Search Results

Search found 26454 results on 1059 pages for 'post parameter'.

Page 507/1059 | < Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >

  • Need help converting SQL to EF4 please

    - by Ken Eldridge
    I need help converting this SQL statement, into EF4: Select Posts.PostID, Post, Comment from Posts left join Comments on posts.PostID = Comments.PostID Where CommentID not in ( Select PostID from Votes where VoteTypeID = 4 --4 = flagged comment type ) In my database, the Votes table stores either the PostID of reported posts, or CommentID of reported comments in the column Votes.PostID Thanks in advance!

    Read the article

  • RegExp to validate a formula (string/boolean/numeric expression)?

    - by JSteve
    I have used regExp quit a bit of times but still far from being an expert. This time I want to validate a formula (or math expression) by regExp. The difficult part here is to validate proper starting and ending parentheses with in the formula. I believe, there would be some sample on the web but I could not find it. Can somebody post a link for such example? or help me by some other means?

    Read the article

  • Ajax doesn't work on remote server .

    - by Nuha
    Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

    Read the article

  • Shipping application required

    - by zohair
    Hi, Can anyone recommend a good FREE shipping application where I can get rates from different courier services, and perform tracking of packages. If there aren't any free ones, do the courier services themselves have API's or webservices of their own? We were thinking of creating an ASP.NET web application in C# that got quotes from FedEx, Purolator, and Canada Post for a specified package. Any help/suggestions are welcome Thank you

    Read the article

  • C++ array initialization without assignment

    - by david
    This question is related to the post here. Is it possible to initialize an array without assigning it? For example, class foo's constructor wants an array of size 3, so I want to call foo( { 0, 0, 0 } ). I've tried this, and it does not work. I'd like to be able to initialize objects of type foo in other objects' constructor initialization lists. Is this possible?

    Read the article

  • GAE HTTP method support

    - by areich
    I get an "unrecognized HTTP method" when trying to do a REPORT request using httplib and gae. Is there a workaround available? An httplib patch for gae? Do you I have to find another host in order to do this natively? According to the docs, only certain fetch actions are valid: GET, POST, HEAD, PUT, and DELETE: http://code.google.com/appengine/docs/python/urlfetch/ fetchfunction.html

    Read the article

  • Problems with MYSQL database

    - by shinjuo
    I have a database that worked fine until I decided to add a log onto the page. here is what I have now: <body> <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { require("serverInfo.php"); mysql_query("UPDATE `cardLists` SET `AmountLeft` = `AmountLeft` + ".mysql_real_escape_string($_POST['Add'])." WHERE `cardID` = '".mysql_real_escape_string($_POST['Cards'])."'"); echo "\"" .$_POST['Add'] ."\" has been added to the inventory amount for the card \"". $_POST['Cards']. "\""; mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <?php require("serverInfo.php"); ?> <?php $res = mysql_query("SELECT * FROM cardLists order by cardID") or die(mysql_error()); echo "<select name = 'Cards'>"; while($row=mysql_fetch_assoc($res)) { echo "<option value=\"$row[cardID]\">$row[cardID]</option>"; } echo "</select>"; ?> Amount to Add: <input type="text" name="Add" maxlength="8" /> Changes Made By: <select name="Person"> <option value="justin">Justin</option> <option value="chris">Chris</option> <option value="matt">Matt</option> <option value="dan">Dan</option> <option value="tim">Tim</option> <option value="amanda">Amanda</option> </select> <input type="submit" name ="submit" onClick= "return confirm( 'Are you sure you want to add this amount?');"> </form> <br /> <input type="button" name="main" value="Return To Main" onclick="window.location.href='index.php';" /> </body> </html> it works fine until I added the: mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); Can anyone see what is going on?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to get Twitter tweets done by me with an HTTP Request

    - by Tharindu Madushanka
    Hi, Is it possible to simply get the twitter posts done by a particular user into an application with simple http requests without logging in. As xml or json format. what I want to do is I want to get my twitter feeds as xml or json with a request, is it possible to do that. Could someone post example http request if its possible to do so. Thank you and Kind Regards, Tharindu Madushanka

    Read the article

  • Where should I put the code for a Django admin action for a third party app?

    - by charlie
    Hi, I'm new to Django. I am writing my own administrative action for a third party app/model, similar to this: http://mnjournal.com/post/2009/jul/10/adding-django-admin-actions-contrib-apps/ It's a simple snippet of code. I'm just wondering where people suggest that I put it. I don't want to put in the third party app because I might need to update to a newer version at some point. Thanks.

    Read the article

  • Variable disappears when I log in

    - by John
    Hello, I have profile page where the profile is retrieved via GET. The index file has this: $profile = $_GET['profile']; When I log in on the profile page, the $profile variable disappears. Here is the form action on the login function: <form name="login-form" id="login-form" method="post" action="./index.php"> (The $profile variable is separate of the login username.) How could I make the page retain the $profile variable? Thanks in advance, John

    Read the article

  • REST verbs - which convention is "correct"

    - by ctacke
    I'm well into implementing a REST service (on a Windows CE platform if that matters) and I started out using IBM's general definitions of using POST for creating (INSERTs) and PUT for updating. Now I've run across Sun's definitions which are exactly the opposite. So my question is, which is the "generally accepted" definition? Or is there even one?

    Read the article

  • True random number generator

    - by goldenmean
    Sorry for this not being a "real" question, but Sometime back i remember seeing a post here about randomizing a randomizer randomly to generate truly random numbers, not just pseudo random. I dont see it if i search for it. Does anybody know about that article?

    Read the article

  • Implementing the server side of Webhooks

    - by Howiecamp
    If I want to Webhooks-enable a web application (I'm referring to the server-side of things, ie the server where the event happens and the callback is initiated from), are there libraries for this, or is this functionality typically part of the web server stack? Or, am I looking at this incorrectly, and to implement Webhooks I simply code my application to do an HTTP POST callback based on whatever events I care about?

    Read the article

  • How do you override ProgramFilesFolder in an msi?

    - by Mark
    I have an msi file that I am trying to install in a place other than C:\Program Files. The directory table shows that ProgramFilesFolder is used as the default install directory. From reading this blog post I understand that ProgramFilesFolder is a standard directory so passing TARGETDIR as a property to the installer will not change the install location even through the directory table has it as the parent of ProgramFilesFolder. How can I override the install location? I am a total novice in this area.

    Read the article

  • What am I doing wrong? (Simple Assembly Loop)

    - by sunnyohno
    It won't let me post the picture. Btw, Someone from Reddit.programming sent me over here. So thanks! TITLE MASM Template ; Description ; ; Revision date: INCLUDE Irvine32.inc .data myArray BYTE 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 .code main PROC call Clrscr mov esi, OFFSET myArray mov ecx, LENGTHOF myArray mov eax, 0 L1: add eax, [esi] inc esi loop L1 call WriteInt exit main ENDP END main Results in: -334881242

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

  • Embedding existing page in a CakePHP site

    - by lhahne
    We have an existing PHP page (from an earlier project) which could be described as cryptic and ancient. It basically displays a form, catches the input and runs an external application to process the input and then pipes the output to the user. I would really like not to modify this file any more than is required. Would there be an easy way to just make this file magically work by copying it to some location in the CakePHP's directory and have it receive $POST etc. as usual?

    Read the article

  • IP address of domain on shared host

    - by Ali
    I have domain on a shared hosting provider. How do I find the direct IP address of my domain using Python? Is it possible to post to a script on my domain using the IP address and not the website itself? Thanks.

    Read the article

  • Netcat / Apache solution to send data to PHP

    - by ToughPal
    Hi, I have this device that sends XML data to a webserver in format as follows POST HTTP/1.1 Content-Type:text/xml Content-Length:369 Followed by XML The problem here is that apache simply sends 400 error for this and does not work. Is there anyway to create netcat to read xml and send to php? Any other solution welcome! Is it better to run php to listen to Port? in that case will multiple requests at the same time work?

    Read the article

  • HorizontalFieldmanager overlay

    - by Dachmt
    Hi, I have a VerticalFieldManager that takes all my screen, and I want to put an HorizontalFieldmanager at the bottom of the screen (menu bar that appear and disappear like the WeatherEye menu bar) that overlay the VerticalFieldManager. Any idea? I think it's something with overwriting the paint or sublayout methods but I have no clue how to implement this... Thanks to Max, I have almost everything, but in my other post it resize the VerticalFieldManager instead of having the HorizontalFieldmanager overlaying it. Thank you!

    Read the article

  • simple IDE in C,link my program to gcc

    - by Moein Hoseini Manesh
    hi my friends, I wanna to write simple C compiler,I wrote some parts of it it can check synetic of C,now I need to link my program to gcc how can I do it? I wanna to link it,for example when user open file in my programm,gcc compile it and save it where the user want. now I don't now how to say gcc to complie this file,show error and ... [english is not my mother language,and my english is not so well,so I apologize for any mistake in my post or If I can't reached my mean]

    Read the article

< Previous Page | 503 504 505 506 507 508 509 510 511 512 513 514  | Next Page >