Search Results

Search found 13469 results on 539 pages for 'avoid trouble'.

Page 507/539 | < Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >

• FTP into a server using specific usernames

  - by user1854765

  I am trying to ftp into a server, once I'm there, I want to get a file, then put it back after sleeping for 5 minutes. I have that part correct, but i added to the code, two variables that will be inputted when the code is executed. The user will input the username they want to connect with. I am having trouble connecting though. When I input the username t14pb, it still goes to the the first if statement, as if I said t14pmds. here is the code: #!/usr/bin/perl use Net::FTP; $host = "fd00p02"; $username = "$ARGV[0]"; $ftpdir = "/"; $file = "$ARGV[1]"; print "$username\n"; print "$file\n"; if ($username == t14pmds) { $password = "test1"; $ftp = Net::FTP->new($host) or die "Error connecting to $host: $!"; $ftp->login($username, $password) or die "Login failed: $!"; $ftp->cwd($ftpdir) or die "Can't go to $ftpdir: $!"; $ftp->get($file) or die "Can't get $file: $!"; sleep 5; $ftp->put($file) or die "Can't put $file: $!"; $ftp->quit or die "Error closing ftp connection: $!"; } if ($username == t14pb) { $password = "test2"; $ftp = Net::FTP->new($host) or die "Error connecting to $host: $!"; $ftp->login($username, $password) or die "Login failed: $!"; $ftp->cwd($ftpdir) or die "Can't go to $ftpdir: $!"; $ftp->get($file) or die "Can't get $file: $!"; sleep 5; $ftp->put($file) or die "Can't put $file: $!"; $ftp->quit or die "Error closing ftp connection: $!"; } if ($username == t14pmds_out) { $password = "test3"; $ftp = Net::FTP->new($host) or die "Error connecting to $host: $!"; $ftp->login($username, $password) or die "Login failed: $!"; $ftp->cwd($ftpdir) or die "Can't go to $ftpdir: $!"; $ftp->get($file) or die "Can't get $file: $!"; sleep 5; $ftp->put($file) or die "Can't put $file: $!"; $ftp->quit or die "Error closing ftp connection: $!"; } if ($username == t14fiserv) { $password = "test4"; $ftp = Net::FTP->new($host) or die "Error connecting to $host: $!"; $ftp->login($username, $password) or die "Login failed: $!"; $ftp->cwd($ftpdir) or die "Can't go to $ftpdir: $!"; $ftp->get($file) or die "Can't get $file: $!"; sleep 5; $ftp->put($file) or die "Can't put $file: $!"; $ftp->quit or die "Error closing ftp connection: $!"; }

  Read the article

• Subband decomposition using Daubechies filter

  - by misha

  I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

  Read the article

• Learning... anything really

  - by WebDevHobo

  I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

  Read the article

• jQuery , Trigger change event on newly created elements

  - by kwhohasamullet

  Hi Guys, I have a button in a form that when clicked adds another set of form fields, In these form fields there are 2 drop downs where the contents of the 2nd dropdown rely on what is selected in the first dropdown... What i want to do is when the new form field button is clicked for the new items to be added and then the change event to be triggered on the drop down that was created so what only that drop down changes and not all the drop downs with the same name currently in that form. THe first drop down is called product Category The code for the addFormField function is: function addFormField() { var id = document.getElementById("field_id").value; $("#products").append("<table width='600' cellpadding='5' cellspacing='0' class='Add_Products' id='row" + id + "'><td width='250' class='left'><label>Select Product Category</label></td><td class='right' ><label><select name='" + id + "' id='ProductCategory'><?php foreach($categories as $key=>$category){ echo "<option value=".$key.">".$category."</option>"; } ?></select></label></td></tr><tr><td width='250' class='left'><label>Select Product Template</label></td><td class='right' ><label><select name='data[QuoteItem][" + id + "][product_id]' id='QuoteItem" + id + "product_id' class='Product' title='" + id + "'></select></label></td></tr><tr ><td class='left'>Name</td><td class='right'><label><input name='data[QuoteItem][" + id + "][name]' type='text' id='QuoteItem" + id + "name' size='50' /></label></td></tr><tr ><td class='left'>Price (ex GST)</td><td class='right'><input type='text' name='data[QuoteItem][" + id + "][price]' id='QuoteItem" + id + "price' onchange='totalProductPrice();' class='quote-item-price' value='0' /></td></tr><tr><td class='left'>Description</td><td class='right'><label><textarea name='data[QuoteItem][" + id + "][description]' cols='38' rows='5' id='QuoteItem" + id + "description'></textarea></label></td></tr><tr><td><a href='#' onClick='removeFormField(\"#row" + id + "\"); return false;'>Remove</a></td></tr></table>"); $('#row' + id).highlightFade({ speed:1000 }); id = (id - 1) + 2; document.getElementById("field_id").value = id; } The code that detects change in ProductCategory dropdown and triggers the AJAX is below: $("select#ProductCategory").live('change', function(){ var url = base + "/quotes/productList/" + $(this).val() + ""; var id = $(this).attr('name'); $.getJSON(url,{id: $(this).val(), ajax: 'true'}, function(j){ var options = ''; options += '<option value="0">None</option>'; $.each(j, function(key, value){ options += '<option value="' + key + '">' + value + '</option>'; }) $("select#QuoteItem" + id + "product_id").html(options); }) }).trigger('change'); I have been trying all afternoon to work this out and the closest one i got to work applied the returned ajax values to all items. Currently using the live function people can add new fields and are able to use the drops down independant of each other dropdown but its only when the field is first added that i have trouble getting is populated Thanks in advance for any help

  Read the article

• C# Serialization Surrogate - Cannot access a disposed object

  - by crushhawk

  I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

  Read the article

• Endianness conversion and g++ warnings

  - by SuperBloup

  I've got the following C++ code : template <int isBigEndian, typename val> struct EndiannessConv { inline static val fromLittleEndianToHost( val v ) { union { val outVal __attribute__ ((used)); uint8_t bytes[ sizeof( val ) ] __attribute__ ((used)); } ; outVal = v; std::reverse( &bytes[0], &bytes[ sizeof(val) ] ); return outVal; } inline static void convertArray( val v[], uint32_t size ) { // TODO : find a way to map the array for (uint32_t i = 0; i < size; i++) for (uint32_t i = 0; i < size; i++) v[i] = fromLittleEndianToHost( v[i] ); } }; Which work and has been tested (without the used attributes). When compiling I obtain the following errors from g++ (version 4.4.1) || g++ -Wall -Wextra -O3 -o t t.cc || t.cc: In static member function 'static val EndiannessConv<isBigEndian, val>::fromLittleEndianToHost(val)': t.cc|98| warning: 'used' attribute ignored t.cc|99| warning: 'used' attribute ignored || t.cc: In static member function 'static val EndiannessConv<isBigEndian, val>::fromLittleEndianToHost(val) [with int isBigEndian = 1, val = double]': t.cc|148| instantiated from here t.cc|100| warning: unused variable 'outVal' t.cc|100| warning: unused variable 'bytes' I've tried to use the following code : template <int size, typename valType> struct EndianInverser { /* should not compile */ }; template <typename valType> struct EndianInverser<4, valType> { static inline valType reverseEndianness( const valType &val ) { uint32_t castedVal = *reinterpret_cast<const uint32_t*>( &val ); castedVal = (castedVal & 0x000000FF << (3 * 8)) | (castedVal & 0x0000FF00 << (1 * 8)) | (castedVal & 0x00FF0000 >> (1 * 8)) | (castedVal & 0xFF000000 >> (3 * 8)); return *reinterpret_cast<valType*>( &castedVal ); } }; but it break when enabling optimizations due to the type punning. So, why does my used attribute got ignored? Is there a workaround to convert endianness (I rely on the enum to avoid type punning) in templates?

  Read the article

• OpenVPN (HideMyAss) client on Ubuntu: Route only HTTP traffic

  - by Andersmith

  I want to use HideMyAss VPN (hidemyass.com) on Ubuntu Linux to route only HTTP (ports 80 & 443) traffic to the HideMyAss VPN server, and leave all the other traffic (MySQL, SSH, etc.) alone. I'm running Ubuntu on AWS EC2 instances. The problem is that when I try and run the default HMA script, I suddenly can't SSH into the Ubuntu instance anymore and have to reboot it from the AWS console. I suspect the Ubuntu instance will also have trouble connecting to the RDS MySQL database, but haven't confirmed it. HMA uses OpenVPN like this: sudo openvpn client.cfg The client configuration file (client.cfg) looks like this: ############################################## # Sample client-side OpenVPN 2.0 config file # # for connecting to multi-client server. # # # # This configuration can be used by multiple # # clients, however each client should have # # its own cert and key files. # # # # On Windows, you might want to rename this # # file so it has a .ovpn extension # ############################################## # Specify that we are a client and that we # will be pulling certain config file directives # from the server. client auth-user-pass #management-query-passwords #management-hold # Disable management port for debugging port issues #management 127.0.0.1 13010 ping 5 ping-exit 30 # Use the same setting as you are using on # the server. # On most systems, the VPN will not function # unless you partially or fully disable # the firewall for the TUN/TAP interface. #;dev tap dev tun # Windows needs the TAP-Win32 adapter name # from the Network Connections panel # if you have more than one. On XP SP2, # you may need to disable the firewall # for the TAP adapter. ;dev-node MyTap # Are we connecting to a TCP or # UDP server? Use the same setting as # on the server. proto tcp ;proto udp # The hostname/IP and port of the server. # You can have multiple remote entries # to load balance between the servers. # All VPN Servers are added at the very end ;remote my-server-2 1194 # Choose a random host from the remote # list for load-balancing. Otherwise # try hosts in the order specified. # We order the hosts according to number of connections. # So no need to randomize the list # remote-random # Keep trying indefinitely to resolve the # host name of the OpenVPN server. Very useful # on machines which are not permanently connected # to the internet such as laptops. resolv-retry infinite # Most clients don't need to bind to # a specific local port number. nobind # Downgrade privileges after initialization (non-Windows only) ;user nobody ;group nobody # Try to preserve some state across restarts. persist-key persist-tun # If you are connecting through an # HTTP proxy to reach the actual OpenVPN # server, put the proxy server/IP and # port number here. See the man page # if your proxy server requires # authentication. ;http-proxy-retry # retry on connection failures ;http-proxy [proxy server] [proxy port #] # Wireless networks often produce a lot # of duplicate packets. Set this flag # to silence duplicate packet warnings. ;mute-replay-warnings # SSL/TLS parms. # See the server config file for more # description. It's best to use # a separate .crt/.key file pair # for each client. A single ca # file can be used for all clients. ca ./keys/ca.crt cert ./keys/hmauser.crt key ./keys/hmauser.key # Verify server certificate by checking # that the certicate has the nsCertType # field set to "server". This is an # important precaution to protect against # a potential attack discussed here: # http://openvpn.net/howto.html#mitm # # To use this feature, you will need to generate # your server certificates with the nsCertType # field set to "server". The build-key-server # script in the easy-rsa folder will do this. ;ns-cert-type server # If a tls-auth key is used on the server # then every client must also have the key. ;tls-auth ta.key 1 # Select a cryptographic cipher. # If the cipher option is used on the server # then you must also specify it here. ;cipher x # Enable compression on the VPN link. # Don't enable this unless it is also # enabled in the server config file. #comp-lzo # Set log file verbosity. verb 3 # Silence repeating messages ;mute 20 # Detect proxy auto matically #auto-proxy # Need this for Vista connection issue route-metric 1 # Get rid of the cached password warning #auth-nocache #show-net-up #dhcp-renew #dhcp-release #route-delay 0 120 # added to prevent MITM attack ns-cert-type server # # Remote servers added dynamically by the master server # DO NOT CHANGE below this line # remote-random remote 173.242.116.200 443 # 0 remote 38.121.77.74 443 # 0 # etc... remote 67.23.177.5 443 # 0 remote 46.19.136.130 443 # 0 remote 173.254.207.2 443 # 0 # END

  Read the article

• Getting rid of "static" references in C#

  - by DevEight

  Hello. I've recently begun learning C# but have encountered an annoying problem. Every variable I want available to all functions in my program I have to put a "static" in front of and also every function. What I'd like to know is how to avoid this, if possible? Also, small side question: creating public variables inside functions? This is what my program looks like right now, and I want to basically keep it like that, without having to add "static" everywhere: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Net; using System.Threading; using System.Net.Sockets; namespace NetworkExercise { class Client { public IPAddress addr; public int port; public string name; public Thread thread; public TcpClient tcp; public NetworkStream stream; public Client(IPAddress addr, int port, string name, NetworkStream stream) { } } class Program { //NETWORK TcpListener tcpListener; Thread listenThread; ASCIIEncoding encoder = new ASCIIEncoding(); //DATA byte[] buffer = new byte[4096]; string servIp; int servPort; //CLIENT MANAGEMENT int clientNum; static void Main(string[] args) { beginConnect(); } public void beginConnect() { Console.Write("Server IP (leave blank if you're the host): "); servIp = Console.ReadLine(); Console.Write("Port: "); servPort = Console.Read(); tcpListener = new TcpListener(IPAddress.Any, servPort); listenThread = new Thread(new ThreadStart(listenForClients)); listenThread.Start(); } public void listenForClients() { tcpListener.Start(); Console.WriteLine("Listening for clients..."); while (true) { Client cl = new Client(null, servPort, null, null); cl.tcp = tcpListener.AcceptTcpClient(); ThreadStart pts = delegate { handleClientCom(cl); }; cl.thread = new Thread(pts); cl.thread.Start(); } } public void handleClientCom(Client cl) { cl.stream = cl.tcp.GetStream(); } } }

  Read the article

• How to cleverly stop "while loop" (php)

  - by user3735697

  I'm having trouble with creating code that echoes a bunch of stuff that is corresponding to the mysql database row. It needs to keep creating the content until all rows are used and then stop. But for some reason the php file causes the browser to keep loading (it never ends). Any help would be appreciated! Thanks! <?php mysql_connect ("localhost", "root", "") or die ("We couldn't connect!"); mysql_select_db ("dr"); mysql_query ("SELECT * FROM songs"); $result = mysql_query ("SELECT * FROM songs"); while ($row=mysql_fetch_array($result)) { $name = $row ['songname']; $genres = $row ['songgenres']; $mediafire = $row ['mediafirelink']; $dropbox = $row ['dropboxlink']; $source = $row ['audiosource']; echo " <div class='playing'> <!-- ======== Song Name ======== --> <li class='songnameli' id='$source'> <span class='info'>$name</span> <audio> <source src='music/singles/$source.mp3'> <source src='music/singles/$source.ogg'> </audio> </li> <!-- ======== Playlist ======== --> <li class='playlistli'> <img src='icons/addtoplaylist.png' title='Add tot the playlist!' /> </li> <!-- ======== Genres ======== --> <li class='genresli'> <img src='icons/genres.png' title='Related genres' /> <span class='addedtext genres'>$genres</span> </li> <!-- ======== Social Media links ======== --> <li> <span> <img src='icons/share.png' alt='Share this with your friends!' title='Share this!'> <!-- /// facebook /// --> <a href='http://www.facebook.com/sharer.php?u=http://www.declassified-recordings.com' class='addedtext nlink' target='blank_' onclick='popup (this.href, 800, 500); return false'>Facebook </a> <span>/</span> <!-- /// Twitter /// --> <a href='http://twitter.com/share? text=Thank%20you%20For%20Sharing!%20It%20means%20the%20world%20to%20us!%40Declassifi3d%20 &url=http://www.declassified-recordings.com' class='twitterlink nlink' target='blank_' onclick='popup (this.href, 800, 500); return false'>Twitter</a> </span> </li> <!-- ======== Download links ======== --> <li> <img src='icons/download.png' title='Download!' /> <span> <!-- /// Mediafire /// --> <a href='$mediafire' class='addedtext nlink' target='_blank'>Mediafire</a> <span class='genres'>/</span> <!-- /// Dropbox /// --> <a href='$mediafire' class='twitterlink nlink' target='_blank'>Dropbox</a> </span> </li> </div>"; } mysql_close (); ?>

  Read the article

• Helping linqtosql datacontext use implicit conversion between varchar column in the database and tab

  - by user213256

  I am creating an mssql database table, "Orders", that will contain a varchar(50) field, "Value" containing a string that represents a slightly complex data type, "OrderValue". I am using a linqtosql datacontext class, which automatically types the "Value" column as a string. I gave the "OrderValue" class implicit conversion operators to and from a string, so I can easily use implicit conversion with the linqtosql classes like this: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // use implicit converstion to turn the string representation of the order // value into the complex data type. OrderValue value = order.Value; // adjust one of the fields in the complex data type value.Shipping += 10; // use implicit conversion to store the string representation of the complex // data type back in the linqtosql order object order.Value = value; // save changes db.SubmitChanges(); However, I would really like to be able to tell the linqtosql class to type this field as "OrderValue" rather than as "string". Then I would be able to avoid complex code and re-write the above as: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // The Value field is already typed as the "OrderValue" type rather than as string. // When a string value was read from the database table, it was implicity converted // to "OrderValue" type. order.Value.Shipping += 10; // save changes db.SubmitChanges(); In order to achieve this desired goal, I looked at the datacontext designer and selected the "Value" field of the "Order" table. Then, in properties, I changed "Type" to "global::MyApplication.OrderValue". The "Server Data Type" property was left as "VarChar(50) NOT NULL" The project built without errors. However, when reading from the database table, I was presented with the following error message: Could not convert from type 'System.String' to type 'MyApplication.OrderValue'. at System.Data.Linq.DBConvert.ChangeType(Object value, Type type) at Read_Order(ObjectMaterializer1 ) at System.Data.Linq.SqlClient.ObjectReaderCompiler.ObjectReader2.MoveNext() at System.Linq.Buffer1..ctor(IEnumerable1 source) at System.Linq.Enumerable.ToArray[TSource](IEnumerable`1 source) at Example.OrdersProvider.GetOrders() at ... etc From the stack trace, I believe this error is happening while reading the data from the table. When presented with converting a string to my custom data type, even though the implicit conversion operators are present, the DBConvert class gets confused and throws an error. Is there anything I can do to help it not get confused and do the implicit conversion? Thanks in advance, and apologies if I have posted in the wrong forum. cheers / Ben

  Read the article

• How does Sentry aggregate errors?

  - by Hugo Rodger-Brown

  I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Jquery - Loading a page with .load and selector doesn't execute script?

  - by PirateKitten

  I'm trying to load one page into another using the .load() method. This loaded page contains a script that I want to execute when it has finished loading. I've put together a barebones example to demonstrate: Index.html: <html> <head> <title>Jquery Test</title> <script type="text/javascript" src="script/jquery-1.3.2.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $('#nav a').click(function() { $('#contentHolder').load('content.html #toLoad', '', function() {}); return false; }); }); </script> </head> <body> <div id="nav"> <a href="content.html">Click me!</a> </div> <hr /> <div id="contentHolder"> Content loaded will go here </div> </body> </html> Content.html: <div id="toLoad"> This content is from content.html <div id="contentDiv"> This should fade away. </div> <script type="text/javascript"> $('#contentDiv').fadeOut('slow', function() {} ); </script> </div> When the link is clicked, the content should load and the second paragraph should fade away. However it doesn't execute. If I stick a simple alert("") in the script of content.html it doesn't execute either. However, if I do away with the #toLoad selector in the .load() call, it works fine. I am not sure why this is, as the block is clearly in the scope of the #toLoad div. I don't want to avoid using the selector, as in reality the content.html will be a full HTML page, and I'll only want a select part out of it. Any ideas? If the script from content.html was in the .load() callback, it works fine, however I obviously don't want that logic contained within index.html. I could possibly have the callback use .getScript() to load "content.html.js" afterwards and have the logic in there, that seems to work? I'd prefer to keep the script in content.html, if possible, so that it executes fine when loaded normally too. In fact, I might do this anyway, but I would like to know why the above doesn't work.

  Read the article

• OpenGL texture misaligned on quad

  - by user308226

  I've been having trouble with this for a while now, and I haven't gotten any solutions that work yet. Here is the problem, and the specifics: I am loading a 256x256 uncompressed TGA into a simple OpenGL program that draws a quad on the screen, but when it shows up, it is shifted about two pixels to the left, with the cropped part appearing on the right side. It has been baffling me for the longest time, people have suggested clamping and such, but somehow I think my problem is probably something really simple, but I just can't figure out what it is! Here is a screenshot comparing the TGA (left) and how it appears running in the program (right) for clarity. Also take note that there's a tiny black pixel on the upper right corner, I'm hoping that's related to the same problem. Here's the code for the loader, I'm convinced that my problem lies in the way that I'm loading the texture. Thanks in advance to anyone who can fix my problem. bool TGA::LoadUncompressedTGA(char *filename,ifstream &texturestream) { cout << "G position status:" << texturestream.tellg() << endl; texturestream.read((char*)header, sizeof(header)); //read 6 bytes into the file to get the tga header width = (GLuint)header[1] * 256 + (GLuint)header[0]; //read and calculate width and save height = (GLuint)header[3] * 256 + (GLuint)header[2]; //read and calculate height and save bpp = (GLuint)header[4]; //read bpp and save cout << bpp << endl; if((width <= 0) || (height <= 0) || ((bpp != 24) && (bpp !=32))) //check to make sure the height, width, and bpp are valid { return false; } if(bpp == 24) { type = GL_RGB; } else { type = GL_RGBA; } imagesize = ((bpp/8) * width * height); //determine size in bytes of the image cout << imagesize << endl; imagedata = new GLubyte[imagesize]; //allocate memory for our imagedata variable texturestream.read((char*)imagedata,imagesize); //read according the the size of the image and save into imagedata for(GLuint cswap = 0; cswap < (GLuint)imagesize; cswap += (bpp/8)) //loop through and reverse the tga's BGR format to RGB { imagedata[cswap] ^= imagedata[cswap+2] ^= //1st Byte XOR 3rd Byte XOR 1st Byte XOR 3rd Byte imagedata[cswap] ^= imagedata[cswap+2]; } texturestream.close(); //close ifstream because we're done with it cout << "image loaded" << endl; glGenTextures(1, &texID); // Generate OpenGL texture IDs glBindTexture(GL_TEXTURE_2D, texID); glPixelStorei(GL_UNPACK_ALIGNMENT, 1); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_S, GL_REPEAT); glTexParameteri (GL_TEXTURE_2D, GL_TEXTURE_WRAP_T, GL_REPEAT); glTexParameteri (GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_NEAREST); glTexParameteri (GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_NEAREST); glTexEnvf(GL_TEXTURE_ENV, GL_TEXTURE_ENV_MODE, GL_MODULATE); glTexImage2D(GL_TEXTURE_2D, 0, type, width, height, 0, type, GL_UNSIGNED_BYTE, imagedata); delete imagedata; return true; } //Public loading function for TGA images. Opens TGA file and determines //its type, if any, then loads it and calls the appropriate function. //Returns: TRUE on success, FALSE on failure bool TGA::loadTGA(char *filename) { cout << width << endl; ifstream texturestream; texturestream.open(filename,ios::binary); texturestream.read((char*)header,sizeof(header)); //read 6 bytes into the file, its the header. //if it matches the uncompressed header's first 6 bytes, load it as uncompressed LoadUncompressedTGA(filename,texturestream); return true; }

  Read the article

• Java - is this an idiom or pattern, behavior classes with no state

  - by Berlin Brown

  I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

  Read the article

• Javascript self contained sandbox events and client side stack

  - by amnon

  I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

  Read the article

• Should I go along with my choice of web hosting company or still search?

  - by Devner

  Hi all, I have been searching for a good website hosting company that can offer me all the services that I need for hosting my PHP & MySQL based website. Now this is a community based website and users will be able to upload pictures, etc. The hosting company that I have in mind, currently lets me do everything... let me use mail(), supports CRON jobs, etc. Of course they are charging about $6/month. Now the only problem with this company is that they have a limit of 50,000 files that can exist within the hosting account at any time. This kind of contradicts their frontpage ad of "UNLIMITED SPACE" on their website. Apart from this, I know of no other reason why I should not go with this hosting company. But my issue is that 50,000 file limit is what I cannot live with, once the users increase in significant number and the files they upload, exceed 50,000 in number. Now since this is a dynamic website and also includes sensitive issues like payments, etc. I am not sure if I should go ahead with this company as I am just starting out and then later switch over to a better hosting company which does not limit me with 50,000 files. If I need to switch over once I host with this company, I will need to take backups of all the files located in my account (jpg, zip, etc.), then upload them to the new host. I am not aware of any tools that can help me in this process. Can you please mention if you know any? I can go ahead with the other companies right now, but their cost is double/triple of the current price and they all sport less features than my current choice. If I pay more, then they are ready to accommodate my higher demands. Unfortunately, the company that I am willing to go with now, does NOT have any other higher/better plans that I can switch to. So that's the really really bad part. So my question(s): Since I am starting out with my website and since the scope of users initially is going to be less/small, should I go ahead with the current choice and then once the demand increases, switch over to a better provider? If yes, how can I transfer my database, especially the jpg files, etc. to the new provider? I don't even know the tools required to backup and restore to another host. (I don't like this idea but still..) Should I go ahead and pay more right now and go with better providers (without knowing if the website is going to do really that well) just for saving myself the trouble of having to take a backup of the 50,000 files and upload to a new host from an old host and just start paying double/triple the price without even knowing if I would receive back the returns as I expected? Backup and Restore in such a bulky numbers is something that I have never done before and hence I am stuck here trying to decide what to do. The price per month is also a considerable factor in my decision. All these web hosting companies say one common thing: It is customers responsibility to backup and restore data and they are not liable for any loss. So no matter what hosting company that I would like to go with, they ask me to take backup via FTP so that I can restore them whenever I want (& it seems to be safer to have the files locally with me). Some are providing tools for backup and some are not and I am not sure how much their backup tools can be trusted considering the disclaimers they have. I have never backed-up and restored 50,000 files from one web host to another, so please, all you experienced people out there, leave your comments and let me know your suggestions so that I can decide. I have spent 2 days fighting with myself trying to decide what to do and finally concluded that this is a double-edged sword and I can't arrive at a satisfactory final decision without involving others suggestions. I believe that someone must be out there who may have had such troublesome decision to make. So all your suggestions to help me make my decision are appreciated. Thank you all.

  Read the article

• Java replacement for C macros

  - by thkala

  Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

  Read the article

• MySQL query works in PHPMyAdmin but not PHP

  - by Su4p

  I do not understand what's happening. I have a query in PHP who crashes -with a strange error-. When I copy/paste the exact same request in PHPMyAdmin it works as expected. What am I doing wrong here ? SELECT oms_patient.id, oms_patient.date, oms_patient.date_modif, date_modif, AES_DECRYPT(nom,"xxxxx") AS "Nom", AES_DECRYPT(prenom,"xxxxx") AS "Prénom usuel", DATE_FORMAT(ddn, "%d/%m/%Y") AS "Date de naissance", villeNaissance AS "Lieu de naissance (ville)", CONCAT(oms_departement.libelle,"(",id_departement,")") AS "Lieu de vie", CONCAT(oms_pays.libelle,"(",id_pays,")") AS "Pays", CONCAT(patientsexe.libelle,"(",id_sexe,")") AS "Sexe", CONCAT(patientprofession.libelle,"(",id_profession,")") AS "Profession", IF(asthme>0,"Oui","Non") AS "Asthme", IF(rhinite>0,"Oui","Non") AS "Rhinite", IF(bcpo>0,"Oui","Non") AS "BPCO", IF(insuffisanceResp>0,"Oui","Non") AS "Insuffisance respiratoire chronique", IF(chirurgieOrl>0,"Oui","Non") AS "Chirurgie ORL du ronflement", IF(autreChirurgie>0,"Oui","Non") AS "Autre chirurgie ORL", IF(allergies>0,"Oui","Non") AS "Allergies", IF(OLD>0,"Oui","Non") AS "OLD", IF(hypertensionArterielle>0,"Oui","Non") AS "Hypertension artérielle", IF(infarctusMyocarde>0,"Oui","Non") AS "Infarctus du myocarde", IF(insuffisanceCoronaire>0,"Oui","Non") AS "Insuffisance coronaire", IF(troubleRythme>0,"Oui","Non") AS "Trouble du rythme", IF(accidentVasculaireCerebral>0,"Oui","Non") AS "Accident vasculaire cérébral", IF(insuffisanceCardiaque>0,"Oui","Non") AS "Insuffisance cardiaque", IF(arteriopathie>0,"Oui","Non") AS "Artériopathie", IF(tabagismeActuel>0,"Oui","Non") AS "Tabagisme actuel", CONCAT(nbPaquetsActuel," ","PA") AS "", IF(tabagismeAncien>0,"Oui","Non") AS "Tabagisme ancien", CONCAT(nbPaquetsAncien," ","PA") AS "", IF(alcool>0,"Oui","Non") AS "Alcool (conso régulière)", IF(refluxGastro>0,"Oui","Non") AS "Reflux gastro-oesophagien", IF(glaucome>0,"Oui","Non") AS "Glaucome", IF(diabete>0,"Oui","Non") AS "Diabète", CONCAT(patienttypeDiabete.libelle,"(",id_typeDiabete,")") AS "", IF(hypercholesterolemie>0,"Oui","Non") AS "Hypercholestérolémie", IF(hypertriglyceridemie>0,"Oui","Non") AS "Hypertriglycéridémie", IF(dysthyroidie>0,"Oui","Non") AS "Dysthyroïdie", IF(depression>0,"Oui","Non") AS "Dépression", IF(sedentarite>0,"Oui","Non") AS "Sédentarité", IF(syndromeDApneesSommeil>0,"Oui","Non") AS "SAS", IF(obesite>0,"Oui","Non") AS "Obésité", IF(dysmorphieFaciale>0,"Oui","Non") AS "Dysmorphie faciale", TextObservations AS "", id_user FROM oms_patient LEFT JOIN oms_departement ON oms_departement.id = id_departement LEFT JOIN oms_pays ON oms_pays.id = id_pays LEFT JOIN patientsexe ON patientsexe.id = id_sexe LEFT JOIN patientprofession ON patientprofession.id = id_profession LEFT JOIN patienttypeDiabete ON patienttypeDiabete.id = id_typeDiabete WHERE oms_patient.id=1 You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'small"(conso régulière)", IF(refluxGastro0,"Oui","Non") as "Reflux ga' at line 1 "near 'small" <-- where is small o_O The PHP code isn't really relevant cause you won't see a lot. $db = mysql_connect(); mysql_select_db();//TODO SWITCH TO PDO mysql_query("SET NAMES UTF8"); $fields = $form->getFields($form); $settingsForm = $form->getSettings(); $sql = 'SELECT oms_patient.id,oms_patient.date,oms_patient.date_modif,'; foreach ($fields as $field) { if (!$field->isMultiSelect()) { $field->select_full(&$sql, 'oms_patient', null); } } if (isset($settingsForm['linkTo'])) { $idLinkTo = 'id_' . str_replace('oms_', '', $settingsForm['linkTo']); $sql .= $idLinkTo; } $sql.=' FROM oms_patient'; foreach ($fields as $field) { if (!$field->isMultiSelect() && $field->getTable('oms_patient')) { $sql .=' LEFT JOIN ' . $field->getTable('oms_patient') . ' ON ' . $field->getTable('oms_patient') . '.id = '.$field->getFieldName().' '; } } $sql.=' where oms_patient.id=' . $this->m_settings['e']; $result = mysql_query($sql) or die('Erreur SQL !<br>' . $sql . '<br>' . mysql_error()); $data = mysql_fetch_assoc($result); var_dump of $sql string(2663) "SELECT oms_patient.id,oms_patient.date,oms_patient.date_modif,date_modif,AES_DECRYPT(nom,"xxxxx") as "Nom",AES_DECRYPT("prenom","xxxxx") as "Prénom usuel",DATE_FORMAT(ddn, "%d/%m/%Y") as "Date de naissance",villeNaissance as "Lieu de naissance (ville)",CONCAT(oms_departement.libelle,"(",id_departement,")") as "Lieu de vie",CONCAT(oms_pays.libelle,"(",id_pays,")") as "Pays",CONCAT(patientsexe.libelle,"(",id_sexe,")") as "Sexe",CONCAT(patientprofession.libelle,"(",id_profession,")") as "Profession", IF"... can't go further to see what is in the output after the "..." <-- if you have an idea

  Read the article

• How do I get a button to show on mouseover using jQuery?

  - by sharataka

  I am trying to get a button to appear over an image when there is a mouseover event over the image. I have multiple images on the screen that I would like to have the same functionality. I'm having trouble getting this to work as the button is always present. Any advice on how to get it to work? Below is the rendered html and javascript. javascript <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.5.1/jquery.min.js"></script> <script src="http://code.jquery.com/jquery.min.js" type="text/javascript"></script> <script type = "text/javascript"> $(document).ready(function() { $('.image').mouseover(function(){ $('.munchbutton').show(); }); }); </script> css div.munchbutton{ position: absolute; bottom: 5px; right: 0px; left: 60px; } div.wrapper{ float:left; /* important */ position:relative; /* important(so we can absolutely position the description div */ padding: 5px; } html <!-- wrapper div --> <div class='wrapper'> <!-- image --> <div class="image" style="position: relative; left: 0; top: 0;"> <a href="/partners/Business/CNNMoney" > <img src="/static/CNNMoney.png" style="position: relative; top: 0; left: 0;"/> </a> <!-- partner munchbutton div --> <div class='munchbutton'> <form method='post'><div style='display:none'><input type='hidden' name='csrfmiddlewaretoken' value='7wq8pRYNCDkXUGRv7eU6qI1BU7RKyoT8' /></div> <input type="hidden" name="channel" id="channel" value="CNNMoney" /> <input type='submit' class = 'add' value='Add to plate'/> </form> </div> <!-- end munchbutton div --> </div> <!-- end image div --> </div> <!-- end wrapper div --> <!-- wrapper div --> <div class='wrapper'> <!-- image --> <div class="image" style="position: relative; left: 0; top: 0;"> <a href="/partners/Business/EconomistMagazine" > <img src="/static/EconomistMagazine.png" style="position: relative; top: 0; left: 0;"/> </a> <!-- partner munchbutton div --> <div class='munchbutton'> <form method='post'><div style='display:none'><input type='hidden' name='csrfmiddlewaretoken' value='7wq8pRYNCDkXUGRv7eU6qI1BU7RKyoT8' /></div> <input type="hidden" name="channel" id="channel" value="EconomistMagazine" /> <input type='submit' class = 'add' value='Add to plate'/> </form> </div> <!-- end munchbutton div --> </div> <!-- end image div --> </div> <!-- end wrapper div -->

  Read the article

• WinForm-style Invoke() in unmanaged C++

  - by Matt Green

  I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

  Read the article

• How to perform gui operation in doInBackground method?

  - by jM2.me

  My application reads a user selected file which contains addresses and then displays on mapview when done geocoding. To avoid hanging app the importing and geocoding is done in AsyncTask. public class LoadOverlayAsync extends AsyncTask<Uri, Integer, StopsOverlay> { Context context; MapView mapView; Drawable drawable; public LoadOverlayAsync(Context con, MapView mv, Drawable dw) { context = con; mapView = mv; drawable = dw; } protected StopsOverlay doInBackground(Uri... uris) { StringBuilder text = new StringBuilder(); StopsOverlay stopsOverlay = new StopsOverlay(drawable, context); Geocoder geo = new Geocoder(context, Locale.US); try { File file = new File(new URI(uris[0].toString())); BufferedReader br = new BufferedReader(new FileReader(file)); String line; while ((line = br.readLine()) != null) { StopOverlay stopOverlay = null; String[] tempLine = line.split("~"); List<Address> results = geo.getFromLocationName(tempLine[4] + " " + tempLine[5] + " " + tempLine[7] + " " + tempLine[8], 10); if (results.size() > 0) { Toast progressToast = Toast.makeText(context, "More than one yo", 1000); progressToast.show(); } else if (results.size() == 1) { Address addr = results.get(0); GeoPoint mPoint = new GeoPoint((int)(addr.getLatitude() * 1E6), (int)(addr.getLongitude() * 1E6)); stopOverlay = new StopOverlay(mPoint, tempLine); } if (stopOverlay != null) { stopsOverlay.addOverlay(stopOverlay); } //List<Address> results = geo.getFromLocationName(locationName, maxResults) } } catch (URISyntaxException e) { showErrorToast(e.toString()); //e.printStackTrace(); } catch (FileNotFoundException e) { showErrorToast(e.toString()); //e.printStackTrace(); } catch (IOException e) { showErrorToast(e.toString()); //e.printStackTrace(); } return stopsOverlay; } protected void onProgressUpdate(Integer... progress) { Toast progressToast = Toast.makeText(context, "Loaded " + progress.toString(), 1000); progressToast.show(); } protected void onPostExecute(StopsOverlay so) { //mapView.getOverlays().add(so); Toast progressToast = Toast.makeText(context, "Done geocoding", 1000); progressToast.show(); } protected void showErrorToast(String msg) { Toast Newtoast = Toast.makeText(context, msg, 10000); Newtoast.show(); } } But if geocode fails, I want a dialog popup to let user edit the address. That would require calling on gui method while in doInBackground. What would be a good workaround this?

  Read the article

• Unable to Use Simple JSOUP Example To Parse Website Table Data

  - by OhNoItsAnOverflow

  I'm attempting to extract the following data from a table via Android / JSOUP however I'm having a bit of trouble nailing down the process. I think I'm getting close to being able to do this using the code I've provided below - but for some reason I still cannot get my textview to display any of the table data. P.S. Live URL's can be provided if necessary. SOURCE: public class MainActivity extends Activity { TextView tv; final String URL = "http://exampleurl.com"; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main); tv = (TextView) findViewById(R.id.TextView01); new MyTask().execute(URL); } private class MyTask extends AsyncTask<String, Void, String> { ProgressDialog prog; String title = ""; @Override protected void onPreExecute() { prog = new ProgressDialog(MainActivity.this); prog.setMessage("Loading...."); prog.show(); } @Override protected String doInBackground(String... params) { try { Document doc = Jsoup.connect(params[0]).get(); Element tableElement = doc.getElementsByClass("datagrid") .first(); title = doc.title(); } catch (IOException e) { e.printStackTrace(); } return title; } @Override protected void onPostExecute(String result) { super.onPostExecute(result); prog.dismiss(); tv.setText(result); } } } TABLE: <table class="datagrid"> <tbody><tr> <th>Item No.</th> <th>Name</th> <th>Sex</th> <th>Location</th> </tr> <tr> <td><a href="redirector.cfm?ID=a33660a3-aae0-45e3-9703-d59d77717836&amp;page=1&amp;&amp;lname=&amp;fname=" title="501207593">501207593&nbsp;</a></td> <td>USER1</td> <td>M&nbsp;</td> <td>Unknown</td> </tr> <tr> <td><a href="redirector.cfm?ID=edf524da-8598-450f-9373-da87db8d6c84&amp;page=1&amp;&amp;lname=&amp;fname=" title="501302750">501302750&nbsp;</a></td> <td>USER2</td> <td>M&nbsp;</td> <td>Unknown</td> </tr> <tr> <td><a href="redirector.cfm?ID=a78abeea-7651-4ac1-bba2-0dcb272c8b77&amp;page=1&amp;&amp;lname=&amp;fname=" title="531201804">531201804&nbsp;</a></td> <td>USER3</td> <td>M&nbsp;</td> <td>Unknown</td> </tr> </tbody></table>

  Read the article

• Robust way to save/load objects with dependencies?

  - by mrteacup

  I'm writing an Android game in Java and I need a robust way to save and load application state quickly. The question seems to apply to most OO languages. To understand what I need to save: I'm using a Strategy pattern to control my game entities. The idea is I have a very general Entity class which e.g. stores the location of a bullet/player/enemy and I then attach a Behaviour class that tells the entity how to act: class Entiy { float x; float y; Behavior b; } abstract class Behavior { void update(Entity e); {} // Move about at a constant speed class MoveBehavior extends Behavior { float speed; void update ... } // Chase after another entity class ChaseBehavior extends Behavior { Entity target; void update ... } // Perform two behaviours in sequence class CombineBehavior extends Behavior { Behaviour a, b; void update ... } Essentially, Entity objects are easy to save but Behaviour objects can have a semi-complex graph of dependencies between other Entity objects and other Behaviour objects. I also have cases where a Behaviour object is shared between entities. I'm willing to change my design to make saving/loading state easier, but the above design works really well for structuring the game. Anyway, the options I've considered are: Use Java serialization. This is meant to be really slow in Android (I'll profile it sometime). I'm worried about robustness when changes are made between versions however. Use something like JSON or XML. I'm not sure how I would cope with storing the dependencies between objects however. Would I have to give each object a unique ID and then use these IDs on loading to link the right objects together? I thought I could e.g. change the ChaseBehaviour to store a ID to an entity, instead of a reference, that would be used to look up the Entity before performing the behaviour. I'd rather avoid having to write lots of loading/saving code myself as I find it really easy to make mistakes (e.g. forgetting to save something, reading things out in the wrong order). Can anyone give me any tips on good formats to save to or class designs that make saving state easier?

  Read the article

• Help to argue why to develop software on a physical computer rather than via a remote desktop

  - by s5804

  Remote desktops are great and many times a blessing and cost effective (instead of leasing expensive cables). I am not arguing against remote desktops, just if one have the alternative to use either remote desktop or physical computer, I would choose the later. Also note that I am not arguing for or against remote work practices. But in my case I am required to be physically present in the office when developing software. Background, I work in a company which main business is not to develop software. Therefore the company IT policies are mainly focused on security and to efficiently deploying/maintaing thousands of computer to users. Further, the typical employee runs typical Office applications, like a word processors. Because safety/stability is such a big priority, every non production system/application, shall be deployed into a physical different network, called the test network. Software development of course also belongs in the test network. To access the test network the company has created a standard policy, which dictates that access to the test network shall go only via a remote desktop client. Practically from ones production computer one would open up a remote desktop client to a virtual computer located in the test network. On the virtual computer's remote desktop one would be able to access/run/install all development tools, like Eclipse IDE. Another solution would be to have a dedicated physical computer, which is physically only connected to the test network. Both solutions are available in the company. I have tested both approaches and found running Eclipse IDE, SQL developer, in the remote desktop client to be sluggish (keyboard strokes are delayed), commands like alt-tab takes me out of the remote client, enjoying... Further, screen resolution and colors are different, just to mention a few. Therefore there is nothing technical wrong with the remote client, just not optimal and frankly de-motivating. Now with the new policies put in place, plans are to remove the physical computers connected to the test network. I am looking for help to argue for why software developers shall have a dedicated physical software development computer, to be productive and cost effective. Remember that we are physically in office. Further one can notice that we are talking about approx. 50 computers out of 2000 employees. Therefore the extra budget is relatively small. This is more about policy than cost. Please note that there are lots of similar setups in other companies that work great due to a perfectly tuned systems. However, in my case it is sluggish and it would cost more money to trouble shoot the performance and fine tune it rather than to have a few physical computers. As a business case we have argued that productivity will go down by 25%, however it's my feeling that the reality is probably closer to 50%. This business case isn't really accepted and I find it very difficult to defend it to managers that has never ever used a rich IDE in their life, never mind developed software. Further the test network and remote client has no guaranteed service level, therefore it is down for a few hours per month with the lowest priority on the fix list. Help is appreciated.

  Read the article

< Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >