Search Results

Search found 42545 results on 1702 pages for 'confirm alert on browser close event'.

Page 512/1702 | < Previous Page | 508 509 510 511 512 513 514 515 516 517 518 519  | Next Page >

  • .net activeX object

    - by Ali YILDIRIM
    Hi, I am trying to use my .net image editor user control as an activeX object in a web form. After internet search, I created a asp.net web site from VS2008 and added the following code <object classid="res/ImageEditor.dll#ImageEditor.Editor" height="400" width="400" id="myControl1" name="myControl1" > </object> <INPUT id="Button1" type="button" value="Btn" name="Btn" onclick="return Button1_onclick()"> </script> <script language=javascript> function Button1_onclick() { alert(document.getElementById("myControl1").WatermarkText); } </script> I have two problems 1-) When i first create the project i see the user control on browser but, after rebuilding the user control and changing the dll file at web site, the object no more appears on browser. Instead i see something like an error image. 2-) i can not access public properties. The user control is marked as "make com visible", and register for com is checked at properties.

    Read the article

  • java httpclient post

    - by Eric V
    Hi, I have a question about how to allow my jsp page to issue a post command to the server, and still have the browser fallow the re direction of the posted page. Here are the code snipets: code that does the post (this is inside a jsp file): HttpClient client = new DefaultHttpClient(); client.getParams().setParameter("SUBMITTED", "submitted"); client.getParams().setParameter("xxxxxxxx", purchaser.getemail()); client.getParams().setParameter("xxxxxxxx", purchaser.getsuject()); HttpPost method = new HttpPost(url+"process.jsp"); client.execute(method); here is a snipet of process.jsp if (person.getStatus() == person.ACTIVE) response.sendRedirect("Account.jsp); else if (person.getStatus() == person.ERROR) response.sendRedirect("Error.jsp); I would like the browser to the fallow/goto the redirect from the process.jsp. Does anyone know a tutorial that would help me or Am I going about this the wrong way. Thanks, eric

    Read the article

  • How to get span tag inside a div in jQuery and assign a text?

    - by bala3569
    I use the following , <div id='message' style="display: none;"> <span></span> <a href="#" class="close-notify">X</a> </div> Now i want to find the span inside the div and assign a text to it... function Errormessage(txt) { $("#message").fadeIn("slow"); // find the span inside the div and assign a text $("#message a.close-notify").click(function() { $("#message").fadeOut("slow"); }); }

    Read the article

  • Custom Installer class , rollback method never called.

    - by yossi1981
    Hi guys. I am having an installer class , Here is a snippet: [RunInstaller(true)] public partial class ServerWrapInstaller : Installer { public override void Install(IDictionary stateSaver) { EventLog.WriteEntry("Installer", "Install", EventLogEntryType.Information); base.Install(stateSaver); } public override void Commit(IDictionary savedState) { EventLog.WriteEntry("Installer", "Commit", EventLogEntryType.Information); base.Commit(savedState); } public override void Rollback(IDictionary savedState) { EventLog.WriteEntry("Installer", "Rollback", EventLogEntryType.Information); base.Rollback(savedState); } public override void Uninstall(IDictionary savedState) { EventLog.WriteEntry("Installer", "UnInstall", EventLogEntryType.Information); base.Uninstall(savedState); } } Now i start the installation in full GUI mode and then click the "Cancel" button in the middle of the process causing the installation to roll back. The problem is that the RollBack method is not called. I don't see the expected entry in the event log. I want to mention that if i let the installation to complete , I do see the "Install" message in the event log and If i then uninstall , I see the "uninstall" message in the event log. But if stop the installtion process in the middle , by pressing the "cancel" button , I do see the progress bar going backward , but the rollback method is not called. what am I doing wrong ? thanks in advance for any help. Edit: Providing more details... The installer is an MSI package. The package is built in vs2009 using a setup project. The installer class is used as a custom action by the setup project. Since this is a MSI Package I have an option to run it in silent mode or in user-interactive more . When I wrote "Full GUI mode" , I ment User-Interactive mode.

    Read the article

  • Java Swingworker: Not as encapsulated class

    - by Thomas Matthews
    I'm having problems passing information, updating progress and indicating "done" with a SwingWorker class that is not an encapsulated class. I have a simple class that processes files and directories on a hard drive. The user clicks on the Start button and that launches an instance of the SwingWorker. I would like to print the names of the files that are processed on the JTextArea in the Event Driven Thread from the SwingWorker as update a progress bar. All the examples on the web are for an nested class, and the nested class accesses variables in the outer class (such as the done method). I would also like to signal the Event Driven Thread that the SwingWorker is finished so the EDT can perform actions such as enabling the Start button (and clearing fields). Here are my questions: 1. How does the SwingWorker class put text into the JTextArea of the Event Driven Thread and update a progress bar? How does the EDT determine when the {external} SwingWorker thread is finished? {I don't want the SwingWorker as a nested class because there is a lot of code (and processing) done.}

    Read the article

  • Why does a ModalPopupExtender fail when using SSL?

    - by Brooke Jackson
    I have created a modal popup using the ModalPopupExtender in Microsoft's AJAX 1.0 for .NET 2.0. It works great when the page doesn't isn't being accessed through SSL (http://) however the link to close the popup fails to fire if accessing the page through https://. Is the ModalPopupExtender at blame? Is it a "Feature" of SSL to block popups, or is it something else I haven't though of? Here is the code I am using: <asp:Button ID="btnHelp" runat="server" Text="?" CausesValidation="False" /> <asp:Panel ID="pnlHelp" BackColor="white" runat="server"> <asp:LinkButton ID="lnkClosePanel" runat="server" CausesValidation="False" OnClick="lnkCloseHelp_Click">Close</asp:LinkButton> <p>Some Text</p> </asp:Panel> <cc1:ModalPopupExtender ID="popExt" runat="server" TargetControlID="btnHelp" PopupControlID="pnlHelp"></cc1:ModalPopupExtender>

    Read the article

  • Hide header and footer when printing from Internet Explorer using Javascript or CSS

    - by molasses
    When I print a webpage from Internet Explorer it will automatically add a header and footer including the website title, URL, date, and page number. Is it possible to hide the header and footer programatically using Javascript or CSS? Requirements: works in IE 6 (no other browser support necessary as its for an Intranet) may use ActiveX, Java Applet, Javascript, CSS preferably not something that the user needs to install (eg. http://www.meadroid.com/scriptx). feel free to list other third party available plug-ins though as I think this may be the only option don't require the user to manually update their browser settings don't render the pages as PDF or Word document or any other format don't write to the registry (security prevents this) Thanks

    Read the article

  • WPF Update Binding when Bound directly to DataContext w/ Converter

    - by Adam
    Normally when you want a databound control to 'update,' you use the "PropertyChanged" event to signal to the interface that the data has changed behind the scenes. For instance, you could have a textblock that is bound to the datacontext with a property "DisplayText" <TextBlock Text="{Binding Path=DisplayText}"/> From here, if the DataContext raises the PropertyChanged event with PropertyName "DisplayText," then this textblock's text should update (assuming you didn't change the Mode of the binding). However, I have a more complicated binding that uses many properties off of the datacontext to determine the final look and feel of the control. To accomplish this, I bind directly to the datacontext and use a converter. In this case I am working with an image source. <Image Source="{Binding Converter={StaticResource ImageConverter}}"/> As you can see, I use a {Binding} with no path to bind directly to the datacontext, and I use an ImageConverter to select the image I'm looking for. But now I have no way (that I know of) to tell that binding to update. I tried raising the propertychanged event with "." as the propertyname, which did not work. Is this possible? Do I have to wrap up the converting logic into a property that the binding can attach to, or is there a way to tell the binding to refresh (without explicitly refreshing the binding)? Any help would be greatly appreciated. Thanks! -Adam

    Read the article

  • How to best handle exception to repeating calendar events

    - by blcArmadillo
    I'm working on a project that will require me to implement a calendar. I'm trying to come up with a system that is very flexible: can handle repeating events, exceptions to repeats, etc. I've looked at the schema for applications like iCal, Lotus Notes, and Mozilla to get an idea of how to go about implementing such a system. Currently I'm having trouble deciding what is the best way to handle exceptions to repeating events. I've used databases quite a bit but don't have a ton of experience with really optimizing everything so I'm not sure which method of the two I'm considering would be optimal in terms of overall performance and ability to query/search: Breaking the repeating event. So taking the changing the ending date on the current row for the repeating event, inserting a new row with the exception, and adding another row continuing the old sequence. Simply adding an exception. So adding a new row with some field that indicates it as an override. So here is why I can't decide. Method one will result in a lot more rows since each edit requires 2 extra rows as apposed to only one row by the second method. On the other hand I think the query to find an event would be much simper, and thus possibly faster(?) using the first method. The second method seems like it will require more calculating on the application server since once you get the data you'll have to remove the intersection of the two rows. I know databases are often the bottleneck for websites and while I'm sure a lot of you are thinking either is fine because your project will probably never get large enough for the difference in efficiency to really matter, I'd still like to implement the best solution. So what method would you guys pick, or would you do something completely different? Also, as a side note I'll be using MySQL and PHP. If there is another technology that you think would be better suited for this, especially in the database area, please mention it. Thanks for the advice.

    Read the article

  • jQuery DatePicker - 'fake' click on page load

    - by Danny
    Hey! I've got a quick question about the jQuery UI DatePicker. When I load the page, defaultDate: 0 will work fine with selecting the current day's date. I would like to create a 'fake' click on the date so it will execute my JavaScript function and retrieve information from the database. I tried calling the function when the page loads but that doesn't work. $(document).ready(function(){ $("#datepicker").datepicker({ gotoCurrent: false, onSelect: function(date, inst) { ajaxFunction(date); }, dateFormat: 'dd-mm-yy', defaultDate: 0, changeMonth: true, changeYear: true }); }); //Browser Support Code function ajaxFunction(date){ var ajaxRequest; // The variable that makes Ajax possible! try{ // Opera 8.0+, Firefox, Safari ajaxRequest = new XMLHttpRequest(); } catch (e){ // Internet Explorer Browsers try{ ajaxRequest = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try{ ajaxRequest = new ActiveXObject("Microsoft.XMLHTTP"); } catch (e){ // Something went wrong alert("Your browser broke!"); return false; } } } // Create a function that will receive data sent from the server ajaxRequest.onreadystatechange = function(){ if(ajaxRequest.readyState == 4){ var ajaxDisplay = document.getElementById('ajaxDiv'); ajaxDisplay.innerHTML = ajaxRequest.responseText; } } var queryString = "?date=" + date; ajaxRequest.open("GET", "getDiary.php" + queryString, true); ajaxRequest.send(null); } function ajaxAdd(){ var ajaxRequest; // The variable that makes Ajax possible! try{ // Opera 8.0+, Firefox, Safari ajaxRequest = new XMLHttpRequest(); } catch (e){ // Internet Explorer Browsers try{ ajaxRequest = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try{ ajaxRequest = new ActiveXObject("Microsoft.XMLHTTP"); } catch (e){ // Something went wrong alert("Your browser broke!"); return false; } } } var day1 = $("#datepicker").datepicker('getDate').getDate(); var day2 = (day1 < 10) ? '0' + day1 : day1; var month1 = $("#datepicker").datepicker('getDate').getMonth() + 1; var month2 = (month1 < 10) ? '0' + month1 : month1; var year1 = $("#datepicker").datepicker('getDate').getFullYear(); var year2 = (year1 < 1000) ? year1 + 1900 : year1; var fullDate = day2 + "-" + month2 + "-" + year2; var queryString = "?breakfast=" + diary1.breakfast.value; queryString = queryString + "&lunch=" + diary1.lunch.value; queryString = queryString + "&dinner=" + diary1.dinner.value; queryString = queryString + "&date=" + fullDate; ajaxRequest.open("GET", "addDiary.php" + queryString, true); ajaxRequest.send(null); alert("Added value to database!"); diary1.breakfast.value = ""; diary1.lunch.value = ""; diary1.dinner.value = ""; ajaxFunction(fullDate); } I have pasted my DatePicker class, and the two functions that are used (one to retrieve information from the database, and one to store). Basically I want to mirror the onSelect: function on the DatePicker, but when the page first loads. Thanks!

    Read the article

  • Ignore whitespace in HTML

    - by IP
    Is there anything in HTML/CSS that tells the browser to ignore whitespace completely? So many times when you want to put, say, two images next to each other - you try desperately to keep the HTML readable, but the browser puts a space between them. So instead of something like this: <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> <imc src="images/minithing.jpg" alt="my mini thing" /> you end up with this <imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /><imc src="images/minithing.jpg" alt="my mini thing" /> Which is just so horrible!

    Read the article

  • Get variables in c# from ajax call

    - by fzshah76
    I've got an Ajax call for log in here is the code: //if MOUSE class is clicked $('.mouse').click(function () { //get the form to submit and return a message //how to call the function var name = $('#name').val(); var pwd2 = $('#pwd2').val(); $.ajax({ type:"POST", url: "http://localhost:51870/code/Login.aspx", data: "{ 'name':'" + $('#name').val() + "', 'pwd':'" + $('#pwd2').val() + "' }", contentType: "application/json; charset=utf-8", dataType: "json", context: document.body, success: function () { //$(this).addClass("done"); $(this).hide(); $('.mouse, .window').hide(); } }); }); the problem is I can't seem to catch name and pwd variables in Login page's preinit event or page load event here is the code in c#: protected void Page_PreInit(object sender, EventArgs e) { //taking javascript argument in preinit event //from here I'll have to build the page for specific lookbook var name = Request.QueryString["name"]; var pwd = Request.QueryString["pwd"]; } protected void Page_Load(object sender, EventArgs e) { var name = Request.QueryString["name"]; var pwd = Request.QueryString["pwd"]; SignIn(name); } I can't seem to get username name and password in c# side, help is appreciated. Here is my final javascript code c# code remains the same: <script type="text/javascript"> $(document).ready(function () { //if MOUSE class is clicked $('.mouse').click(function () { var name = $('#name').val(); var pwd = $('#pwd').val(); $.ajax({ url: "http://localhost:51870/code/Login.aspx?name="+ name +"&pwd="+pwd, context: document.body, success: function () { //$(this).addClass("done"); $(this).hide(); $('.mouse, .window').hide(); } }); }); }); </script> Thanks Zachary

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Persist subclass as superclass using Hibernate

    - by franziga
    I have a subclass and a superclass. However, only the fields of the superclass are needed to be persist. session.saveOrUpdate((Superclass) subclass); If I do the above, I will get the following exception. org.hibernate.MappingException: Unknown entity: test.Superclass at org.hibernate.impl.SessionFactoryImpl.getEntityPersister(SessionFactoryImpl.java:628) at org.hibernate.impl.SessionImpl.getEntityPersister(SessionImpl.java:1366) at org.hibernate.engine.ForeignKeys.isTransient(ForeignKeys.java:203) at org.hibernate.event.def.AbstractSaveEventListener.getEntityState(AbstractSaveEventListener.java:535) at org.hibernate.event.def.DefaultSaveOrUpdateEventListener.performSaveOrUpdate(DefaultSaveOrUpdateEventListener.java:103) at org.hibernate.event.def.DefaultSaveOrUpdateEventListener.onSaveOrUpdate(DefaultSaveOrUpdateEventListener.java:93) at org.hibernate.impl.SessionImpl.fireSaveOrUpdate(SessionImpl.java:535) at org.hibernate.impl.SessionImpl.saveOrUpdate(SessionImpl.java:527) at org.hibernate.impl.SessionImpl.saveOrUpdate(SessionImpl.java:523) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.hibernate.context.ThreadLocalSessionContext$TransactionProtectionWrapper.invoke(ThreadLocalSessionContext.java:342) at $Proxy54.saveOrUpdate(Unknown Source) How can I persist a subclass as a superclass? I do not prefer creating a superclass instance and then passing the values from the subclass instance. Because, it is easy to forget updating the logic if extra fields are added to superclass in the future.

    Read the article

  • iPhone UIWebView local resources using Javascript and handling onorientationChange

    - by Dougnukem
    I'm trying to server HTML Javascript and CSS content from an iPhone application's local resources, and I'm having trouble handling onOrientationChange events and including external Javascript. I seem to be able to link in CSS properly but not javascript. I'm trying to use the following example of handling onOrientationChange (How to build an iPhone website) but I'm serving the webpage from my app's NSBundle mainBundle. I tried attaching a javascript function to body.onorientationchange and to window.onorientationchange but neither work when served from UIWebView locally (or remotely), but it works if I'm using the iPhone Safari. <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>How to build an iPhone website</title> <meta name="author" content="will" /> <meta name="copyright" content="copyright 2008 www.engageinteractive.co.uk" /> <meta name="description" content="Welcome to engege interactive on the iPhone!" /> <meta name="viewport" content="width=device-width; initial-scale=1.0; maximum-scale=1.0;"> <link rel="apple-touch-icon" href="images/template/engage.png"/> <style type="text/css"> @import url("iphone.css"); </style> <!-- <script type="text/javascript" src="orientation.js"></script> --> <script type="text/javascript"> function updateOrientation(){ try { var contentType = "show_normal"; switch(window.orientation){ case 0: contentType = "show_normal"; break; case -90: contentType = "show_right"; break; case 90: contentType = "show_left"; break; case 180: contentType = "show_flipped"; break; } document.getElementById("page_wrapper").setAttribute("class", contentType); //alert('ORIENTATION: ' + contentType); } catch(e) { alert('ERROR:' + e.message); } } window.onload = function initialLoad(){ try { loaded(); updateOrientation(); } catch(e) { alert('ERROR:' + e.message); } } function loaded() { document.getElementById("page_wrapper").style.visibility = "visible"; } </script> </head> <body onorientationchange="updateOrientation();"> <div id="page_wrapper"> <h1>Engage Interactive</h1> <div id="content_left"> <p>You are now holding your phone to the left</p> </div> <div id="content_right"> <p>You are now holding your phone to the right</p> </div> <div id="content_normal"> <p>You are now holding your phone upright</p> </div> <div id="content_flipped"> <p>This doesn't work yet, but there is a chance apple will enable it at some point, so I've put it in anyway. You would be holding your phone upside down if it did work.</p> </div> </div> </body> </html>

    Read the article

  • AutoCompleteTextView displays 'android.database.sqlite.SQLiteCursor@'... after making selection

    - by user244190
    I am using the following code to set the adapter (SimpleCursorAdapter) for an AutoCompleteTextView mComment = (AutoCompleteTextView) findViewById(R.id.comment); Cursor cComments = myAdapter.getDistinctComments(); scaComments = new SimpleCursorAdapter(this,R.layout.auto_complete_item,cComments,new String[] {DBAdapter.KEY_LOG_COMMENT},new int[]{R.id.text1}); mComment.setAdapter(scaComments); auto_complete_item.xml <?xml version="1.0" encoding="utf-8"?> <TextView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/text1" android:layout_width="wrap_content" android:layout_height="wrap_content"/> and thi is the xml for the actual control <AutoCompleteTextView android:id="@+id/comment" android:hint="@string/COMMENT" android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="18dp"/> The dropdown appears to work correctly, and shows a list of items. When I make a selection from the list I get a sqlite object ('android.database.sqlite.SQLiteCursor@'... ) in the textview. Anyone know what would cause this, or how to resolve this? thanks Ok I am able to hook into the OnItemClick event, but the TextView.setText() portion of the AutoCompleteTextView widget is updated after this point. The OnItemSelected() event never gets fired, and the onNothingSelected() event gets fired when the dropdown items are first displayed. mComment.setOnItemClickListener( new OnItemClickListener() { @Override public void onItemClick(AdapterView<?> arg0, View arg1, int arg2, long arg3) { // TODO Auto-generated method stub SimpleCursorAdapter sca = (SimpleCursorAdapter) arg0.getAdapter(); String str = getSpinnerSelectedValue(sca,arg2,"comment"); TextView txt = (TextView) arg1; txt.setText(str); Toast.makeText(ctx, "onItemClick", Toast.LENGTH_SHORT).show(); } }); mComment.setOnItemSelectedListener(new OnItemSelectedListener() { @Override public void onItemSelected(AdapterView<?> arg0, View arg1, int arg2, long arg3) { Toast.makeText(ctx, "onItemSelected", Toast.LENGTH_SHORT).show(); } @Override public void onNothingSelected(AdapterView<?> arg0) { // TODO Auto-generated method stub Toast.makeText(ctx, "onNothingSelected", Toast.LENGTH_SHORT).show(); } }); Anyone alse have any ideas on how to override the updating of the TextView? thanks patrick

    Read the article

  • HISTCONTROL=ignoreboth not working Debian Lenny

    - by Mike
    Can anybody confirm if by setting the the following environmental variables under debian lenny will make previous history entries not to be saved. GNU bash, version 3.2.39(1)-release export HISTCONTROL=ignoreboth export HISTSIZE=500 I have added them to my /etc/bash.bashrc but I keep getting repeated commands. Thanks

    Read the article

  • gdb+osx: no output when using printf/CFShow

    - by yairchu
    I attached to a program with gdb in OSX and I want to use CFShow in the gdb console etc. However, nothing shows up. printf shows nothing as well: (gdb) call (int) printf("Hello\n") $10 = 6 (gdb) call (int) printf("Hello World!\n") $11 = 13 Apple suggests the following tip for when attaching with gdb, to make the output appear in the gdb console: (gdb) call (void) close(1) (gdb) call (void) close(2) (gdb) shell tty /dev/ttyp1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $1 = 1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $2 = 2 In xcode's gdb console tty gives "not a tty", so I tried it in gdb in a terminal. There tty does work but after redirecting stdout there's still no output. Also no output if I direct stdout to a file.. :/ Any salvation?

    Read the article

  • Hibernate "JOIN ... ON"?

    - by CaptainAwesomePants
    I have an application that uses Hibernate for its domain objects. One part of the app is common between a few apps, and it has no knowledge of the other systems. In order to handle relations, our class looks like this: @Entity public class SystemEvent { @Id @GeneratedValue public int entity_id; @Column(name="event_type") public String eventType; @Column(name="related_id") public int relatedObjectId; } relatedObjectId holds a foreign key to one of several different objects, depending on the type of event. When a system wants to know about events that are relevant to its interests, it grabs all the system events with eventType "NewAccounts" or some such thing, and it knows that all of those relatedObjectIds are IDs to a "User" object or similar. Unfortunately, this has caused a problem down the line. I can't figure out a way to tell Hibernate about this mapping, which means that HQL queries can't do joins. I'd really like to create an HQL query that looks like this: SELECT users FROM SystemEvent event join Users newUsers where event.eventType = 'SignUp' However, Hibernate has no knowledge of the relationship between SystemEvent and Users, and as far as I can tell, there's no way to tell it. So here's my question: Is there any way to tell Hibernate about a relationship when your domain objects reference each other via ID numbers and not class references?

    Read the article

  • html widget communicating with server

    - by Nikita Rybak
    I'm making html widget for websites. Let's say, it will display current stock indexes. In short, arbitrary website owner takes code snippet from me and includes it on his webpage http://website.com/index.html. When arbitrary user opens http://website.com/index.html, my code sends request to my server (provider.com), which performs necessary operations and returns information to user's browser. When response has arrived, user will see relevant stock value on http://website.com/index.html. In index.html service could be called like this <script type="text/javascript" src="provider.com/service.js"> </script> <div id="target_area"></div> <script type="text/javascript"> service.show("target_area", options); </script> Now, the problem is in the same origin policy: I can't just send ajax request from website.com to provided.com and return html to embed in client's webpage. I see several solutions, which I list below, but none quite satisfy me. I wonder, if you could suggest something, especially if you had some relevant experience. 1) iframe, plain and simple. Disadvantage: must have fixed dimensions + stupid scroll bars appearing in some browsers. Can be fixed with javascript, but all this browser-specific tinkering doesn't sound good to me. 2) JSONP. Problem: can't return whole chunk of html, must return only data. Then, on browser side, I'll have to use javascript to embed data into html snippet placed statically in index.html. Doesn't sound nice, because data format is not very simple and may even change later. 3) Use hidden iframe to do ajax requests. A bit tricky, but sounds like a way to go. Well, that's my thoughts on the subject. Are there any better ways? BTW, I tried to check some existing widgets too, but didn't find much useful information. All domain names used in this text are fictional and any resemblance is purely coincidental :)

    Read the article

  • ASP.NET website not working properly in mobile

    - by ria
    I have created a simple app with a page having a server side form, three fields and a button that submits and performs two operations - 1) adds the form fields to the database table 2) sends an email. Now everything works fine on the web browser on my machine but when I access the app through my mobile, the page does not seem to work. the UI and all are set but the button click functionality doesnt seem to be working and also the label which is set after a successful submit is already visible and showing the "thank you" message. Am i doing something wrong here? I have checked the app on Nokia Smartphone browser, android phone, and iphone simulator.

    Read the article

  • Prevent Jquery Accordion tab from expanding

    - by Edwin
    I'm trying to use JQuery UI Accordion as a menu, but I can't figure out how to prevent some tabs from expanding. My JS: $("#sidebar").accordion({ collapsible: true, changestart: function(event, ui) { switch ($(ui.newHeader).attr("id")) { case "sidebar_grades": return false; break; } } }); the HTML: <div id="sidebar"> <h3 id="sidebar_home"> <a href="/blah">Home</a> </h3> <div> <a href="/child">Settings</a> </div> <h3 id="sidebar_grades"> <a href="/grades">Grades</a> </h3> <div></div> <h3 id="sidebar_calendar"> <a href="/calendar">Calendar</a> </h3> <div></div> </div> In the above example, since #sidebar_grades doesn't have any child, it should not be expandable, but user can click on the link. I tried using "changestart" event and return false when #sidebar_grades is clicked, but it doesn't work. I also tried attaching onClick event to #sidebar_grades to return false, but that didn't work either. Any idea how to do this? Thank you!

    Read the article

  • PhantomJS not exactly rendering HTML to PNG

    - by John Leonard
    I'm having trouble adjusting PhantomJS to create a PNG file that matches the original browser presentation. Here is the entire sample html file. It's a sankey diagram creating using rCharts and d3-sankey. (You'll need to save the file to your hard drive and view it from there.) I'm running on Windows and using rasterize.js: >> phantomjs.exe rasterize.js test.html test.png ISSUE: Below is a snip of one of the text strings when viewed in a browser: And here is a snip of the same string from the PNG created by PhantomJS: How do I make the text-shadow go away? I've played around with various CSS attributes (text-shadow) and webkit-specific attributes (e.g., -webkit-text-rendering), but can't seem to make it go away. Is this a setting in PhantomJS? in the underlying webkit? or somewhere else? Many thanks!

    Read the article

  • Javascript/CSS rollover menus are patented and subject to licensing?

    - by Scott B
    Very interesting finding that a client brought to my attention today regarding javascript style rollover menus. They got a call from their legal dept that they need to change the manner in which their rollover menu is activated (at the risk of having to pay license to continue using the navigation technique). Its no April fools joke, apparently this is really happening. Apparently a company named Webvention LLC has obtained enforcement rights to a patent, U.S. Patent No. 5,251,294 - "Accessing, assembling, and using bodies of Information." A menu link, that when rolled over, expands to show a list of categorized, related links. Dropdown menus and slide-out menus are examples of this patented navigational methodology. A key component of this patent is that the dropdown/slide-out action must be initiated by a rollover or mouseover event. If the dropdown/slide-out action is initiated by any other event, such as a mouse-click event, then this behavior is not in violation of the patent. Anyone ever heard of this or know of the validity of its claims? Website is here: http://www.webventionllc.com/

    Read the article

< Previous Page | 508 509 510 511 512 513 514 515 516 517 518 519  | Next Page >