Search Results

Search found 4398 results on 176 pages for 'photo matching'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 5/176 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Extract string between matching braces in Perl

    - by Srilesh
    My input file is as below : HEADER {ABC|*|DEF {GHI 0 1 0} {{Points {}}}} {ABC|*|DEF {GHI 0 2 0} {{Points {}}}} {ABC|*|XYZ:abc:def {GHI 0 22 0} {{Points {{F1 1.1} {F2 1.2} {F3 1.3} {F4 1.4}}}}} {ABC|*|XYZ:ghi:jkl {JKL 0 372 0} {{Points {}}}} {ABC|*|XYZ:mno:pqr {GHI 0 34 0} {{Points {}}}} { ABC|*|XYZ:abc:pqr {GHI 0 68 0} {{Points {{F1 11.11} {F2 12.10} {F3 14.11} {F4 16.23}}}} } TRAILER I want to extract the file into an array as below : $array[0] = "{ABC|*|DEF {GHI 0 1 0} {{Points {}}}}" $array[1] = "{ABC|*|DEF {GHI 0 2 0} {{Points {}}}}" $array[2] = "{ABC|*|XYZ:abc:def {GHI 0 22 0} {{Points {{F1 1.1} {F2 1.2} {F3 1.3} {F4 1.4}}}}}" .. .. $array[5] = "{ ABC|*|XYZ:abc:pqr {GHI 0 68 0} {{Points {{F1 11.11} {F2 12.10} {F3 14.11} {F4 16.23}}}} }" Which means, I need to match the first opening curly brace with its closing curly brace and extract the string in between. I have checked the below link, but this doesnt apply to my question. http://stackoverflow.com/questions/413071/regex-to-get-string-between-curly-braces-i-want-whats-between-the-curly-braces I am trying but would really help if someone can assist me with their expertise ... Thanks Sri ...

    Read the article

  • pattern matching and returning new object based on pattern

    - by Rune FS
    Say I'v got some code like this match exp with | Addition(lhs,rhs,_) -> Addition(fix lhs,fix rhs) | Subtraction(lhs,rhs,_) -> Subtraction(fix lhs,fix rhs) is there any way that would allow me to do something like match exp with | Addition(lhs,rhs,_) | Subtraction(lhs,rhs,_) -> X(fix lhs,fix rhs) where X be based on the actual pattern being matched

    Read the article

  • Regular expressions and matching question marks in URLs

    - by James P.
    I'm having trouble finding a regular expression that matches the following String. Korben;http://feeds.feedburner.com/KorbensBlog-UpgradeYourMind?format=xml;1 One problem is escaping the question mark. Java's pattern matcher doesn't seem to accept \? as a valid escape sequence but it also fails to work with the tester at myregexp.com. Here's what I have so far: ([a-zA-Z0-9])+;http://([a-zA-Z0-9./-]+);[0-9]+ Any suggestions?

    Read the article

  • Excel Matching problem with logic expression

    - by abelenky
    (I understand Excel is only borderline programming) I have a block of data that represents the steps in a process and the possible errors: ProcessStep Status FeesPaid OK FormRecvd OK RoleAssigned OK CheckedIn Not Checked In. ReadyToStart Not Ready for Start I want to find the first Status that is not "OK". I have attempted this: =Match("<>""OK""", StatusRange, 0) which is supposed to return the index of the first element in the range that is NOT-EQUAL (<) to "OK" But this doesn't work, instead returning #N/A. I expect it to return 4 (index #4, in a 1-based index, representing that CheckedIn is the first non-OK element) Any ideas how to do this?

    Read the article

  • Pattern Matching with XSLT

    - by genesis11
    I'm trying to match a pattern into a string in XSLT/XPath using the matches function, as follows: <xsl:when test="matches('awesome','awe')"> ... </xsl:when> However, in both Firefox 3.5.9 and IE8, it doesn't show up. IE8 tells me that "'matches' is not a valid XSLT or XPath function." Is this due to XSLT 2.0 not being supported, and is there a way around this?

    Read the article

  • Regex and Pattern Matching in Scala

    - by Bruce Ferguson
    I am not strong in regex, and pretty new to Scala. I would like to be able to find a match between the first letter of a word, and one of the letters in a group such as "ABC". In pseudocode, this might look something like: case Process(word) => word.firstLetter match { case([a-c][A-C]) => case _ => } } but I don't know how to grab the first letter in Scala instead of Java, how to express the regular expression properly, nor if it's possible to do this within a case class. Any suggestions? Thanks in advance. Bruce

    Read the article

  • F# pattern matching when mixing DU's and other values

    - by Roger Alsing
    What would be the most effective way to express the following code? match cond.EvalBool() with | true -> match body.Eval() with | :? ControlFlowModifier as e -> match e with | Break(scope) -> e :> obj //Break is a DU element of ControlFlowModifier | _ -> next() //other members of CFM should call next() | _ -> next() //all other values should call next() | false -> null cond.EvalBool returns a boolean result where false should return null and true should either run the entire block again (its wrapped in a func called next) or if the special value of break is found, then the loop should exit and return the break value. Is there any way to compress that block of code to something smaller?

    Read the article

  • Scala: Matching optional Regular Expression groups

    - by Brian Heylin
    I'm trying to match on an option group in Scala 2.8 (beta 1) with the following code: import scala.xml._ val StatementPattern = """([\w\.]+)\s*:\s*([+-])?(\d+)""".r def buildProperty(input: String): Node = input match { case StatementPattern(name, value) => <propertyWithoutSign /> case StatementPattern(name, sign, value) => <propertyWithSign /> } val withSign = "property.name: +10" val withoutSign = "property.name: 10" buildProperty(withSign) // <propertyWithSign></propertyWithSign> buildProperty(withoutSign) // <propertyWithSign></propertyWithSign> But this is not working. What is the correct way to match optional regex groups?

    Read the article

  • Eliminating matching values in a SQL result set

    - by Burgess Taylor
    I have a table with a list of transactions (invoices and credits) and I need to get a list of all the rows where the invoices and credits don't match up. eg user product value bill ThingA 200 jim ThingA -200 sue ThingB 100 liz ThingC 50 I only want to see the third and fourth rows, as the values of the others match off. I can do this if I select product, sum(value) ... group by product having sum(value) < 0 which works well, but I want to return the user name as well. As soon as I add the user to the select, I need to group by it as well, which messes it up as the amounts don't match up by user AND product. Any ideas ? I am using MS SQL 2000... Cheers

    Read the article

  • Haskell: Pattern Matching with Lists

    - by user1670032
    I'm trying to make a function that takes in a list, and if one of the elements is negative, then any elements in that list that are equal to its positive counterpart should be changed to 0. Eg, if there is a -2 in a list, then all 2's in that list should be changed to 0. Any ideas why it only works for some cases and not others? I'm not understanding why this is, I've looked it over several times. changeToZero [] = [] changeToZero [x] = [x] changeToZero (x:zs:y:ws) | (x < 0) && ((-1)*(x) == y) = x : zs : 0 : changeToZero ws changeToZero (x:xs) = x : changeToZero xs *Main changeToZero [-1,1,-2,2,-3,3] [-1,1,-2,2,-3,3] *Main changeToZero [-2,1,2,3] [-2,1,0,3] *Main changeToZero [-2,1,2,3,2] [-2,1,0,3,2] *Main changeToZero [1,-2,2,2,1] [1,-2,2,0,1]

    Read the article

  • Is it possible, with simple F# pattern matching transformations, to ignore unmatched values without

    - by Phobis
    So, I previously asked this question: http://stackoverflow.com/questions/2820234/can-someone-help-me-compare-using-f-over-c-in-this-specific-example-ip-address I was looking at the posted code and I was wondering if this code could be written without it producing a warning: let [|a;b;c;d|] = s.Split [|'.'|] IP(parseOrParts a, parseOrParts b, parseOrParts c, parseOrParts d) Is it possible to do something for the match _ pattern ot ignore? Without adding in something like Active Patterns? i want to keep the code as simple as possible... can I do this without drastically changing this code? NOTE: Warning is as follows Warning Incomplete pattern matches on this expression. For example, the value '[|_; _; _; _; _|]' may indicate a case not covered by the pattern(s).

    Read the article

  • How to implement best matching logic in TSQL (SQL Server 2000)

    - by sanjay-kumar1911
    I have two tables X and Y: Table X C1 C2 C3 1 A 13 2 B 16 3 C 8 Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 N 3 A 12 N 4 A 5 N 5 B 7 N 6 B 16 N 7 B 9 N 8 B 5 N 9 C 8 N 10 C 2 N 11 C 8 N 12 C 6 N Records in Table Y can be n number CREATE TABLE X(C1 INT, C2 CHAR(1), C3 INT); CREATE TABLE Y(C1 INT, C2 CHAR(1), C3 INT, C4 CHAR(1)); with following data: INSERT INTO X VALUES (1 'A',13 ); INSERT INTO X VALUES (2 'B',16 ); INSERT INTO X VALUES (3 'C',8 ); INSERT INTO Y VALUES (1,'A', 2,'N'); INSERT INTO Y VALUES (2,'A', 8,'N'); INSERT INTO Y VALUES (3,'A', 12,'N'); INSERT INTO Y VALUES (4,'A', 5,'N'); INSERT INTO Y VALUES (5,'B', 7,'N'); INSERT INTO Y VALUES (6,'B', 16,'N'); INSERT INTO Y VALUES (7,'B', 9,'N'); INSERT INTO Y VALUES (8,'B', 5,'N'); INSERT INTO Y VALUES (9,'C', 8,'N'); INSERT INTO Y VALUES (10,'C', 2,'N'); INSERT INTO Y VALUES (11,'C', 8,'N'); INSERT INTO Y VALUES (12,'C', 6,'N'); EXPECTED RESULT Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 Y 3 A 12 N 4 A 5 Y 5 B 7 N 6 B 16 Y 7 B 9 N 8 B 5 N 9 C 8 Y 10 C 2 N 11 C 8 N 12 C 6 N How do I compare value of column C3 in Table X with all possible matches of column C3 of Table Y and to mark records as matched and unmatched in column C4 of Table Y? Possible matches for A (i.e. value of column C2 in Table X) would be (where R is row number i.e. value of column C1 in Table Y): R1, R2, R3, R4, R1+R2, R1+R3, R1+R4, R2+R3, R2+R4, R3+R4, R4+R5, R1+R2+R3, R1+R2+R4, R2+R3+R4, R1+R2+R3+R4

    Read the article

  • Matching a rotated bitmap to a collage image

    - by Dmi
    Hi, My problem is that I have an image of a detailed street map. On this map, there can be a certain small image of a sign (such as a traffic light icon) rotated at any angle, maybe resized. I have this small image in a bitmap. Is there any algorithm or technique by which I can locate this bitmap if a copy of it exists, rotated and maybe resized, in the large collage image? This is similar to the problem with Augmented Reality and locating the marker image, but mine is only 2D with no perspective distortion.

    Read the article

  • Correct syntax for matching a string inside a variable against an array

    - by Jamex
    Hi, I have a variable, $var, that contains a string of characters, this is a dynamic variable that contains the values from inputs. $var could be 'abc', or $var could be 'blu', I want to match the string inside variable against an array, and return all the matches. $array = array("blue", "red", "green"); What is the correct syntax for writing the code in php, my rough code is below $match = preg_grep($var, $array); (incorrect syntax of course) I tried to put quotes and escape slashes, but so far no luck. Any suggestion? TIA

    Read the article

  • Strange pattern matching with functions instancing Show

    - by Sean D
    So I'm writing a program which returns a procedure for some given arithmetic problem, so I wanted to instance a couple of functions to Show so that I can print the same expression I evaluate when I test. The trouble is that the given code matches (-) to the first line when it should fall to the second. {-# OPTIONS_GHC -XFlexibleInstances #-} instance Show (t -> t-> t) where show (+) = "plus" show (-) = "minus" main = print [(+),(-)] returns [plus,plus] Am I just committing a motal sin printing functions in the first place or is there some way I can get it to match properly? edit:I realise I am getting the following warning: Warning: Pattern match(es) are overlapped In the definition of `show': show - = ... I still don't know why it overlaps, or how to stop it.

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • Pattern Matching of Units of Measure in F#

    - by Oldrich Svec
    This function: let convert (v: float<_>) = match v with | :? float<m> -> v / 0.1<m> | :? float<m/s> -> v / 0.2<m/s> | _ -> failwith "unknown" produces an error The type 'float<'u>' does not have any proper subtypes and cannot be used as the source of a type test or runtime coercion. Is there any way how to pattern match units of measure?

    Read the article

  • Pattern matching against Scala Map type

    - by Tom Morris
    Imagine I have a Map[String, String] in Scala. I want to match against the full set of key–value pairings in the map. Something like this ought to be possible val record = Map("amenity" -> "restaurant", "cuisine" -> "chinese", "name" -> "Golden Palace") record match { case Map("amenity" -> "restaurant", "cuisine" -> "chinese") => "a Chinese restaurant" case Map("amenity" -> "restaurant", "cuisine" -> "italian") => "an Italian restaurant" case Map("amenity" -> "restaurant") => "some other restaurant" case _ => "something else entirely" } The compiler complains thulsy: error: value Map is not a case class constructor, nor does it have an unapply/unapplySeq method What currently is the best way to pattern match for key–value combinations in a Map?

    Read the article

  • Perfect Cloud-based Photo Setup with digiKam and Piwigo

    <b>Linux Pro Magazine:</b> "Using digiKam's Kipi plugins, you can upload your photos to a variety of popular photo services, including Flickr, Picasaweb, and SmugMug. But what if you want to host your own photo album and still be able to populate it with photos directly from within digiKam?"

    Read the article

  • &amp;#65279;Five Simple Photo Fixes with digiKam

    <b>Linux Magazine: </b>"digiKam is an immensely powerful photo application, so learning all its features requires time and effort. But this capable photo management application also offers a few easy to use features which you can use to instantly improve your shots."

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to do this Python / MySQL manipulation (match) more efficiently?

    - by NJTechie
    Following is my data : Company Table : ID Company Address City State Zip Phone 1 ABC 123 Oak St Philly PA 17542 7329878901 2 CDE 111 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 KLE 87 Ilk St Plains NY 07654 7376578901 6 AB 1 W.House SField PA 87656 7329878901 Branch Office Table : ID Address City State Zip Phone 1 323 Alk St Philly PA 17542 7329832221 1 171 Joe St Newark NJ 08654 3 287 Foe St Brick NJ 07740 7321178901 3 700 Wall Ocean NJ 07764 7322278901 1 89 Blk St Surrey NY 07154 7376222901 File to be Matched (In MySQL): ID Company Address City State Zip Phone 1 ABC 123 Oak St Philly PA 17542 7329878901 2 AB 171 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 K 87 Ilk St Plains NY 07654 7376578901 Resulting File : ID Company Address City State Zip Phone appendedID 1 ABC 123 Oak St Philly PA 17542 7329878901 [Original record, field always empty] 1 ABC 171 Joe St Newark NJ 08654 1 [Company Table] 1 ABC 323 Alk St Philly PA 17542 7329832221 1 [Branch Office Table] 1 AB 1 W.House SField PA 87656 7329878901 6 [Partial firm and State, Zip match] 2 CDE 111 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 3 GHI 700 Wall Ocean NJ 07764 7322278901 3 3 GHI 287 Foe St Brick NJ 07740 7321178901 3 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 KLE 87 Ilk St Surrey NY 07654 7376578901 5 KLE 89 Blk St Surrey NY 07154 7376222901 5 Requirement : 1) I have to match each firm on the 'File to be Matched' to that of Company and Branch Office tables (MySQL). 2) If there are multiple exact/partial matches, then the ID from Company, Branch Office table is inserted as a new row in the resulting file. 3) Not all the firms will be matched perfectly, in that case I have to match on partial Company names (like 5/8th of the company name) and any of the address fields and insert them in the resulting file. Please help me out in the most efficient solution for this problem.

    Read the article

  • Recover that Photo, Picture or File You Deleted Accidentally

    - by The Geek
    Have you ever accidentally deleted a photo on your camera, computer, USB drive, or anywhere else? What you might not know is that you can usually restore those pictures—even from your camera’s memory stick. Windows tries to prevent you from making a big mistake by providing the Recycle Bin, where deleted files hang around for a while—but unfortunately it doesn’t work for external USB drives, USB flash drives, memory sticks, or mapped drives. The great news is that this technique also works if you accidentally deleted the photo… from the camera itself. That’s what happened to me, and prompted writing this article. Restore that File or Photo using Recuva The first piece of software that you’ll want to try is called Recuva, and it’s extremely easy to use—just make sure when you are installing it, that you don’t accidentally install that stupid Yahoo! toolbar that nobody wants. Now that you’ve installed the software, and avoided an awful toolbar installation, launch the Recuva wizard and let’s start through the process of recovering those pictures you shouldn’t have deleted. The first step on the wizard page will let you tell Recuva to only search for a specific type of file, which can save a lot of time while searching, and make it easier to find what you are looking for. Next you’ll need to specify where the file was, which will obviously be up to wherever you deleted it from. Since I deleted mine from my camera’s SD card, that’s where I’m looking for it. The next page will ask you whether you want to do a Deep Scan. My recommendation is to not select this for the first scan, because usually the quick scan can find it. You can always go back and run a deep scan a second time. And now, you’ll see all of the pictures deleted from your drive, memory stick, SD card, or wherever you searched. Looks like what happened in Vegas didn’t stay in Vegas after all… If there are a really large number of results, and you know exactly when the file was created or modified, you can switch to the advanced view, where you can sort by the last modified time. This can help speed up the process quite a bit, so you don’t have to look through quite as many files. At this point, you can right-click on any filename, and choose to Recover it, and then save the files elsewhere on your drive. Awesome! Restore that File or Photo using DiskDigger If you don’t have any luck with Recuva, you can always try out DiskDigger, another excellent piece of software. I’ve tested both of these applications very thoroughly, and found that neither of them will always find the same files, so it’s best to have both of them in your toolkit. Note that DiskDigger doesn’t require installation, making it a really great tool to throw on your PC repair Flash drive. Start off by choosing the drive you want to recover from…   Now you can choose whether to do a deep scan, or a really deep scan. Just like with Recuva, you’ll probably want to select the first one first. I’ve also had much better luck with the regular scan, rather than the “dig deeper” one. If you do choose the “dig deeper” one, you’ll be able to select exactly which types of files you are looking for, though again, you should use the regular scan first. Once you’ve come up with the results, you can click on the items on the left-hand side, and see a preview on the right.  You can select one or more files, and choose to restore them. It’s pretty simple! Download DiskDigger from dmitrybrant.com Download Recuva from piriform.com Good luck recovering your deleted files! And keep in mind, DiskDigger is a totally free donationware software from a single, helpful guy… so if his software helps you recover a photo you never thought you’d see again, you might want to think about throwing him a dollar or two. Similar Articles Productive Geek Tips Stupid Geek Tricks: Undo an Accidental Move or Delete With a Keyboard ShortcutRestore Accidentally Deleted Files with RecuvaCustomize Your Welcome Picture Choices in Windows VistaAutomatically Resize Picture Attachments in Outlook 2007Resize Your Photos with Easy Thumbnails TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Icelandic Volcano Webcams Open Multiple Links At One Go NachoFoto Searches Images in Real-time Office 2010 Product Guides Google Maps Place marks – Pizza, Guns or Strip Clubs Monitor Applications With Kiwi

    Read the article

  • Select photo while keep the order

    - by wong2
    I have a list of photo on the page, each have an unique id, user can click on them to toggle select the photo, when they click the submit button, I need to send the array of selected photo ids to the back end, in the order that the photo was selected. I think that the fastest way to track if a photo is selected is to use an object that use photo id as key, like: var selected = { "6272861": true, "6272888": true } when the user unselect a photo, I just need to delete selected["6272861"]. But this will ignore the order, if I use an array to keep the selected photos: var selected = ["6272861", "6272888"]; then when I need to unselect a photo, I have to loop through the array and delete the item. Is there better ways? thanks.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >