Search Results

Search found 13757 results on 551 pages for 'decimal format'.

Page 511/551 | < Previous Page | 507 508 509 510 511 512 513 514 515 516 517 518  | Next Page >

  • Generating Unordered List with PHP + CodeIgniter from a MySQL Database

    - by Tim
    Hello Everyone, I am trying to build a dynamically generated unordered list in the following format using PHP. I am using CodeIgniter but it can just be normal php. This is the end output I need to achieve. <ul id="categories" class="menu"> <li rel="1"> Arts &amp; Humanities <ul> <li rel="2"> Photography <ul> <li rel="3"> 3D </li> <li rel="4"> Digital </li> </ul> </li> <li rel="5"> History </li> <li rel="6"> Literature </li> </ul> </li> <li rel="7"> Business &amp; Economy </li> <li rel="8"> Computers &amp; Internet </li> <li rel="9"> Education </li> <li rel="11"> Entertainment <ul> <li rel="12"> Movies </li> <li rel="13"> TV Shows </li> <li rel="14"> Music </li> <li rel="15"> Humor </li> </ul> </li> <li rel="10"> Health </li> And here is my SQL that I have to work with. -- -- Table structure for table `categories` -- CREATE TABLE IF NOT EXISTS `categories` ( `id` mediumint(8) NOT NULL auto_increment, `dd_id` mediumint(8) NOT NULL, `parent_id` mediumint(8) NOT NULL, `cat_name` varchar(256) NOT NULL, `cat_order` smallint(4) NOT NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1 ; So I know that I am going to need at least 1 foreach loop to generate the first level of categories. What I don't know is how to iterate inside each loop and check for parents and do that in a dynamic way so that there could be an endless tree of children. Thanks for any help you can offer. Tim

    Read the article

  • How to develop a Jquery plugin to find the first child that match with a selector?

    - by Ivan
    I'm trying to make a Jquery plugin (findFirst()) to find the first child with a given characteristics (something in the middle of the find() and children() functions. For instance, given this markup: <div id="start"> <div> <span>Hello world</span> <ul class="valid-result"> ... </ul> <ul class="valid-result"> <li> <ul class="not-a-result"> ... </ul> </li> </ul> <div> <ul class="valid-result"> ... </ul> </div> </div> </div> If you ask for $("#start").findFirst('ul') it should return all ul lists that I have tagged with the valid-result class, but not the ul with class not-a-result. It is, this function has to find the first elements that matches with a given selector, but not the inner elements that match this selector. This is the first time I try to code a Jquery function, and what I've already read doesn't helps me too much with this. The function I have developed is this: jQuery.fn.findFirst = function (sel) { return this.map(function() { return $(this).children().map(function() { if ($(this).is(sel)) { return $(this); } else { return $(this).findFirst(sel); } }); }); } It works in the sense it tries to return the expected result, but the format it returns the result is very rare for me. I suppose the problem is something I don't understand about Jquery. Here you have the JFiddle where I'm testing. EDIT The expected result after $("#start").findFirst('ul') is a set with all UL that have the class 'valid-result' BUT it's not possible to use this class because it doesn't exist in a real case (it's just to try to explain the result). This is not equivalent to first(), because first returns only one element!

    Read the article

  • Use of text() function when using xPath in dom4j

    - by jlawless
    I have inherited an application that parses xml using dom4j and xPath: The xml being parsed is similar to the following: <cache> <content> <transaction> <page> <widget name="PAGE_ID">WRK_REGISTRATION</widget> <widget name="TRANS_DETAIL_ID">77145</widget> <widget name="GRD_ERRORS" /> </page> <page> <widget name="PAGE_ID">WRK_REGISTRATION</widget> <widget name="TRANS_DETAIL_ID">77147</widget> <widget name="GRD_ERRORS" /> </page> <page> <widget name="PAGE_ID">WRK_PROCESSING</widget> <widget name="TRANS_DETAIL_ID">77152</widget> <widget name="GRD_ERRORS" /> </page> </transaction> </content> </cache> Individual Nodes are being searched using the following: String xPathToGridErrorNode = "//cache/content/transaction/page/widget[@name='PAGE_ID'][text()='WRK_DNA_REGISTRATION']/../widget[@name='TRANS_DETAIL_ID'][text()='77147']/../widget[@name='GRD_ERRORS_TEMP']"; org.dom4j.Element root = null; SAXReader reader = new SAXReader(); Document document = reader.read(new BufferedInputStream(new ByteArrayInputStream(xmlToParse.getBytes()))); root = document.getRootElement(); Node gridNode = root.selectSingleNode(xPathToGridErrorNode); where xmlToParse is a String of xml similar to the excerpt provided above. The code is trying to obtain the GRD_ERROR node for the page with the PAGE_ID and TRANS_DETAIL_ID provided in the xPath. I am seeing an intermittent (~1-2%) failure (returned node is null) of this selectSingleNode request even though the requested node is in the xml being searched. I know there are some gotchas associated with using text()= in xPath and was wondering if there was a better way to format the xPath string for this type of search.

    Read the article

  • MATLAB image corner coordinates & referncing to cell arrays

    - by James
    Hi, I am having some problems comparing the elements in different cell arrays. The context of this problem is that I am using the bwboundaries function in MATLAB to trace the outline of an image. The image is of a structural cross section and I am trying to find if there is continuity throughout the section (i.e. there is only one outline produced by the bwboundaries command). Having done this and found where the is more than one section traced (i.e. it is not continuous), I have used the cornermetric command to find the corners of each section. The code I have is: %% Define the structural section as a binary matrix (Image is an I-section with the web broken) bw(20:40,50:150) = 1; bw(160:180,50:150) = 1; bw(20:60,95:105) = 1; bw(140:180,95:105) = 1; Trace = bw; [B] = bwboundaries(Trace,'noholes'); %Traces the outer boundary of each section L = length(B); % Finds number of boundaries if L > 1 disp('Multiple boundaries') % States whether more than one boundary found end %% Obtain perimeter coordinates for k=1:length(B) %For all the boundaries perim = B{k}; %Obtains perimeter coordinates (as a 2D matrix) from the cell array end %% Find the corner positions C = cornermetric(bw); Areacorners = find(C == max(max(C))) % Finds the corner coordinates of each boundary [rowindexcorners,colindexcorners] = ind2sub(size(Newgeometry),Areacorners) % Convert corner coordinate indexes into subcripts, to give x & y coordinates (i.e. the same format as B gives) %% Put these corner coordinates into a cell array Cornerscellarray = cell(length(rowindexcorners),1); % Initialises cell array of zeros for i =1:numel(rowindexcorners) Cornerscellarray(i) = {[rowindexcorners(i) colindexcorners(i)]}; %Assigns the corner indicies into the cell array %This is done so the cell arrays can be compared end for k=1:length(B) %For all the boundaries found perim = B{k}; %Obtains coordinates for each perimeter Z = perim; % Initialise the matrix containing the perimeter corners Sectioncellmatrix = cell(length(rowindexcorners),1); for i =1:length(perim) Sectioncellmatrix(i) = {[perim(i,1) perim(i,2)]}; end for i = 1:length(perim) if Sectioncellmatrix(i) ~= Cornerscellarray Sectioncellmatrix(i) = []; %Gets rid of the elements that are not corners, but keeps them associated with the relevent section end end end This creates an error in the last for loop. Is there a way I can check whether each cell of the array (containing an x and y coordinate) is equal to any pair of coordinates in cornercellarray? I know it is possible with matrices to compare whether a certain element matches any of the elements in another matrix. I want to be able to do the same here, but for the pair of coordinates within the cell array. The reason I don't just use the cornercellarray cell array itself, is because this lists all the corner coordinates and does not associate them with a specific traced boundary.

    Read the article

  • Paging & Sorting grids with ASP.Net MVC

    - by Scott Ivey
    I'm new to MVC, and am not following how you'd do paging and sorting on a grid. I'm used to using the asp.Net GridView control with an ObjectDataSource pointed at objects in our business layer - and in that case the ODS handles all of the paging & sorting using the methods that our ORM generates on the objects. I've looked at using the same ORM with MVC - and things work out fine there - i just loop thru the collections to build the table on the page - but without the ODS to handle the paging & sorting, i'm confused as to how I'd handle that. Would I have a separate controller for the paging and sorting? I'm not sure what the best practices are for this scenario, so if someone can point me in the right direction it would be much appreciated. Edit: Ok, so I understand that I need to roll my own - but where do I start? I've created a CustomerController, and a view that displays a table of customers that looks like below - and I want to sort on FirstName or LastName columns. My Model has a Sort() method on it that'll take a string sort expression in the format that would be used by a GridView/ODS pair. Would I create a new Action on my CustomerController called Sort, and put an ActionLink in my header? <table> <tr> <th> First Name </th> <th> Last Name </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.Encode(item.FirstName) %> </td> <td> <%= Html.Encode(item.LastName) %> </td> </tr> <% } %> </table>

    Read the article

  • Activity gets killed while executing the camera intent

    - by BlackRider
    In my app I call the system camera to take a picture, and then handle the result in onActivityResult. You know, the usual. It used to work, but now my calling activity gets killed while I'm taking the picture. Specifically, onDestroy() is called on my activity right after I press the camera shutter. The photo does get taken & saved (I've checked that the file gets written on the SD card). After I accept the photo, instead of returning to the calling activity and invoking onActivityResult, the previous activity in the activity stack gets called. I see no exceptions in the logcat. My custom exception handler doesn't get called. If it matters, my app also includes a service that listens to GPS updates, but I unregister all the receivers in onPause(). Here's the call stack for MyCallingActivity.onDestroy(): Thread [<1> main] (Suspended (breakpoint at line 303 in NewPlaceDetailsActivity)) NewPlaceDetailsActivity.onDestroy() line: 303 ActivityThread.performDestroyActivity(IBinder, boolean, int, boolean) line: 2663 ActivityThread.handleDestroyActivity(IBinder, boolean, int, boolean) line: 2694 ActivityThread.access$2100(ActivityThread, IBinder, boolean, int, boolean) line: 117 BinderProxy(ActivityThread$H).handleMessage(Message) line: 968 ActivityThread$H(Handler).dispatchMessage(Message) line: 99 Looper.loop() line: 130 ActivityThread.main(String[]) line: 3687 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 842 ZygoteInit.main(String[]) line: 600 NativeStart.main(String[]) line: not available [native method] This is how I start the camera activity, in case you're wondering: protected void startCamera() { createPhotoDirsIfNeeded(); String fileName = "temp.jpg"; ContentValues values = new ContentValues(); values.put(MediaStore.Images.Media.TITLE, fileName); m_capturedImageUri = getContentResolver().insert(MediaStore.Images.Media.EXTERNAL_CONTENT_URI, values); m_photoFileName = APP_PHOTO_PATH + "/" + DateFormat.format(DATE_FORMAT, Calendar.getInstance().getTime()) + ".jpg"; File picFile = new File(m_photoFileName); if(picFile.exists()) { picFile.delete(); } // start the camera activity Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); intent.putExtra(MediaStore.EXTRA_OUTPUT, Uri.fromFile(picFile)); startActivityForResult(intent, IntentHelper.REQUEST_TAKE_PHOTO); } How can I find out why does my activity get killed, AND removed from the stack instead of being created again?

    Read the article

  • angular-ui-router : breadcrumps ok but view ko

    - by anakin59490
    this is my app.router.js : agentRouter.config([ '$stateProvider', '$urlRouterProvider', function($stateProvider, $urlRouterProvider) { var root = { name: 'root', abstract: true, url: '', title: 'home', views: { 'header': { templateUrl: 'views/headers/header.app.html', controller: 'HeaderCtrl' }, 'body': { templateUrl: "views/root.html" }, 'footer': { templateUrl: 'views/footers/footer.app.html' } } }; var agent = { name: 'root.agent', url: '/agent', title: 'agent', views: { 'root.sidebar': { templateUrl: "views/main.sidebar.html" }, 'root.container': { templateUrl: "views/partials/agent/list.container.html" } } }; var detail = { name: 'root.agent.detail', url: '/detail/:id', title: 'agentDetail', // use for breadcrumb views: { 'root.sidebar': { templateUrl: "views/main.sidebar.html" }, 'root.container': { templateUrl: "views/partials/agent/list.chantier.html" } } }; /.../ $stateProvider.state(root); $stateProvider.state(agent); $stateProvider.state(detail); } ]); and this is my root.html : <!--Breadcrumb content--> <ul class="row breadcrumb"> <i class="glyphicon glyphicon-home" style=""></i> <li ng-repeat="state in $state.$current.path"> <a ng-href="#{{state.url.format($stateParams)}}"><span ng-bind="state.title"></span></a> <span ng-hide="$last" class=""></span> </li> </ul> <!--Sidebar content--> <div ui-view="root.sidebar">default root.sidebar</div> <!--Container content--> <div style="background-color: #f9f9f9" ui-view="root.container">default root.container</div> I can access to my "agent" page (a list of person) and my breadcrumb is right : home / agent but when i click on an item of the list i got always the same page but my breadcrumb is right : home / agent / agentDetail but in app.router.js if change detail like this : var detail = { name: 'root.detail', // référence initiale + detail (fils) url: '/agent/detail/:id', // réference utilisée dans les fichiers HTML, attention c'est la suite de l'url précédente!!! title: 'agentDetail', // référence utilisée pour le breadcump views: { 'root.sidebar': { templateUrl: "views/main.sidebar.html" }, 'root.container': { templateUrl: "views/partials/agent/list.chantier.html" } } }; i got the right page (list.chantier.xml) but the breadcrumb is false : home / agentDetail instead of home / agent / agentDetail I would like to got the right breadcrumb (home / agent / agentDetail) with the right page (list.chantier.html) when i click on an item of the agent list page (list.container.html) Thank you in advance for your help

    Read the article

  • Internet Explorer 8 + Deflate

    - by Andreas Bonini
    I have a very weird problem.. I really do hope someone has an answer because I wouldn't know where else to ask. I am writing a cgi application in C++ which is executed by Apache and outputs HTML code. I am compressing the HTML output myself - from within my C++ application - since my web host doesn't support mod_deflate for some reason. I tested this with Firefox 2, Firefox 3, Opera 9, Opera 10, Google Chrome, Safari, IE6, IE7, IE8, even wget.. It works with ANYTHING except IE8. IE8 just says "Internet Explorer cannot display the webpage", with no information whatsoever. I know it's because of the compression only because it works if I disable it. Do you know what I'm doing wrong? I use zlib to compress it, and the exact code is: /* Compress it */ int compressed_output_size = content.length() + (content.length() * 0.2) + 16; char *compressed_output = (char *)Alloc(compressed_output_size); int compressed_output_length; Compress(compressed_output, compressed_output_size, (void *)content.c_str(), content.length(), &compressed_output_length); /* Send the compressed header */ cout << "Content-Encoding: deflate\r\n"; cout << boost::format("Content-Length: %d\r\n") % compressed_output_length; cgiHeaderContentType("text/html"); cout.write(compressed_output, compressed_output_length); static void Compress(void *to, size_t to_size, void *from, size_t from_size, int *final_size) { int ret; z_stream stream; stream.zalloc = Z_NULL; stream.zfree = Z_NULL; stream.opaque = Z_NULL; if ((ret = deflateInit(&stream, CompressionSpeed)) != Z_OK) COMPRESSION_ERROR("deflateInit() failed: %d", ret); stream.next_out = (Bytef *)to; stream.avail_out = (uInt)to_size; stream.next_in = (Bytef *)from; stream.avail_in = (uInt)from_size; if ((ret = deflate(&stream, Z_NO_FLUSH)) != Z_OK) COMPRESSION_ERROR("deflate() failed: %d", ret); if (stream.avail_in != 0) COMPRESSION_ERROR("stream.avail_in is not 0 (it's %d)", stream.avail_in); if ((ret = deflate(&stream, Z_FINISH)) != Z_STREAM_END) COMPRESSION_ERROR("deflate() failed: %d", ret); if ((ret = deflateEnd(&stream)) != Z_OK) COMPRESSION_ERROR("deflateEnd() failed: %d", ret); if (final_size) *final_size = stream.total_out; return; }

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Need help helping in converting jquery, ajax, json and asp.net

    - by Haja Mohaideen
    I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • How can call a JQuery function when it in side the from view (asp.net control)?

    - by ricky roy
    Hi, All I have a Span in side the Form view. I wanted to Call a Jquery Fucntion when the from load how can i do this? Thanks Waiting for your reply here is my code <asp:FormView ID="FormView1" runat="server" OnItemCommand="FormView1_ItemCommand"> <ItemTemplate> <asp:HiddenField ID="hidProductID" Value='<%#Eval("ProductID") %>' runat="server" /> <asp:HiddenField ID="hidCustomerID" Value='<%#Eval("CustomerID") %>' runat="server" /> <a href='<%=WinToSave.SettingsConstants.SiteURL%>WintoSave/AuctionProduct.aspx?id=<%#Eval("ProductID") %>'> <%#Eval("ProductName")%> </a> <br /> <img src='<%#Eval("ImagePath")%>' alt="Image No available" /> <br /> <asp:Label ID="lblTime" runat="server" Text='<%#Convert.ToDateTime(Eval("ModifiedOn")).ToString("hh:mm:ss") %>'></asp:Label> <span id='Countdown_<%#Eval("ProductID") %>' onload="GetTimeOnLoad('<%#Eval("ModifiedOn")%>','Countdown_<%#Eval("ProductID") %>');"></span> <br /> <asp:Label ID="lblFinalPrice" runat="server" Text='<%#Convert.ToDouble(Eval("FinalPrice")).ToString("#.00")%>'></asp:Label> <br /> <asp:Label ID="lblFullName" runat="server" Text='<%#Eval("FullName") %>'></asp:Label> <br /> <asp:Button ID="btnAddbid" Text="Bid" CommandName="AddBid" CommandArgument='<%#Eval("ID")%>' runat="server" /> </ItemTemplate> </asp:FormView> and following is my jquery code function GetTimeOnLoad(shortly,DivID) { var dt = new Date(shortly); alert(dt); alert(shortly); alert(DivID); var ProductDivID = "#" +DivID; alert(ProductDivID); $(ProductDivID).countdown({ until: dt, onExpiry: liftOff, onTick: watchCountdown, format: 'HMS', layout: '{hnn}{sep}{mnn}{sep}{snn}' }); } function liftOff(){}; function watchCountdown(){}; In above code I Used ' onload="GetTimeOnLoad('<%#Eval("ModifiedOn")%','Countdown_<%#Eval("ProductID") %');" but is not working

    Read the article

  • Application error when drawing to SurfaceView

    - by DKDiveDude
    I'm am doing a simple coding attempt trying to draw on a SurfaceView created on my main.xml layout. I can change background color and display an icon fine, but when I try to draw I get an error. I am a newbie so obvious I am missing something, please lent a helping hint, thanks! main.xml <?xml version="1.0" encoding="utf-8"?> <SurfaceView android:id="@+id/Paper" android:layout_height="fill_parent" android:layout_width="fill_parent"> </SurfaceView> and code here; package com.example.SurfaceViewTest; import android.app.Activity; import android.graphics.Bitmap; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.os.Bundle; import android.view.SurfaceHolder; import android.view.SurfaceView; public class SurfaceViewTest extends Activity implements SurfaceHolder.Callback { private SurfaceView mSurfaceView; private SurfaceHolder mSurfaceHolder; private Paint paint; private Canvas canvas; Bitmap mDrawing; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mSurfaceView = (SurfaceView) this.findViewById(R.id.Paper); mSurfaceHolder = mSurfaceView.getHolder(); mSurfaceHolder.addCallback(this); mSurfaceHolder.setType(SurfaceHolder.SURFACE_TYPE_PUSH_BUFFERS); } @Override public void surfaceChanged(SurfaceHolder holder, int format, int width, int height) { // TODO Auto-generated method stub } @Override public void surfaceCreated(SurfaceHolder holder) { mSurfaceView.setBackgroundColor(Color.rgb(0, 255, 0)); //mSurfaceView.setBackgroundResource(R.drawable.icon); canvas = holder.lockCanvas(null); mDrawing = Bitmap.createBitmap(100, 100, Bitmap.Config.RGB_565); canvas.setBitmap(mDrawing); paint = new Paint(); paint.setColor(Color.rgb(255, 255,255)); canvas.drawLine(1,1,200,300, paint); holder.unlockCanvasAndPost(canvas); } @Override public void surfaceDestroyed(SurfaceHolder holder) { // TODO Auto-generated method stub } }

    Read the article

  • gcc optimization? bug? and its practial implication to project

    - by kumar_m_kiran
    Hi All, My questions are divided into three parts Question 1 Consider the below code, #include <iostream> using namespace std; int main( int argc, char *argv[]) { const int v = 50; int i = 0X7FFFFFFF; cout<<(i + v)<<endl; if ( i + v < i ) { cout<<"Number is negative"<<endl; } else { cout<<"Number is positive"<<endl; } return 0; } No specific compiler optimisation options are used or the O's flag is used. It is basic compilation command g++ -o test main.cpp is used to form the executable. The seemingly very simple code, has odd behaviour in SUSE 64 bit OS, gcc version 4.1.2. The expected output is "Number is negative", instead only in SUSE 64 bit OS, the output would be "Number is positive". After some amount of analysis and doing a 'disass' of the code, I find that the compiler optimises in the below format - Since i is same on both sides of comparison, it cannot be changed in the same expression, remove 'i' from the equation. Now, the comparison leads to if ( v < 0 ), where v is a constant positive, So during compilation itself, the else part cout function address is added to the register. No cmp/jmp instructions can be found. I see that the behaviour is only in gcc 4.1.2 SUSE 10. When tried in AIX 5.1/5.3 and HP IA64, the result is as expected. Is the above optimisation valid? Or, is using the overflow mechanism for int not a valid use case? Question 2 Now when I change the conditional statement from if (i + v < i) to if ( (i + v) < i ) even then, the behaviour is same, this atleast I would personally disagree, since additional braces are provided, I expect the compiler to create a temporary built-in type variable and them compare, thus nullify the optimisation. Question 3 Suppose I have a huge code base, an I migrate my compiler version, such bug/optimisation can cause havoc in my system behaviour. Ofcourse from business perspective, it is very ineffective to test all lines of code again just because of compiler upgradation. I think for all practical purpose, these kinds of error are very difficult to catch (during upgradation) and invariably will be leaked to production site. Can anyone suggest any possible way to ensure to ensure that these kind of bug/optimization does not have any impact on my existing system/code base? PS : When the const for v is removed from the code, then optimization is not done by the compiler. I believe, it is perfectly fine to use overflow mechanism to find if the variable is from MAX - 50 value (in my case).

    Read the article

  • Programmatically created GridView cells don't scale to fit screen

    - by ChrisAshton84
    I've read a ton of other responses about GridView already but almost all deal with the XML format (which I had working). I wanted to learn the programmatic way of designing Android, though, so I'm trying to build most of this app without XML. All I define in XML are the GridView and the first TextView. After that I add the other LinearLayouts in onCreate(). I would like to have a 2 column GridView containing a title and several (4 for now) LinearLayouts. I realize from documentation that the GridView won't scale cells unless they have a gravity set, but no matter how I try to do this I can't get it to work. After adding two cells, my GridView tree would look like: GridView -> TextView (colspan 2) -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView I've tried about every combination of FILL and FILL_HORIZONTAL I could think of on either the outermost LinearLayouts, or also trying on the TextViews and inner LinearLayouts. No matter what I do, the LinearLayouts I add are always sized as small as possible and pushed to the left of the screen. Meanwhile, the first TextView (the colspan 2 one) with only CENTER_HORIZONTAL set is correctly centered in the screen. Its as if that TextView gets one idea of the column widths and the LinearLayouts get another! (If I add the FILL Gravity for it, it also moves all the way left.) I believe I had this working accidentally with 100% XML, but I would prefer not to switch back unless this is known to not work programatically. Any ideas what I can try to get this working?

    Read the article

  • How to put Google adsense in iPhone application?

    - by oksk
    Hi all. I have a question about adsense. I want to put Google adsense in my application to be developed. But after testing my code, It wasn't shown. this is my code self.webView.userInteractionEnabled = NO; NSMutableString *manageableHTML = [[[NSMutableString alloc] init] autorelease]; [manageableHTML appendFormat:@"<html><head></head>"]; [manageableHTML appendFormat:@"<body>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\"><!--"]; [manageableHTML appendFormat:@"window.googleAfmcRequest = {"]; [manageableHTML appendFormat:@"client: 'ca-mb-pub-7564235160823935',"]; [manageableHTML appendFormat:@"ad_type: 'text_image',"]; [manageableHTML appendFormat:@"output: 'html',"]; [manageableHTML appendFormat:@"channel: '2052458338',"]; [manageableHTML appendFormat:@"format: '320x50_mb',"]; [manageableHTML appendFormat:@"oe: 'utf8',"]; [manageableHTML appendFormat:@"color_border: '336699',"]; [manageableHTML appendFormat:@"color_bg: 'FFFFFF',"]; [manageableHTML appendFormat:@"color_link: '0000FF',"]; [manageableHTML appendFormat:@"color_text: '000000',"]; [manageableHTML appendFormat:@"color_url: '008000',"]; [manageableHTML appendFormat:@"};"]; [manageableHTML appendFormat:@"//--></script>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\" "]; [manageableHTML appendFormat:@"src=\"http://pagead2.googlesyndication.com/pagead/show_afmc_ads.js\"></script>"]; [manageableHTML appendFormat:@"</body></html>"]; [self.webView loadHTMLString:manageableHTML baseURL:nil]; [self.view addSubview:self.webView]; Bofore testing, this javascript code are well operated in my google blog. I found that this code work at only mobile device. and I checked it through safari of my ipod touch. (It works well.) But Checking in the application, I don't see adsense. what is something wrong?

    Read the article

  • XML serialization options in .NET

    - by Borek
    I'm building a service that returns an XML (no SOAP, no ATOM, just plain old XML). Say that I have my domain objects already filled with data and just need to transform them to the XML format. What options do I have on .NET? Requirements: The transformation is not 1:1. Say that I have an Address property of type Address with nested properties like Line1, City, Postcode etc. This may need to result in an XML like <xaddr city="...">Line1, Postcode</xaddr>, i.e. quite different. Some XML elements/attributes are conditional, for example, if a Customer is under 18, the XML needs to contain some additional information. I only need to serialize the objects to XML, the other direction (XML to objects) is not important Some technologies, i.e. Data Contracts use .NET attributes. Other means of configuration (external XML config, buddy classes etc.) would be a plus. Here are the options as I see them as the moment. Corrections / additions will be very welcome. String concatenation - forget it, it was a joke :) Linq 2 XML - complete control but quite a lot of hand written code, would need good suite of unit tests View engines in ASP.NET MVC (or even Web Forms theoretically), the logic being in controllers. It's a question how to structure it, I can have simple rules engine in my controller(s) and one view template per each possible output, or have the decision logic directly in the template. Both have upsides and downsides. XML Serialization - I'm not sure about the flexibility here Data Contracts from WCF - not sure about the flexibility either, plus would they work in a simple ASP.NET MVC app (non-WCF service)? Are they a super-set of the standard XML serialization now? If it exists, some XML-to-object mapper. The more I think about it the more I think I'm looking for something like this but I couldn't find anything appropriate. Any comments / other options?

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Create a timer countdown using hours, minutes & seconds from a future date

    - by Tommy Coffee
    I am using some code I found on the internet that creates a countdown from a certain date. I am trying to edit the code so that it only gives me a countdown from an hour, minute, and second that I specify from a future date. I cannot just have code that counts down from a specified time, I need it to countdown to a specified date in the future. This is important so that if the browser is refreshed the countdown doesn't start over but continues where left off. I will be using cookies so the browser remembers what future date was specified when it was first run. Here is the HTML: <form name="count"> <input type="text" size="69" name="count2"> </form> And here is the javascript: window.onload = function() { //change the text below to reflect your own, var montharray=new Array("Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec") function countdown(yr,m,d){ var theyear=yr; var themonth=m; var theday=d var today=new Date() var todayy=today.getYear() if (todayy < 1000) todayy+=1900; var todaym=today.getMonth() var todayd=today.getDate() var todayh=today.getHours() var todaymin=today.getMinutes() var todaysec=today.getSeconds() var todaystring=montharray[todaym]+" "+todayd+", "+todayy+" "+todayh+":"+todaymin+":"+todaysec futurestring=montharray[m-1]+" "+d+", "+yr var dd=Date.parse(futurestring)-Date.parse(todaystring) var dday=Math.floor(dd/(60*60*1000*24)*1) var dhour=Math.floor((dd%(60*60*1000*24))/(60*60*1000)*1) var dmin=Math.floor(((dd%(60*60*1000*24))%(60*60*1000))/(60*1000)*1) var dsec=Math.floor((((dd%(60*60*1000*24))%(60*60*1000))%(60*1000))/1000*1) if(dday==0&&dhour==0&&dmin==0&&dsec==1){ document.forms.count.count2.value=current return } else document.forms.count.count2.value= dhour+":"+dmin+":"+dsec; setTimeout(function() {countdown(theyear,themonth,theday)},1000) } //enter the count down date using the format year/month/day countdown(2012,12,25) } I am sure there is superfluous code above since I only need an hour, minute, and second that I would like to pass to the countdown() function. The year, month and day is unimportant but as I said this is code I am trying to edit which I found on the internet. Any help would be very appreciated. Thank you!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Converting a list into a select with jquery

    - by Davemof
    I'm trying to convert the following list into a select list so it can be submitted via a form - the element within the lists will become the value of each option: <ul class="selected connected-list ui-sortable" style="height: 279px;"> <li class="ui-helper-hidden-accessible" style=""></li> <li title="Owner Name 1 - " class="ui-state-default ui-element ui-draggable" style="display: block; position: relative; top: 0px; left: 0px;"><span class="ui-icon-arrowthick-2-n-s ui-icon"></span>Owner Name 1 - <em class="thenumber">4.4796E+11</em><a class="action" href="#"><span class="ui-corner-all ui-icon ui-icon-minus"></span></a></li> <li title="David Moffat - " class="ui-state-default ui-element" style="display: block; position: relative; top: 0px; left: 0px;"><span class="ui-icon ui-icon-arrowthick-2-n-s"></span>David Moffat - <em class="thenumber">07730423005</em><a class="action" href="#"><span class="ui-corner-all ui-icon ui-icon-minus"></span></a></li> </ul> This should convert to the following format: <select style="display:none" class="selectoption" name="p_num[]" multiple="multiple"> <option value="">4.4796E+11</option> <option value="">07730423007</option> </select> I have tried the following jquery code, but after many hours I'm pulling my hair out: $('a.sendform').click(function(){ $('ul.selected').each(function() { var $select = $('<select />'); $(this).find('li').each(function() { var $option = $('<option />'); $option.attr('value', $(this).('em')).html($(this).html()); $select.append($option); }); $(this).replaceWith($select); }); }); Any help might save my remaining hair. Many thanks David

    Read the article

  • Problem in suspending 2 threads at the same time in MFC!

    - by kiddo
    I am learning about threading and multithreading..so i just created a small application in which i will update the progressbar and a static text using threading.I vl get two inputs from the user, start and end values for how long the loop should rotate.I have 2threads in my application. Thread1- to update the progressbar(according to the loop) the static text which will show the count(loop count). Thread2 - to update the another static text which will just diplay a name Basically if the user clicks start, the progressbar steps up and at the same time filecount and the name are displayed parallely. There's is another operation where if the user clicks pause it(thread) has to suspend until the user clicks resume. The problem is,the above will not work(will not suspend and resume) for both thread..but works for a singlw thread. Please check the code to get an idea and reply me what can done! on button click start void CThreadingEx3Dlg::OnBnClickedStart() { m_ProgressBar.SetRange(start,end); myThread1 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction1,this); myThread2 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction2,this); } thread1 UINT MyThreadFunction1(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int intvalue =pthis->start;intvalue<=pthis->end; ++intvalue) { pthis->SendMessage(WM_MY_THREAD_MESSAGE1,intvalue); } return 0; } thread1 function LRESULT CThreadingEx3Dlg::OnThreadMessage1(WPARAM wparam,LPARAM lparam) { int nProgress= (int)wparam; m_ProgressBar.SetPos(nProgress); CString strStatus; strStatus.Format(L"Thread1:Processing item: %d", nProgress); m_Static.SetWindowText(strStatus); Sleep(100); return 0; } thread2 UINT MyThreadFunction2(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int i =pthis->start;i<=pthis->end;i++) { pthis->SendMessage(WM_MY_THREAD_MESSAGE2,i); } return 0; } thread2 function LRESULT CThreadingEx3Dlg::OnThreadMessage2(WPARAM wparam,LPARAM lparam) { m_Static1.GetDlgItem(IDC_STATIC6); m_Static1.SetWindowTextW(L"Thread2 Running"); Sleep(100); m_Static1.SetWindowTextW(L""); Sleep(100); return TRUE; } void CThreadingEx3Dlg::OnBnClickedPause() { // TODO: Add your control notification handler code here if(!m_Track) { m_Track = TRUE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Resume"); myThread1->SuspendThread(); WaitForSingleObject(myThread1->m_hThread,INFINITE); myThread2->SuspendThread(); m_Static.SetWindowTextW(L"Paused.."); } else { m_Track = FALSE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Pause"); myThread1->ResumeThread(); myThread2->ResumeThread(); /*myEventHandler.SetEvent(); WaitForSingleObject(myThread1->m_hThread,INFINITE);*/ } }

    Read the article

  • .NET Extension Objects with XSLT -- how to iterate over a collection?

    - by Pandincus
    Help me, Stackoverflow! I have a simple .NET 3.5 console app that reads some data and sends emails. I'm representing the email format in an XSLT stylesheet so that we can easily change the wording of the email without needing to recompile the app. We're using Extension Objects to pass data to the XSLT when we apply the transformation: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" xmlns:EmailNotification="ext:EmailNotification"> -- this way, we can have statements like: <p> Dear <xsl:value-of select="EmailNotification:get_FullName()" />: </p> The above works fine. I pass the object via code like this (some irrelevant code omitted for brevity): // purely an example structure public struct EmailNotification { public string FullName { get; set; } } // Somewhere in some method ... var notification = new Notification("John Smith"); // ... XsltArgumentList xslArgs = new XsltArgumentList(); xslArgs.AddExtensionObject("ext:EmailNotification", notification); // ... // The part where it breaks! (This is where we do the transformation) xslt.Transform(fakeXMLDocument.CreateNavigator(), xslArgs, XmlWriter.Create(transformedXMLString)); So, all of the above code works. However, I wanted to get a little fancy (always my downfall) and pass a collection, so that I could do something like this: <p>The following accounts need to be verified:</p> <xsl:for-each select="EmailNotification:get_SomeCollection()"> <ul> <li> <xsl:value-of select="@SomeAttribute" /> </li> </ul> <xsl:for-each> When I pass the collection in the extension object and attempt to transform, I get the following error: "Extension function parameters or return values which have Clr type 'String[]' are not supported." or List, or IEnumerable, or whatever I try to pass in. So, my questions are: How can I pass in a collection to my XSLT? What do I put for the xsl:value-of select="" inside the xsl:for-each ? Is what I am trying to do impossible?

    Read the article

< Previous Page | 507 508 509 510 511 512 513 514 515 516 517 518  | Next Page >