Search Results

Search found 18598 results on 744 pages for 'result'.

Page 518/744 | < Previous Page | 514 515 516 517 518 519 520 521 522 523 524 525  | Next Page >

• Randomly choose value between 1 and 10 with equal number of instances

  - by user1723765

  I would like to generate 2000 random numbers between 1 and 10 such that for each random number I have the same number of instances. In this case 200 for each number. What should be random is the order in which it is generated. I have the following problem: I have an array with 2000 entries but not each with unique values, for example it starts like this: 11112233333333344445667777777777 and consists of 2000 entries. I would like to generate random numbers and assign each UNIQUE value a separate random number but have an entry for each value So my intended result would look like this: original array: 11112233333333344445667777777777 random numbers: 33334466666666699991778888888888

  Read the article

• Same script, working on a site, not working on the other!

  - by Tioneb

  Hello, First of all I apologize in advance for this question, a bit off the rang of stackoverflow, but I've spend a day trying to solve that issue and I'm totally stuck. The issue: The search function of my script (php) works perfectly fine on one host but not on the other. If you search something here : edu-cafe.com, you'll get a result, just as it should be. However, try a search on this site, hosted somewhere else : code-reduc.com, exact same script, files and datable, and it just hang. I've asked both the host and the original programmer of the script to look at the issue but they can't seem to find an answer... Obviously the cause of my troubles comes from the Host, but I can't find the issue Any bit of help would be hugely appreciated! PS: part of the script here: http://codepaste.net/fuymqn Thanks!

  Read the article

• How can I get running totals of integer values from a SortedDictionary?

  - by user578083

  SortedDictionary<int, string> typeDictionary = new SortedDictionary<int, string>(); SortedDictionary<int, int> lengthDictionary = new SortedDictionary<int, int>(); lengthDictionary has values in key value pair as follows: <1,20> <2,8> <3,10> <4,5> i want LINQ query which will return me new list like as follows <1,20> <2,20+8=28> // 20 from key 1 <3,28+10=38> // 28 from key 2 <4,38+5=43> // 38 from key 3 Result should like this: <1,20> <2,28> <3,38> <4,43>

  Read the article

• sql query is too slow, how to improve speed

  - by user1289282

  I have run into a bottleneck when trying to update one of my tables. The player table has, among other things, id, skill, school, weight. What I am trying to do is: SELECT id, skill FROM player WHERE player.school = (current school of 4500) AND player.weight = (current weight of 14) to find the highest skill of all players returned from the query UPDATE player SET starter = 'TRUE' WHERE id = (highest skill) move to next weight and repeat when all weights have been completed move to next school and start over all schools completed, done I have this code implemented and it works, but I have approximately 4500 schools totaling 172000 players and the way I have it now, it would take probably a half hour or more to complete (did not wait it out), which is way too slow. How to speed this up? Short of reducing the scale of the system, I am willing to do anything that gets the intended result. Thanks! *the weights are the standard folk style wrestling weights ie, 103, 113, 120, 126, 132, 138, 145, 152, 160, 170, 182, 195, 220, 285 pounds

  Read the article

• fullscreen map not displayed correctly

  - by user1747168

  I want the map to be opened on full-screen. I've tried this: <div class="b-firm-map-content" id="map"></div> <a href="#" onclick="test2();return false;" >full screen</a> function test2(){ var width = $(window).width()-3; var height = $(window).height(); $('#map').css({ 'width': width, 'height': height - 40 , 'position': 'absolute ', 'z-index' : '900' }); } but it result in: http://pixs.ru/showimage/Snimokpng_5811285_6065704.png http://pixs.ru/showimage/Snimok1png_4265065_6065745.png My map not completely displayed.

  Read the article

• (Action<T>).Name does not return expected values

  - by Tomas Lycken

  I have the following method (used to generate friendly error messages in unit tests): protected string MethodName<TTestedType>(Action<TTestedType> call) { return string.Format("{0}.{1}", typeof(TTestedType).FullName, call.Method.Name); } But when I call it as follows, I don't get the expected results: var nm = MethodName<MyController>(ctrl => ctrl.Create()); After running this code, nm contains "<Create_CreateShowsView>b__8", and not (as expected) "Create". How should I change the code to obtain the expected result?

  Read the article

• Grails searchable plugin with hasMany

  - by user2624442

  I am using grails searchable plugin to search my domain classes. However, I cannot yet search by my hasMany (skills and interests) fields even though they are of the simple type String. This is my domain class: class EmpactUser { static searchable = [except: ['dateCreated','password','enabled','accountExpired','accountLocked','passwordExpired']] String username String password boolean enabled = true boolean accountExpired boolean accountLocked boolean passwordExpired String email String firstName String lastName String address String phoneNumber String description byte[] avatar byte[] resume Date dateCreated static hasMany = [ skills : String, interests : String, // each user has the ability to list many skills and interests so that they can be matched with a project. ] static constraints = { username blank: false, unique: true password blank: false email email: true, blank: false firstName blank: false lastName blank: false description nullable: true address nullable: true avatar nullable: true, maxSize: 1024 * 1024 * 10 resume nullable: true, maxSize: 1024 * 1024 * 10 phoneNumber nullable: true, matches: "/[(][+]d{3}[)]d+/", maxSize: 30 } } This is the code I am using to search: def empactUserList = EmpactUser.search( searchQuery, [reload: false, result: "every", defaultOperator: "or"]) Am I missing something? Thanks, Alan.

  Read the article

• Error about TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `<top (required)>'

  - by edi susanto

  hy guys . . im new at this . . sorry for the word that's not understandable and the easy question . . i'd like to ask about an error that shown below : TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `' i want to test the result by render json in soapUI. does anyone know what's the problem so that the error will show up like above ? thanks before.regards,edy

  Read the article

• Using calculated fields over and over again with a new table

  - by Sin5k4

  I'm fairly new to SQL and i had to do some calculations using a table.Imagine we have a table with fields : ID - Name - Val1 - Val2 ; Lets say i want to add up 2 values and add it to my query result.I can do that easily with a sub query such as: select val1+val2 as valtotal,* from my table. Now if i want to do some more process on valtotal, i use a derived table such as; select valtotal*3 as ValMoreCalculated,* from (select val1+val2 as valtotal,* from my table) AS A A bit more code maybe?? select ValMoreCalculated/valtotal as ValEvenMoreCalc ,* from (select valtotal*3 as ValMoreCalculated,* from (select val1+val2 as valtotal,* from my table) AS A)AS B So if i want to do more calculations with the ValMoreCalculated do i have to go through another derived table? Name it as B for example? Is there an easier way to achieve this in SQL? PS:the title is a bit off i know,but couldn't figure out what to name it :P

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Is the FoldLeft function available in R?

  - by JSmaga

  Hi, I would like to know if there is an implementation of the foldLeft function (and foldRight?) in R. The language is supposed to be "rather" functional oriented and hence I think there should be something like this, but I could not find it in the documentation. To me, foldLeft function applies on a list and has the following signature: foldLeft[B](z : B)(f : (B, A) => B) : B It is supposed to return the following result: f(... (f(f(z, a0), a1) ...), an) if the list is [a0, a1, ..., an]. (I use the definition of the Scala List API) Does anybody know if such a function exists in R?

  Read the article

• Capture variable assignments in a Perl eval

  - by Bruce

  I would like to be able to capture variable assignments from a Perl eval. That is, to determine what variable names have been assigned to within the code and extract their value. For example if I run: eval '$foo=42; $bar=3.14;' The result of the eval is 3.14 (the last value evaluated), but I would also like to be able to determine the names "$foo" and "$bar" and their values (without knowing the names in advance). I have read up on a couple of ways of inserting variables into the eval block, through Safe and Eval::Context, but not yet any way of extracting them. I am more familiar with Python's eval/exec which have built in support for this.

  Read the article

• Contents of a node in Nokogiri

  - by Styggentorsken

  Is there a way to select all the contents of a node in Nokogiri? <root> <element>this is <hi>the content</hi> of my æøå element</element> </root> The result of getting the content of /root/element should be this is <hi>the content</hi> of my æøå element Edit: It seems like the solution is simply to use myElement.inner_html(). The problem I had was in fact that I was relying on an old version of libxml2, which escaped all the special characters.

  Read the article

• is this code correct? [closed]

  - by davit-datuashvili

  hi i have poste this code from this title http://stackoverflow.com/questions/2896363/hi-i-have-question-here-is-pseudo-code-about-sift-up-and-sift-down-on-heaps i have following code of siftup on heap is it correct?i have put here because i have changed at old place my question and it became unreadable so i have posted here public class siftup{ public static void main(String[]args){ int p; int n=12; int a[]=new int[]{15,20,12,29,23,17,22,35,40,26,51,19}; int i=n-1; while (i!=0){ if (i==1) break; p=i/2; if (a[p]<=a[i]){ int t=a[p]; a[p]=a[i]; a[i]=t; } i=p; } for (int j=0;j<n;j++){ System.out.println(a[j]); } } } //result is this 15 20 19 29 23 12 22 35 40 26 51 17 is it correct?

  Read the article

• How do I search within svn logs

  - by user369311

  I want to be able to search within the commit logs of svn. I know you can do that on tortoise, but couldn't find a way using the command line. We are moving to a two-tiered repository approach, so that the stable branch will only get stories fully completed and tested. To achieve that, we would need a way to search within the commit messages for the story code (eg:#s1322) and get a list of the revisions to be used in a subsequent merge command. Ex: searchsvnapp http://[repo location root] #s1322 result: 4233,4249,4313

  Read the article

• Safe way of iterating over an array or dictionary and deleting entries?

  - by mystify

  I've heard that it is a bad idea to do something like this. But I am sure there is some rule of thumb which can help to get that right. When I iterate over an NSMutableDictionary or NSMutableArray often I need to get rid of entries. Typical case: You iterate over it, and compare the entry against something. Sometimes the result is "don't need anymore" and you have to remove it. But doing so affects the index of all the rows, doesn't it? So how could I safely iterate over it without accidently exceeding bounds or jumping over an element that hasn't been checked?

  Read the article

• Returning an array from an activity

  - by Boardy

  I am currently working on an android project and I want to be able to startActivityForResult so that I can return an array of. The array is an ArrayList<Spanned> lets say its called myArray. From what I've read I can't return an array directly from the activty using the set result so I was thinking that once the array has added all the data to the array, I can then call the toString function on it, i.e. myArray.toString(). If I do this, I have no idea how I can then convert this back into the original ArrayList<Spanned>. Thanks for any help you can provide.

  Read the article

• Displaying Data from a Join in Codeigniter

  - by Brad

  I am using a simple join to pull data from two databases. This is the join in the model function com_control(){ $this->db->select('*'); $this->db->from('comments'); $this->db->join('posts', 'comments.entry_id = posts.id'); $query = $this->db->get(); return $query->result; } My desired method of display is going to be in a table so I am starting out to use like this foreach($comm_control as $row){ $this->table->add_row( $row->entry_id, $row->comments.id, $row->comment, $row->title ); }//end of foreach My problem is the display of data from comments.id. What is the proper format to add the comment.id into the table rows? I need the ID from both tables for display, edit and delete further on in the table. The only display I get at this time for "comment.id" is the word id. The Any help would be appreciated.

  Read the article

• Do sfSubForm.fForm.RecordSource and Forms(fForm).RecordSource refer to the same object and property?

  - by Raymond Rosalind

  Hi, this has me pretty confused and I can't find the answer anywhere else so thought I'd post here to see if anyone can help! I have a form in an Access 2007 database with a subform (sfSubform) embedded in it. The subform control's SourceObject is set to be another form (fForm). fForm's RecordSource starts out as a table. At one point I want to change the data displayed in the subform to the result of a SQL statement, so I use sfSubform.Form.RecordSource = strSQL. This works fine. However, if I ouput the name of the RecordSource for fForm after making this change, it still gives the name of the table that I orginially set. Does sfSubform.Form.RecordSource not change the source of fForm? Is it a copy of fForm that is embedded in the control? Hope all that makes sense.

  Read the article

• How to group rows into two groups in sql?

  - by user1055638

  Lets say I have such a table: id|time|operation 1 2 read 2 5 write 3 3 read 4 7 read 5 2 save 6 1 open and now I would like to do two things: Divide all these records into two groups: 1) all rows where operation equals to "read" 2) all other rows. Sum the time in each group. So that my query would result only into two rows. What I got so far is: select sum(time) as total_time, operation group by operation ; Although that gives me many groups, depending on the number of distinct operations. How I could group them only into two categories? Cheers!

  Read the article

• NSDate compare is false?

  - by user1280535

  i compare 2 NSDates which are the same and i get false result. i cant show how i get this dates because its too long , but i can show what i do : NSLog(@"this date is:%@ , and date we check to equality is:%@",thisDate,dateToFind); if([thisDate isEqualToDate:dateToFind] ) { NSLog(@"equal date!"); // not printed! } the NSLog show me this : this date is:2012-09-13 14:23:54 +0000 , and date we check to equality is:2012-09-13 14:23:54 +0000 he doesnt print the NSLog . why ?

  Read the article

• How should 4 decimals places behave, being simple yet powerful

  - by vener

  I have a UI question that troubled me on the best method to handle 4 decimal places for prices. In an table already cramped full of data, I would want to simplified the interface to make it not so cluttered. The actual current UI is shown below. http://i41.tinypic.com/bg5tub.jpg The problem is, for a unit price/units/D.Price and Dis.(Discount) to have 4 decimal places ($0.3459) is quite rare but it still happens (5 in 100 entries). This will result a lot of junk decimal places, cluttering up the interface. What is the best solution to this problem? In short, I want to declutter it yet maintain the precision. Note: This is web app

  Read the article

• How to get all possible generic type in StructureMap?

  - by Soul_Master

  I just used StructureMap few days ago. I use StructureMap for collecting all validator class like the following code. public class BaseClassA {} public class ClassB : BaseClassA {} public class ClassC : BaseClassB {} public BaseClassAValidator : IValidator<BaseClassA>() {} In StructureMap, I only register IValidator interface for BaseClassAValidator class. But I want to get the same result when I call IValidator or IValidator that mean StructureMap should return IValidator where T is requested class or parent class of requested class. Is it possible? Or I need to manually call it.

  Read the article

• javascript call url from different domain

  - by user246114

  Hi, I want to post some data via javascript to another domain. Something like: http://www.othersite.com/submitfunnyname?name=blah The other site (othersite.com) has a REST interface that you can call (well actually this is a get example) to submit a funny name to them. Can I do this already with javascript? I'm a little confused on this - I know if that service wants to return some data, I'd need to use something like JSON-P - even though here I'm submitting some data, I guess the service will return some message structure letting me know the result, so it would have to be JSON-P, right? Thanks

  Read the article

• Submit form when selected value of select element is changed without javascript

  - by Roman Kupin

  Hi the question is pretty simple. <select name="justanumber"> <option value="1" selected="selected">1</option> <option value="2"></option> </select> when selected value is changed i have to do a form post. But the problem is to do this WITHOUT javascript. I'm not sure is it possible to do that, the best result i have archived is submit form using label for.

  Read the article

< Previous Page | 514 515 516 517 518 519 520 521 522 523 524 525  | Next Page >