Search Results

Search found 7651 results on 307 pages for 'pattern matching'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 5/307 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Extract string between matching braces in Perl

    - by Srilesh
    My input file is as below : HEADER {ABC|*|DEF {GHI 0 1 0} {{Points {}}}} {ABC|*|DEF {GHI 0 2 0} {{Points {}}}} {ABC|*|XYZ:abc:def {GHI 0 22 0} {{Points {{F1 1.1} {F2 1.2} {F3 1.3} {F4 1.4}}}}} {ABC|*|XYZ:ghi:jkl {JKL 0 372 0} {{Points {}}}} {ABC|*|XYZ:mno:pqr {GHI 0 34 0} {{Points {}}}} { ABC|*|XYZ:abc:pqr {GHI 0 68 0} {{Points {{F1 11.11} {F2 12.10} {F3 14.11} {F4 16.23}}}} } TRAILER I want to extract the file into an array as below : $array[0] = "{ABC|*|DEF {GHI 0 1 0} {{Points {}}}}" $array[1] = "{ABC|*|DEF {GHI 0 2 0} {{Points {}}}}" $array[2] = "{ABC|*|XYZ:abc:def {GHI 0 22 0} {{Points {{F1 1.1} {F2 1.2} {F3 1.3} {F4 1.4}}}}}" .. .. $array[5] = "{ ABC|*|XYZ:abc:pqr {GHI 0 68 0} {{Points {{F1 11.11} {F2 12.10} {F3 14.11} {F4 16.23}}}} }" Which means, I need to match the first opening curly brace with its closing curly brace and extract the string in between. I have checked the below link, but this doesnt apply to my question. http://stackoverflow.com/questions/413071/regex-to-get-string-between-curly-braces-i-want-whats-between-the-curly-braces I am trying but would really help if someone can assist me with their expertise ... Thanks Sri ...

    Read the article

  • OpenCV shape matching

    - by MAckerman
    I'm new to OpenCV (am actually using Emgu CV C# wrapper) and am attempting to do some object detection. I'm attempting to determine if an object matches a predefined set of objects (that I will have to define). The background is well lit and does not move. My objects that I am starting with are bottles and cans. My current approach is: Do absDiff with a previously taken background image to separate the background. Then dilate 4x to make the lighter areas (in labels) shrink. Then I do a binary threshold to get a big blog, followed by finding contours in this image. I then take the largest contour and draw it, which becomes my shape to either save to the accepted set or compare with the accepted set. Currently I'm using cvMatchShapes, but the double return value seems to vary widely. I'm guessing it is because it doesn't take into account rotation. Is this approach a good one? It isn't working well for glass bottles since the edges are hard to find... I've read about haar classifiers, but thinking that might be overkill for my task.

    Read the article

  • Excel Matching problem with logic expression

    - by abelenky
    (I understand Excel is only borderline programming) I have a block of data that represents the steps in a process and the possible errors: ProcessStep Status FeesPaid OK FormRecvd OK RoleAssigned OK CheckedIn Not Checked In. ReadyToStart Not Ready for Start I want to find the first Status that is not "OK". I have attempted this: =Match("<>""OK""", StatusRange, 0) which is supposed to return the index of the first element in the range that is NOT-EQUAL (<) to "OK" But this doesn't work, instead returning #N/A. I expect it to return 4 (index #4, in a 1-based index, representing that CheckedIn is the first non-OK element) Any ideas how to do this?

    Read the article

  • F# pattern matching when mixing DU's and other values

    - by Roger Alsing
    What would be the most effective way to express the following code? match cond.EvalBool() with | true -> match body.Eval() with | :? ControlFlowModifier as e -> match e with | Break(scope) -> e :> obj //Break is a DU element of ControlFlowModifier | _ -> next() //other members of CFM should call next() | _ -> next() //all other values should call next() | false -> null cond.EvalBool returns a boolean result where false should return null and true should either run the entire block again (its wrapped in a func called next) or if the special value of break is found, then the loop should exit and return the break value. Is there any way to compress that block of code to something smaller?

    Read the article

  • Scala: Matching optional Regular Expression groups

    - by Brian Heylin
    I'm trying to match on an option group in Scala 2.8 (beta 1) with the following code: import scala.xml._ val StatementPattern = """([\w\.]+)\s*:\s*([+-])?(\d+)""".r def buildProperty(input: String): Node = input match { case StatementPattern(name, value) => <propertyWithoutSign /> case StatementPattern(name, sign, value) => <propertyWithSign /> } val withSign = "property.name: +10" val withoutSign = "property.name: 10" buildProperty(withSign) // <propertyWithSign></propertyWithSign> buildProperty(withoutSign) // <propertyWithSign></propertyWithSign> But this is not working. What is the correct way to match optional regex groups?

    Read the article

  • Eliminating matching values in a SQL result set

    - by Burgess Taylor
    I have a table with a list of transactions (invoices and credits) and I need to get a list of all the rows where the invoices and credits don't match up. eg user product value bill ThingA 200 jim ThingA -200 sue ThingB 100 liz ThingC 50 I only want to see the third and fourth rows, as the values of the others match off. I can do this if I select product, sum(value) ... group by product having sum(value) < 0 which works well, but I want to return the user name as well. As soon as I add the user to the select, I need to group by it as well, which messes it up as the amounts don't match up by user AND product. Any ideas ? I am using MS SQL 2000... Cheers

    Read the article

  • Haskell: Pattern Matching with Lists

    - by user1670032
    I'm trying to make a function that takes in a list, and if one of the elements is negative, then any elements in that list that are equal to its positive counterpart should be changed to 0. Eg, if there is a -2 in a list, then all 2's in that list should be changed to 0. Any ideas why it only works for some cases and not others? I'm not understanding why this is, I've looked it over several times. changeToZero [] = [] changeToZero [x] = [x] changeToZero (x:zs:y:ws) | (x < 0) && ((-1)*(x) == y) = x : zs : 0 : changeToZero ws changeToZero (x:xs) = x : changeToZero xs *Main changeToZero [-1,1,-2,2,-3,3] [-1,1,-2,2,-3,3] *Main changeToZero [-2,1,2,3] [-2,1,0,3] *Main changeToZero [-2,1,2,3,2] [-2,1,0,3,2] *Main changeToZero [1,-2,2,2,1] [1,-2,2,0,1]

    Read the article

  • How to implement best matching logic in TSQL (SQL Server 2000)

    - by sanjay-kumar1911
    I have two tables X and Y: Table X C1 C2 C3 1 A 13 2 B 16 3 C 8 Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 N 3 A 12 N 4 A 5 N 5 B 7 N 6 B 16 N 7 B 9 N 8 B 5 N 9 C 8 N 10 C 2 N 11 C 8 N 12 C 6 N Records in Table Y can be n number CREATE TABLE X(C1 INT, C2 CHAR(1), C3 INT); CREATE TABLE Y(C1 INT, C2 CHAR(1), C3 INT, C4 CHAR(1)); with following data: INSERT INTO X VALUES (1 'A',13 ); INSERT INTO X VALUES (2 'B',16 ); INSERT INTO X VALUES (3 'C',8 ); INSERT INTO Y VALUES (1,'A', 2,'N'); INSERT INTO Y VALUES (2,'A', 8,'N'); INSERT INTO Y VALUES (3,'A', 12,'N'); INSERT INTO Y VALUES (4,'A', 5,'N'); INSERT INTO Y VALUES (5,'B', 7,'N'); INSERT INTO Y VALUES (6,'B', 16,'N'); INSERT INTO Y VALUES (7,'B', 9,'N'); INSERT INTO Y VALUES (8,'B', 5,'N'); INSERT INTO Y VALUES (9,'C', 8,'N'); INSERT INTO Y VALUES (10,'C', 2,'N'); INSERT INTO Y VALUES (11,'C', 8,'N'); INSERT INTO Y VALUES (12,'C', 6,'N'); EXPECTED RESULT Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 Y 3 A 12 N 4 A 5 Y 5 B 7 N 6 B 16 Y 7 B 9 N 8 B 5 N 9 C 8 Y 10 C 2 N 11 C 8 N 12 C 6 N How do I compare value of column C3 in Table X with all possible matches of column C3 of Table Y and to mark records as matched and unmatched in column C4 of Table Y? Possible matches for A (i.e. value of column C2 in Table X) would be (where R is row number i.e. value of column C1 in Table Y): R1, R2, R3, R4, R1+R2, R1+R3, R1+R4, R2+R3, R2+R4, R3+R4, R4+R5, R1+R2+R3, R1+R2+R4, R2+R3+R4, R1+R2+R3+R4

    Read the article

  • Matching a rotated bitmap to a collage image

    - by Dmi
    Hi, My problem is that I have an image of a detailed street map. On this map, there can be a certain small image of a sign (such as a traffic light icon) rotated at any angle, maybe resized. I have this small image in a bitmap. Is there any algorithm or technique by which I can locate this bitmap if a copy of it exists, rotated and maybe resized, in the large collage image? This is similar to the problem with Augmented Reality and locating the marker image, but mine is only 2D with no perspective distortion.

    Read the article

  • Correct syntax for matching a string inside a variable against an array

    - by Jamex
    Hi, I have a variable, $var, that contains a string of characters, this is a dynamic variable that contains the values from inputs. $var could be 'abc', or $var could be 'blu', I want to match the string inside variable against an array, and return all the matches. $array = array("blue", "red", "green"); What is the correct syntax for writing the code in php, my rough code is below $match = preg_grep($var, $array); (incorrect syntax of course) I tried to put quotes and escape slashes, but so far no luck. Any suggestion? TIA

    Read the article

  • Search pattern in string using regex in obj-c

    - by manileo86
    I'm working on a string pattern match algorithm. I use NSRegularExpression for finding the matches. For ex: I've to find all words starting with '#' in a string.. Currently I use the following regex function: static NSRegularExpression *_searchTagRegularExpression; static inline NSRegularExpression * SearchTagRegularExpression() { if (!_searchTagRegularExpression) { _searchTagRegularExpression = [[NSRegularExpression alloc] initWithPattern:@"(?<!\\w)#([\\w\\._-]+)? options:NSRegularExpressionCaseInsensitive error:nil]; } return _searchTagRegularExpression; } and I use it as below: NSRegularExpression *regexp = SearchTagRegularExpression(); [regexp enumerateMatchesInString:searchString options:0 range:stringRange usingBlock:^(NSTextCheckingResult *result, NSMatchingFlags flags, BOOL *stop) { // comes here for every match with range }]; This works properly. But i just want to know if this is the best way. suggest if there's any better alternative...

    Read the article

  • EF Query Object Pattern over Repository Example

    - by Dale Burrell
    I have built a repository which only exposes IEnumerable based mostly on the examples in "Professional ASP.NET Design Patterns" by Scott Millett. However because he mostly uses NHibernate his example of how to implement the Query Object Pattern, or rather how to best translate the query into something useful in EF, is a bit lacking. I am looking for a good example of an implementation of the Query Object Pattern using EF4.

    Read the article

  • Count number of occurrences of a pattern in a file (even on same line)

    - by jrdioko
    When searching for number of occurrences of a string in a file, I generally use: grep pattern file | wc -l However, this only finds one occurrence per line, because of the way grep works. How can I search for the number of times a string appears in a file, regardless of whether they are on the same or different lines? Also, what if I'm searching for a regex pattern, not a simple string? How can I count those, or, even better, print each match on a new line?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to do this Python / MySQL manipulation (match) more efficiently?

    - by NJTechie
    Following is my data : Company Table : ID Company Address City State Zip Phone 1 ABC 123 Oak St Philly PA 17542 7329878901 2 CDE 111 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 KLE 87 Ilk St Plains NY 07654 7376578901 6 AB 1 W.House SField PA 87656 7329878901 Branch Office Table : ID Address City State Zip Phone 1 323 Alk St Philly PA 17542 7329832221 1 171 Joe St Newark NJ 08654 3 287 Foe St Brick NJ 07740 7321178901 3 700 Wall Ocean NJ 07764 7322278901 1 89 Blk St Surrey NY 07154 7376222901 File to be Matched (In MySQL): ID Company Address City State Zip Phone 1 ABC 123 Oak St Philly PA 17542 7329878901 2 AB 171 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 K 87 Ilk St Plains NY 07654 7376578901 Resulting File : ID Company Address City State Zip Phone appendedID 1 ABC 123 Oak St Philly PA 17542 7329878901 [Original record, field always empty] 1 ABC 171 Joe St Newark NJ 08654 1 [Company Table] 1 ABC 323 Alk St Philly PA 17542 7329832221 1 [Branch Office Table] 1 AB 1 W.House SField PA 87656 7329878901 6 [Partial firm and State, Zip match] 2 CDE 111 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 3 GHI 700 Wall Ocean NJ 07764 7322278901 3 3 GHI 287 Foe St Brick NJ 07740 7321178901 3 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 KLE 87 Ilk St Surrey NY 07654 7376578901 5 KLE 89 Blk St Surrey NY 07154 7376222901 5 Requirement : 1) I have to match each firm on the 'File to be Matched' to that of Company and Branch Office tables (MySQL). 2) If there are multiple exact/partial matches, then the ID from Company, Branch Office table is inserted as a new row in the resulting file. 3) Not all the firms will be matched perfectly, in that case I have to match on partial Company names (like 5/8th of the company name) and any of the address fields and insert them in the resulting file. Please help me out in the most efficient solution for this problem.

    Read the article

  • Matching Line Boundaries in a Regular Expression (Pattern.MULTILINE/(?m)) is broken in Java?

    - by Mister M. Bean
    The example on http://www.exampledepot.com/egs/java.util.regex/Line.html gives false for me twice but should'nt! Why? CharSequence inputStr = "abc\ndef"; String patternStr = "abc$"; // Compile with multiline enabled Pattern pattern = Pattern.compile(patternStr, Pattern.MULTILINE); Matcher matcher = pattern.matcher(inputStr); boolean matchFound = matcher.find(); // true // Use an inline modifier to enable multiline mode matchFound = pattern.matches(".*abc$.*", "abc\r\ndef"); // false System.out.println(matchFound); // false matchFound = pattern.matches("(?m).*abc$.*", "abc\r\ndef"); // true System.out.println(matchFound);// false !!!!!

    Read the article

  • Aggregate Pattern and Performance Issues

    - by Mosh
    Hello, I have read about the Aggregate Pattern but I'm confused about something here. The pattern states that all the objects belonging to the aggregate should be accessed via the Aggregate Root, and not directly. And I'm assuming that is the reason why they say you should have a single Repository per Aggregate. But I think this adds a noticeable overhead to the application. For example, in a typical Web-based application, what if I want to get an object belonging to an aggregate (which is NOT the aggregate root)? I'll have to call Repository.GetAggregateRootObject(), which loads the aggregate root and all its child objects, and then iterate through the child objects to find the one I'm looking for. In other words, I'm loading lots of data and throwing them out except the particular object I'm looking for. Is there something I'm missing here? PS: I know some of you may suggest that we can improve performance with Lazy Loading. But that's not what I'm asking here... The aggregate pattern requires that all objects belonging to the aggregate be loaded together, so we can enforce business rules.

    Read the article

  • Visitor Pattern can be replaced with Callback functions?

    - by getit
    Is there any significant benefit to using either technique? In case there are variations, the Visitor Pattern I mean is this: http://en.wikipedia.org/wiki/Visitor_pattern And below is an example of using a delegate to achieve the same effect (at least I think it is the same) Say there is a collection of nested elements: Schools contain Departments which contain Students Instead of using the Visitor pattern to perform something on each collection item, why not use a simple callback (Action delegate in C#) Say something like this class Department { List Students; } class School { List Departments; VisitStudents(Action<Student> actionDelegate) { foreach(var dep in this.Departments) { foreach(var stu in dep.Students) { actionDelegate(stu); } } } } School A = new School(); ...//populate collections A.Visit((student)=> { ...Do Something with student... }); *EDIT Example with delegate accepting multiple params Say I wanted to pass both the student and department, I could modify the Action definition like so: Action class School { List Departments; VisitStudents(Action<Student, Department> actionDelegate, Action<Department> d2) { foreach(var dep in this.Departments) { d2(dep); //This performs a different process. //Using Visitor pattern would avoid having to keep adding new delegates. //This looks like the main benefit so far foreach(var stu in dep.Students) { actionDelegate(stu, dep); } } } }

    Read the article

  • xslt broken: pattern does not match

    - by krisvandenbergh
    I'm trying to query an xml file using the following xslt: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:rdfs="http://www.w3.org/2000/01/rdf-schema#" xmlns:bpmn="http://dkm.fbk.eu/index.php/BPMN_Ontology"> <!-- Participants --> <xsl:template match="/"> <html> <body> <table> <xsl:for-each select="Package/Participants/Participant"> <tr> <td><xsl:value-of select="ParticipantType" /></td> <td><xsl:value-of select="Description" /></td> </tr> </xsl:for-each> </table> </body> </html> </xsl:template> </xsl:stylesheet> Here's the contents of the xml file: <?xml version="1.0" encoding="utf-8"?> <?xml-stylesheet type="text/xsl" href="xpdl2bpmn.xsl"?> <Package xmlns="http://www.wfmc.org/2008/XPDL2.1" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema" Id="25ffcb89-a9bf-40bc-8f50-e5afe58abda0" Name="1 price setting" OnlyOneProcess="false"> <PackageHeader> <XPDLVersion>2.1</XPDLVersion> <Vendor>BizAgi Process Modeler.</Vendor> <Created>2010-04-24T10:49:45.3442528+02:00</Created> <Description>1 price setting</Description> <Documentation /> </PackageHeader> <RedefinableHeader> <Author /> <Version /> <Countrykey>CO</Countrykey> </RedefinableHeader> <ExternalPackages /> <Participants> <Participant Id="008af9a6-fdc0-45e6-af3f-984c3e220e03" Name="customer"> <ParticipantType Type="RESOURCE" /> <Description /> </Participant> <Participant Id="1d2fd8b4-eb88-479b-9c1d-7fe6c45b910e" Name="clerk"> <ParticipantType Type="ROLE" /> <Description /> </Participant> </Participants> </Package> Despite, the simple pattern, the foreach doesn't work. What is wrong with Package/Participants/Participant ? What do I miss here? Thanks a lot!

    Read the article

  • patterns in case statement in bash scripting

    - by Ramiro Rela
    The man says that case statements use "filename expansion pattern matching". I usually want to have short names for some parameters, so I go: case $1 in req|reqs|requirements) TASK="Functional Requirements";; met|meet|meetings) TASK="Meetings with the client";; esac logTimeSpentIn "$TASK" I tried patterns like "req*" or "me{e,}t" which I understand would expand correctly to match those values in the context of filename expansion, but it doesn't work. Thanks.

    Read the article

  • IoC containers and service locator pattern

    - by TheSilverBullet
    I am trying to get an understanding of Inversion of Control and the dos and donts of this. Of all the articles I read, there is one by Mark Seemann (which is widely linked to in SO) which strongly asks folks not to use the service locator pattern. Then somewhere along the way, I came across this article by Ken where he helps us build our own IoC. I noticed that is is nothing but an implementation of service locator pattern. Questions: Is my observation correct that this implementation is the service locator pattern? If the answer to 1. is yes, then Do all IoC containers (like Autofac) use the service locator pattern? If the answer to 1. is no, then why is this differen? Is there any other pattern (other than DI) for inversion of control?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >