export -f do_Copy parallel --retries 10 -j 10 do_Copy {} $PRIMARY ::: "${PRIMARY_PARTITION[@]}" & parallel --retries 10 -j 10 do_Copy {} $SECONDARY ::: "${SECONDARY_PARTITION[@]}" & wait echo "All files copied." Problem Statement:- With the above script at some point I am getting this exception - ssh_exchange_identification: Connection closed by remote host ssh_exchange_identification: Connection closed by remote host ssh_exchange_identification: Connection closed by remote host And I guess the error is typically caused by too many ssh/scp starting at the same time. That leads me to believe /etc/ssh/sshd_config:MaxStartups and MaxSessions is set too low. But my question is on which server it is pretty low? machineB and machineC or machineA? And on what machines I need to increase the number? On machineA this is what I can find - root@machineA:/home/david# grep MaxStartups /etc/ssh/sshd_config #MaxStartups 10:30:60 root@machineA:/home/david# grep MaxSessions /etc/ssh/sshd_config And on machineB and machineC this is what I can find - [root@machineB ~]$ grep MaxStartups /etc/ssh/sshd_config #MaxStartups 10 [root@machineB ~]$ grep MaxSessions /etc/ssh/sshd_config #MaxSessions 10

    Read the article

  • Duplicate content issue after URL-change with 301-redirects

    - by David
    We got the following problem: We changed all URLs on our page from oldURL.html to newURL.html and set up 301-redirects (ca. 600 URLs) Google re-crawled our page, indexed all the new URLs (newURL.html), but didn't crawl the old URLs (oldURL.html) again, as there were no internal links pointing at those domains anymore after the URL-change. This resulted in massive ranking-drops, etc. because (i) Google thought oldURL.html has exactly the same content as newURL, causing duplicate content issues, and (ii) Google did not transfer the juice from oldURL to newURL, because the 301-redirect was never noticed. Now we reset all internal Links to the old URLs again, which then redirect to the newURLs, in the hope that Google would re-crawl the pages, once there are internal links pointing at them. This is partially happening, but at a really low speed, so it would take multiple months to notice all-redirects. I guess, because Google thinks: "Aah, I already know oldURL.html, so no need to re-crawl it. Possible solutions we thought of are ... Submitting as many of the old URLs to the index as possible via Webmaster Tools, to manually trigger a crawl. Doing that already Submitting a sitemap with all old URLs - but not sure if good idea, because Google does not seem to like 301-redirects in a sitemap ... Both solutions are not perfect - and we cannot wait for three months, just to regain our old rankings. What are your ideas? Best, David

    Read the article

  • The emergence of Atlassian's Bamboo (and a free SQL Source Control license offer!)

    - by David Atkinson
    The rise in demand for database continuous integration has forced me to skill-up in various new tools and technologies, particularly build servers. We have been using JetBrain's TeamCity here at Red Gate for a couple of years now, having replaced the ageing CruiseControl.NET, so it was a natural choice for us to use this for our database CI demos. Most of our early adopter customers have also transitioned away from CruiseControl, the majority to TeamCity and Microsoft's TeamBuild. However, more recently, for reasons we've yet to fully comprehend, we've observed a significant surge in the number of evaluators for Atlassian's Bamboo. I installed this a couple of weeks back to satisfy myself that it works seamlessly with Red Gate tools. As you would expect Bamboo's UI has the same clean feel found in any Atlassian tool (we use JIRA extensively here at Red Gate). In the coming weeks I will post a short step-by-step guide to setting up SQL Server continuous integration using the Red Gate command lines. To help us further optimize the integration between these tools I'd be very keen to hear from any Bamboo users who also use Red Gate tools who might be willing to participate in usability tests and other similar research in exchange for Amazon vouchers. If you are interested in helping out please contact me at David dot Atkinson at red-gate.com I recently spoke with Sarah, the product marketing manager for Bamboo, and we ended up having a detailed conversation about database CI, which has been meticulously documented in the form of a blog post on Atlassian's website: http://blogs.atlassian.com/2012/05/database-continuous-integration-redgate/ We've also managed to persuade Red Gate marketing to provide a great free-tool offer, provide a free SQL Source Control or SQL Connect license to Atlassian users provided it is claimed before the end of June! Full details are at the bottom of the post. Technorati Tags: sql server

    Read the article

  • Trying to format drive fails

    - by david
    since I will be doing an internship for which i need to use Windows software, I have decided to ruin my day trying to remove my Ubuntu 12.04, install Win XP SP3 (since the DualBoot theme from ubuntu suggests to first install Windows and then Ubuntu, for problems with the bootloader if you do it the other way around) and then reinstall Ubuntu 12.04 since I would like to keep using it as my primary operating system, using WinXP exclusively for the internship. Other than that, I would like to have a partition for the data, which can be used by both Ubuntu and Windows. So now, I have used the disk utility run from an ubuntu-live cd to format my drive with Master Boot Record (being conscious of the fact that this way I will lose all my data, which I have saved on an external drive before, and that my Ubuntu won't work anymore afterwards), creating partitions for Windows (NTFS), personal data (FAT, since as far as I know both Ubuntu and Windows can deal with this), a Swap partition for Linux, and one partition for Ubuntu (ext4); trying to install Win XP from cd gives me a blue screen, which stops the setup and telling me to remove all recently installed drives and to run CHKDSK. So I thought, that maybe Windows doesn't like pre-partitioned drives for its installation and thus I need to re-format my hard drive in order to have a completely "new" drive, which I can then, during the Windows-installation, partition in order to create the partitions I need. Trying to do this, though, the disk-utility run from the live-CD gives me this warning: Error creating partition table: helper exited with exit code 1: In part_create_partition_table: device_file=/dev/sda, scheme=0 got it got disk committed to disk BLKRRPART ioctl failed for /dev/sda: Device or resource busy I do not understand why it tells me that the hard-drive is busy, because, as stated above, I am doing all this from a live-CD. Thus, my questions are: How can I resolve the error given by the disk utility? Does it make sense to use four partitions in the way mentioned above? And if not so, which partitions should I create? Can I, theoretically, partition my drive from an Ubuntu live-cd in order to create the partitions I want and to install first Windows and then Ubuntu? Thanks for any help, David

    Read the article

  • Windows Intune, Cloud Desktop management

    - by David Nudelman
    As a part of Microsoft Cloud computing strategy, Windows Intune beta was released today. Here’s a quick overview of what customers and IT consultants can do with the cloud service component of Windows Intune: Manage PCs through web-based console: Windows Intune provides a web-based console for IT to administrate their PCs. Administrators can manage PCs from anywhere. Manage updates: Administrators can centrally manage the deployment of Microsoft updates and service packs to all PCs. Protection from malware: Windows Intune helps protect PCs from the latest threats with malware protection built on the Microsoft Malware Protection Engine that you can manage through the Web-based console. Proactively monitor PCs: Receive alerts on updates and threats so that you can proactively identify and resolve problems with your PCs—before it impacts end users and your business. Provide remote assistance: Resolve PC issues, regardless of where you or your users are located, with remote assistance. Track hardware and software inventory: Track hardware and software assets used in your business to efficiently manage your assets, licenses, and compliance. Set security policies: Centrally manage update, firewall, and malware protection policies, even on remote machines outside the corporate network. And here a quick video about Windows Intune For support and questions go to : TechNet Forums for Intune Regards, David Nudelman

    Read the article

  • The emergence of Atlassian's Bamboo (and a free SQL Source Control license offer!)

    - by David Atkinson
    The rise in demand for database continuous integration has forced me to skill-up in various new tools and technologies, particularly build servers. We have been using JetBrain's TeamCity here at Red Gate for a couple of years now, having replaced the ageing CruiseControl.NET, so it was a natural choice for us to use this for our database CI demos. Most of our early adopter customers have also transitioned away from CruiseControl, the majority to TeamCity and Microsoft's TeamBuild. However, more recently, for reasons we've yet to fully comprehend, we've observed a significant surge in the number of evaluators for Atlassian's Bamboo. I installed this a couple of weeks back to satisfy myself that it works seamlessly with Red Gate tools. As you would expect Bamboo's UI has the same clean feel found in any Atlassian tool (we use JIRA extensively here at Red Gate). In the coming weeks I will post a short step-by-step guide to setting up SQL Server continuous integration using the Red Gate command lines. To help us further optimize the integration between these tools I'd be very keen to hear from any Bamboo users who also use Red Gate tools who might be willing to participate in usability tests and other similar research in exchange for Amazon vouchers. If you are interested in helping out please contact me at David dot Atkinson at red-gate.com I recently spoke with Sarah, the product marketing manager for Bamboo, and we ended up having a detailed conversation about database CI, which has been meticulously documented in the form of a blog post on Atlassian's website: http://blogs.atlassian.com/2012/05/database-continuous-integration-redgate/ We've also managed to persuade Red Gate marketing to provide a great free-tool offer, provide a free SQL Source Control or SQL Connect license to Atlassian users provided it is claimed before the end of June! Full details are at the bottom of the post. Technorati Tags: sql server

    Read the article

  • DNS NAmeserver Aname and cname records

    - by David
    Hi - I am inexperienced in the configuration of DNS and have an issue with dominan hosting set up. I have two domains 'www.mydomain1.com' and 'www.mydomain2.com', with mydomain2 pointed at the same place as mydomain1. The domains were passed to me recently by the person who previoulsy controlled them. I have an account with fasthosts in the uk. When I accepted the domains I could not access the DNS settings and enquired with fasthosts as to why. The replied saying 'The delegate hosting option for both domains were enabled and this is the reason why you were unable to find the option to edit the advanced DNS records. I have now disabled the delegate hosting option so you can now edit the advanced DNS records for both domains in your account.' When i log into the fasthost control panel now i can access the DNS controls but both domains have no A Record of Cname record set up. I am concerned that fasthosts have blatted the previous Nameserver entries and set me up on theirs but not added any record. 'www.mydomain1.com' currently still works but 'www.mydomain2.com' does not find the site anymore. i am worried i will lose mydomain1 to as teh dns changes filter through the system. my webhosting is at 'xxx.xxx.xxx.xxx/mydomain1.com/' and this is where I want both domains to point. Any advice would be much appreciated. one thing which is confusing me is that because I am on a shared server I have to put 'xxx.xxx.xxx.xxx/mydomain1.com/' to get to my site rather than just 'xxx.xxx.xxx.xxx'. The form on fasthosts for the aname record only allows an IP to be entered - does it add the mydomain1.com/ onto the end itself? Thanks for any help given - I'm quite worried about this David

    Read the article

  • Découvrir la solution d'exploration de données structuré et non structuré

    - by David lefranc
    Explorer et découvrir l’information… Nous vous proposons un atelier découverte pour vous permettre d’explorer toute type de données grâce à la solution Oracle Endeca . Quand : 7 Décembre 2012 De 9h30 à 12h30  Lieu : Oracle 15 Boulevard Charles de gaulle 92715 Colombes Pour s'inscrire : David[email protected] Réalisé pour des utilisateurs métiers, cet atelier vous permettera en une demi journée , de découvrir Oracle Endeca Information Discovery afin de : Comprendre et explorer toute information venant de différents horizons ( Big Data, réseaux sociaux, forums, sondages, blogs..) Découvrir en quoi et comment OEID est un complément à des solutions de BI classiques Par une navigation simple et rapide, vous découvrirez combien il est facile de trouver des réponses à des questions imprévues en utilisant OEID sans formation préalable. Utilisez la recherche et la navigation guidée pour voir comment les informations structurées et non structurées peuvent être rapidement réunies pour dégager la valeur cachée. Explorer toutes vos données dans n'importe quel format et à partir de n'importe quelle source, y compris les médias sociaux, documents, fichiers,…. Pouvoir découvrir et explorer vos données sans référentiel pour permettre aux utilisateurs d’être autonome et d’analyser leurs propres données de manière rapide Élaborer une stratégie visant à accroître la valeur des données de l'entreprise tout en réduisant le coût total de possession Découvrez l'incroyable performance d’ Endeca sur Oracle Exalytics la machine In Memory AgendaAprès une introduction sur la solution Oracle information Endeca, suivi d’un atelier, vous verrez comment il est facile de: Utiliser la navigation guidée et le moteur de recherche pour explorer les données structurées et non structurées intégrer rapidement les nouvelles sources de données comme les médias sociaux Construire de nouvelles interfaces utilisateur tout en découvrant l’information répondre rapidement aux besoins changeants des entreprises et des environnements de données

    Read the article

  • pdflatex reads .eps files saved in OS/X, but not in Ubuntu

    - by David B Borenstein
    Sorry if this is a stupid question; I'm a newbie. I am preparing a manuscript in LaTeX. The journal (Physical Biology, an IOP publication) requires that figures be saved in .eps format, so I am trying to do that. However, I cannot get my LaTeX file to build when I have generated the .eps files on my Ubuntu computer. If I save the images on my Mac, the file build just fine. So far, I have tried saving images in ImageJ, FIJI and Inkscape. The same problem occurs in all three. When using kile, I get the following error: /usr/share/texmf-texlive/tex/latex/oberdiek/epstopdf-base.sty:0: Shell escape feature is not enabled. In TexWorks, the error is different, but still there: Package pdftex.def Error: File `./figures4/figure4a-eps-converted-to.pdf' not found. Now, if I fire up Inkscape, FIJI or ImageJ on OS/X, everything works fine. The Mac also can't build with the Ubuntu-saved images. The images generated on the Ubuntu machine open fine using Document Viewer. I am building the same LaTeX file on both computers, with the exact same results. The header of my LaTeX file is: \documentclass[12pt]{iopart} \usepackage{graphicx} \usepackage{epstopdf} \usepackage{parskip} \usepackage{color} \usepackage{iopams} And then the code for the figure is: \begin{figure} \center{\includegraphics[width=4in] {./figures4/figure4a.eps}} \footnotesize{\caption{ \label{fig:4a} (4a) lorem ipsum dolor sic amet.}} \end{figure} I'd be happy to send an example of both .eps files. Again, sorry if this is a dumb question. I tried everything I could think of before posting here. Thanks, David

    Read the article

  • DNS NAmeserver Aname and cname records [closed]

    - by David
    I am inexperienced in the configuration of DNS and have an issue with dominan hosting set up. I have two domains 'www.mydomain1.com' and 'www.mydomain2.com', with mydomain2 pointed at the same place as mydomain1. The domains were passed to me recently by the person who previoulsy controlled them. I have an account with Fasthosts in the UK. When I accepted the domains I could not access the DNS settings and inquired with fasthosts as to why. The reply was: The delegate hosting option for both domains were enabled and this is the reason why you were unable to find the option to edit the advanced DNS records. I have now disabled the delegate hosting option so you can now edit the advanced DNS records for both domains in your account. When I log into the Fasthost control panel now I can access the DNS controls but both domains have no A record or Cname record set up. I am concerned that Fasthosts have blatted the previous Nameserver entries and set me up on theirs but not added any record. 'www.mydomain1.com' currently still works but 'www.mydomain2.com' does not find the site anymore. I am worried I will lose mydomain1 to as the DNS changes filter through the system. my webhosting is at 'xxx.xxx.xxx.xxx/mydomain1.com/' and this is where I want both domains to point. Any advice would be much appreciated. One thing which is confusing me is that because I am on a shared server I have to put 'xxx.xxx.xxx.xxx/mydomain1.com/' to get to my site rather than just 'xxx.xxx.xxx.xxx'. The form on Fasthosts for the A name record only allows an IP to be entered - does it add the mydomain1.com/ onto the end itself? Thanks for any help given - I'm quite worried about this David

    Read the article

  • Compiz Fusion And Unity Tool

    - by David Michael Rice
    I tried to install compiz fusion on ubuntu studio 13 and all I got was this Some packages could not be installed. This may mean that you have requested an impossible situation or if you are using the unstable distribution that some required packages have not yet been created or been moved out of Incoming. The following information may help to resolve the situation: The following packages have unmet dependencies: compiz-fusion-plugins-extra:i386 : Depends: compiz-core:i386 but it is not going to be installed Depends: compiz-fusion-plugins-main:i386 but it is not going to be installed Recommends: compizconfig-settings-manager:i386 but it is not going to be installed compiz-gnome : Depends: libcompizconfig0 but it is not going to be installed compizconfig-settings-manager : Depends: python-compizconfig (>= 1:0.9.9~daily13.04.18.1~13.04-0ubuntu1) but it is not going to be installed libcompizconfig-backend-gconf:i386 : Depends: libcompizconfig0:i386 but it is not going to be installed E: Unable to correct problems, you have held broken packages. david@Nebuchadnezzar:~$ Also I installed Unity tweak tool through the software center, and now I cannot find it at all, not even in search apps. I feel like every time I try to install something I have to jump through flaming hoops...

    Read the article

  • Atelier gratuit : Découvrir la solution d'exploration de données structuré et non structuré

    - by David lefranc
    Explorer et découvrir l’information… Nous vous proposons un atelier découverte pour vous permettre d’explorer toute type de données grace à la solution Oracle Endeca Information Discovery. Quand : 7 Décembre 2012 De 9h30 à 12h30  Lieu : Oracle 15 Boulevard Charles de gaulle 92715 Colombes Pour s'inscrire : David[email protected] Réalisé pour des utilisateurs métiers, cet atelier vous permettera en une demi journée , de découvrir Oracle Endeca Information Discovery afin de : Comprendre et explorer toute information venant de différents horizons ( Big Data, réseaux sociaux, forums, sondages, blogs..) Découvrir en quoi et comment OEID est un complément à des solutions de BI classiques Par une navigation simple et rapide, vous découvrirez combien il est facile de trouver des réponses à des questions imprévues en utilisant OEID sans formation préalable. Utilisez la recherche et la navigation guidée pour voir comment les informations structurées et non structurées peuvent être rapidement réunies pour dégager la valeur cachée. Explorer toutes vos données dans n'importe quel format et à partir de n'importe quelle source, y compris les médias sociaux, documents, fichiers,…. Pouvoir découvrir et explorer vos données sans référentiel pour permettre aux utilisateurs d’être autonome et d’analyser leurs propres données de manière rapide Élaborer une stratégie visant à accroître la valeur des données de l'entreprise tout en réduisant le coût total de possession Découvrez l'incroyable performance d’ Endeca sur Oracle Exalytics la machine In Memory Agenda Après une introduction sur la solution Oracle information Endeca, suivi d’un atelier, vous verrez comment il est facile de: Utiliser la navigation guidée et le moteur de recherche pour explorer les données structurées et non structurées intégrer rapidement les nouvelles sources de données comme les médias sociaux Construire de nouvelles interfaces utilisateur tout en découvrant l’information répondre rapidement aux besoins changeants des entreprises et des environnements de données Quand Lieu 7 Décembre 2012 De 9h30 à 12h30 Oracle 15 Boulevard Charles de gaulle 92715 Colombes

    Read the article

  • Wessty: Live with HTML 5 (2011 Speaker Tour)

    - by David Wesst
    That’s right: Wessty is on tour. Okay, the banner and the tour is a little over the top, but I am really excited about my upcoming speaking engagements to spread the word about HTML 5! I have already kicked off the tour with the Winnipeg Code Camp last weekend with the world premiere of HTML 5 for .NET Pro presentation, and the turn out fantastic. It was the last presentation of the day, but we still had some great questions about the new standard and got to see how HTML 5 can fit into .NET web applications today. In any case, above you can see the confirmed presentations that I will be doing so far in 2011, but there are a few more events that I have heard about that I hope to add to that list. Ultimately, expect that list to be updated over the course of the year as the year is young and there are plenty of conferences coming up! Presentation Resources As the tour continues, I will be posting the slides and the source code for the demonstrations up here on my site. They will be free of charge and give you the chance to review the demos and hopefully take advantage of some of the cool things you see in the presentations. Become part of the Tour If you are considering hosting an event where you think that HTML 5 could use a voice, drop me a line and let me know. I am always looking for opportunities to grow the tour to talk not just about HTML 5, but a variety of topics that relate to user interface and user experience development. This post also appears at http://david.wes.st

    Read the article

  • Rankings dropping after small URL-change WITH 301-redirect

    - by David
    Two weeks ago, we attempted to make the URLs of ca. 12 pages more search-engine friendly. We changed three things. 1. Make URLs more SEF from: /????-????/brandname.html (meaning: /aircon-price/daikin.html to: /????-brandnameinenglish-brandnameinthai.html We set up 301-redirects from the old to the new URLs. You can find an example and the link to our page here: http://bit.ly/XRoTOK There are no direct external links to the old URLs. 2. Added text to img-links from homepage to brand-pages Before those changes, we only linked to those brands with a picture, so we added some text under the picture. You can see that here, in the left submenu: http://bit.ly/XRpfoF 3. Minor changes to Title, h1-Tags, Meta Description, etc. Only minor changes, to better match the on-site optimization with targeted keywords. For example, before we used full brand names, after we used what was really searched for: from: Mitsubishi Electric Mr. Slim to: ???? Mitsubishi (means: Aircon Mitsubishi) Three days after these changes, we noticed a heavy drop (80% loss in non-paid search traffic) in rankings and traffic for those pages, and also for all pages which are sub-categorized. Rankings for all keywords not affected by the changes stayed the same. Any ideas, what happened, and how we can regain our old rankings? What we already did, was submitting a new sitemap. Help much appreciated. Best regards, David

    Read the article

  • REMINDER: ATG Live Webcast Nov. 15: Best Practices for Using EBS SDK for Java with Oracle ADF

    - by Bill Sawyer
    Thursday, November 15th is your chance to join Sara Woodhull and Juan Camilo Ruiz as they discuss  Best Practices for Using EBS SDK for Java with Oracle ADF. You can find the complete event details at ATG Live Webcast: Best Practices for Using EBS SDK for Java with Oracle ADF Date:               Thursday, November 15, 2012Time:              8:00 AM - 9:00 AM Pacific Standard TimePresenters:   Sara Woodhull, Principal Product Manager, E-Business Suite ATG                         Juan Camilo Ruiz, Principal Product Manager, ADF Webcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:    Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103192To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  591862924 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • Can't restore backup from SQL Server 2008 R2 to SQL Server 2005 or 2008

    - by Erick
    Hi everyone, I'm trying to get a backup from SQL Server 2008 R2 restored to SQL Server 2008, but when we try to do the restore we get this: The database was backed up on a server running version 10.50.1092. That version is incompatible with this server, which is running version 10.00.2531. Either restore the database on a server that supports the backup, or use a backup that is compatible with this server. I can use the script wizard to generate a script, but that takes over an hour to run. I also tried just exporting the data from server to server, but it had issues with the primary keys/identity columns. I will be running into this issue with several other clients so any help you could offer about how to get around this would be great. Thanks for your help!

    Read the article

  • Compare two NTP servers

    - by David Turner
    Hi, I want to compare the time used by our internal servers against time.microsoft.com. Is there an easy way to do this? Basically a third party sends me messages stamped with a time that has been synced iwth time.microsoft.com, unfortunately our servers are using a different time server, so I want to calculate if there is a significant difference between the our NTP synced time, and theirs. Is there a simple way to accurately compare times? regards, David.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Flash movie randomly freeze the browser

    - by Erick
    Just recently it seems that my flash player have had some troubles to display flash videos (youtube/dailymotions and others like this). This issue was supposed to be fixed with Flash Player 10 beta if I remember correctly. My flash player is currently at the lastest version available (10.0.45.2) I'm currently on Windows 7 x64. I tried to uninstall it and reboot and reinstall it, didn't work. Sometimes when it freeze and I reboot it "fixes" temporary the problem. The freeze problem is each and every browser. If one fails and freeze, every browsers using the plugin or ActiveX (Opera 10.5/Chrome 5/Safari 4/IE 8/FF 3.7 all installed) will freeze upon playing. I'm quite out of inspirations for fixing this up now I dare say.

    Read the article

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >