Search Results

Search found 49404 results on 1977 pages for 'string search'.

Page 537/1977 | < Previous Page | 533 534 535 536 537 538 539 540 541 542 543 544  | Next Page >

  • JPA Native Query (SQL View)

    - by Uchenna
    I have two Entities Customer and Account. @Entity @Table(name="customer") public class Customer { private Long id; private String name; private String accountType; private String accountName; ... } @Entity @Table(name="account") public class Account { private Long id; private String accountName; private String accountType; ... } i have a an sql query select a.id as account_id, a.account_name, a.account_type, d.id, d.name from account a, customer d Assumption account and customer tables are created during application startup. accountType and accountName fields of Customer entity should not be created. That is, only id and name columns will be created. Question How do i run the above sql query and return a Customer Entity Object with the accountType and accountName properties populated with sql query's account_name and account_type values. Thanks

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • loop for Cursor1.moveToPosition() in android

    - by Edward Sullen
    I want to get data in the first column of all row from my database and convert to String[] ... List<String> item1 = new ArrayList<String>(); // c is a cursor which pointed from a database for(int i=0;i<=nombre_row;i++) { c.moveToPosition(i); item1.add(c.getString(0)); } String[] strarray = new String[item1.size()]; item1.toArray(strarray ); I've tried to command step by step, and found that the problem is in the Loop for.... Please help... thanks in advance for all answer.

    Read the article

  • Methods specific only to an instance? What are they called in Ruby?

    - by daremarkovic
    I know there are "instance methods", "class methods" but what are these types of methods called, for eg: s1 = "This is my STRING!" def s1.m1 downcase end p s1 # => "This is my STRING!" p s1.m1 # => "this is my string!" What type of method is the "m1" method called on the s1 "instance" of the "string" class? It's really weird because I didn't know this was possible at all if I try: s2 = "This is ANOTHER string" s2.m1 # => Won't work! Which kind of makes sense, but not sure why defining methods like m1 on instances on a class are useful at all.

    Read the article

  • suppose there is a class which contains 4 data fields.i have to read these value from xml file and s

    - by SunilRai86
    suppose there is a class which contains 4 fields.i have to read these value from xml file and set that value to fields the xml file is like that <Root> <Application > <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>ABC</ClassName> <ExecName>XYZ</ExecName> </Application> <Application> <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>abc</ClassName> <ExecName>xyz</ExecName> </Application> </Root> now i have to read all the values from xml file and set each value to particular fields. i hav done reading of the xml file and i saved the retrieved value in arraylist. the code is like that public class CXmlFileHook { string appname; string classname; string idmark; string execname; string ctor; public CXmlFileHook() { this.appname = "Not Set"; this.idmark = "Not Set"; this.classname = "Not Set"; this.execname = "Not Set"; this.ctor = "CXmlFileHook()"; } public void readFromXmlFile(string path) { XmlTextReader oRreader = new XmlTextReader(@"D:\\Documents and Settings\\sunilr\\Desktop\\MLPACK.xml"); //string[] strNodeValues = new string[4] { "?","?","?","?"}; ArrayList oArrayList = new ArrayList(); while (oRreader.Read()) { if (oRreader.NodeType == XmlNodeType.Element) { switch (oRreader.Name) { case "AppName": oRreader.Read(); //strNodeValues[0] =oRreader.Value; oArrayList.Add(oRreader.Value); break; case "IdMark": oRreader.Read(); //strNodeValues[1] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ClassName": oRreader.Read(); //strNodeValues[2] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ExecName": oRreader.Read(); //strNodeValues[3] = oRreader.Value; oArrayList.Add(oRreader.Value); break; } } } Console.WriteLine("Reading from arraylist"); Console.WriteLine("-------------------------"); for (int i = 0; i < oArrayList.Count; i++) { //Console.WriteLine("Reading from Sting[]"+ strNodeValues[i]); Console.WriteLine(oArrayList[i]); } //this.appname = strNodeValues[0]; //this.idmark = strNodeValues[1]; //this.classname = strNodeValues[2]; //this.execname = strNodeValues[3]; this.appname = oArrayList[0].ToString(); this.idmark = oArrayList[1].ToString(); this.classname = oArrayList[2].ToString(); this.execname = oArrayList[3].ToString(); } static string vInformation; public void showCurrentState(string path) { FileStream oFileStream = new FileStream(path, FileMode.Append, FileAccess.Write); StreamWriter oStreamWriter = new StreamWriter(oFileStream); oStreamWriter.WriteLine("****************************************************************"); oStreamWriter.WriteLine(" Log File "); oStreamWriter.WriteLine("****************************************************************"); CXmlFileHook oFilehook = new CXmlFileHook(); //Type t = Type.GetType(this._classname); //Type t = typeof(CConfigFileHook); DateTime oToday = DateTime.Now; vInformation += "Logfile created on : "; vInformation += oToday + Environment.NewLine; vInformation += "Public " + Environment.NewLine; vInformation += "----------------------------------------------" + Environment.NewLine; vInformation += "Private " + Environment.NewLine; vInformation += "-----------------------------------------------" + Environment.NewLine; vInformation += "ctor = " + this.ctor + Environment.NewLine; vInformation += "appname = " + this.appname + Environment.NewLine; vInformation += "idmark = " + this.idmark + Environment.NewLine; vInformation += "classname = " + this.classname + Environment.NewLine; vInformation += "execname = " + this.execname + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; vInformation += "Protected" + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; oStreamWriter.WriteLine(vInformation); oStreamWriter.Flush(); oStreamWriter.Close(); oFileStream.Close(); } } here i set set the fields according to arraylist index but i dont want is there any another solution for this....

    Read the article

  • 2 ajax forms on the same page posting same textbox

    - by rod
    Hi All, Is it possible to post, say like a value in a textbox, to 2 different ajax forms that are on the same page? It doesn't have to be at the same time? What I'm trying to do is this: I have a search page that searches for customers and displays them on a paged grid. Users can specify up to 5 parameters (5 textboxes) to narrow the search. On the same page I have an export option. Well since I want all the customers for the search and not just the paged data I need a way to post back to the server for this option passing the same parameters used in the grid. I'm using a ViewModel which would be nice if I can pass that back to the server rather than the individual search fields that are backed by the view model. Thanks, rodchar

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • Share variable across site ASP.NET

    - by Anders
    I have a class isSearching with a single boolean property in a 'functions' file in my webapp. On my search page, I have a variable oSearchHandler declared as a Public Shared variable. How can I access the contents of oSearchHandler on other pages in my webapp? Code with Session.... 'search.aspx Public Function oSearchString(ByVal oTextBoxName As String) As String For Each oKey As String In Request.Form.AllKeys If oKey.Contains(oTextBoxName) Then Session.Add("searching", True) Session.Add("search-term", Request.Form(oKey)) Return Request.Form(oKey) End If Next Return "" End Function 'theMaster.master <% If Session("searching") Then %><ul style="float: right;"> <li> <div class="gsSearch"> <asp:TextBox ID="searchbox" runat="server"></asp:TextBox> </div> </li> <li> <div class="gsSearch"> <asp:Button ID="searchbutton" runat="server" Text="search" UseSubmitBehavior="true" PostBackUrl="search.aspx" CssClass="searchBtn" /> </div> </li> </ul> <% End If %> I think that the session will work just fine.

    Read the article

  • How to store and retrieve pictures using PHP?

    - by user1276898
    I am building a webpage using PHP to search within my database. I am able to do a query and get the data to show on my page. I also have a picture that is related to each record. Let's say something like a picture ID for each employee. I am wondering what is the best way to store and retrieve pictures in order to get it show using PHP. Is there a way to store all the pictures in the subfolder like " image" and retrieve the pictures using PHP? I tried to search around on the internet, but I get confused. Also, when I type something in the search box and click the button, is there a way to keep the input in the search box without erasing it? Thank you very much.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • error message fix

    - by user1722654
    for (int i = 0; i < dataGridView1.Rows.Count; i++) { //bool sleected = false; if (dataGridView1.Rows[i].Cells[3].Value != null) { selected.Add(i); } } //string donew = ""; // line off error textBox1.Text = ((String)dataGridView1.Rows[1].Cells[2].Value); /* for (int i = 0; i < selected.Count; i++) { textAdded.Add((String)dataGridView1.Rows[0].Cells[2].Value); // donew += (String)dataGridView1.Rows[selected[i]].Cells[2].Value; }*/ I keep getting the error Unable to cast object of type 'System.Double' to type 'System.String' What can I do to overcome this?

    Read the article

  • Mystery: How does Google do cross-domain iframe communication?

    - by Shraga
    Hi everyone, When you host Googles web search element on a page, a div is created which incorporates an iframe which points to a Google adsense ads page. However, if there are no ads for the specific query, Google somehow changes the class on YOUR domain to render the div (and iframe) invisible. They are NOT using postMessage, as it also works in IE7. They are also not using the fragment identifier method, as no hash appears in the url. So how do they do it? To check what I'm saying just put the following into a regular html page: <!-- Google Custom Search Element --> <div id="cse" style="width:100%;">Loading</div> <script src="http://www.google.com/jsapi" type="text/javascript"></script> <script type="text/javascript"> google.load('search', '1'); google.setOnLoadCallback(function(){ new google.search.CustomSearchControl().draw('cse'); }, true); </script> and then do a search for "cars" (or anything else that will definitely have ads) and then for "wzxv", which has no ads...

    Read the article

  • Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

    - by Newbie
    If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Best way to integrate searching with pagination

    - by Vijay Choudhary
    I have a web application build on cakephp 2.x. I have integrated pagination on my data. Now i want to implement searching on that data also, and pagination should work according to search result. Now my question is: Should i use a form to post my search string. If so, then which method should i use, GET or POST. OR, should i use javascript window.location method, and append the search string to it. If we use this method then search string can append more than once to url. Or any other best way to implement this. Can anybody give the best solution for this as it is a common task for each application to have.

    Read the article

  • Python "string_escape" vs "unicode_escape"

    - by Mike Boers
    According to the docs, the builtin string encoding string_escape: Produce[s] a string that is suitable as string literal in Python source code ...while the unicode_escape: Produce[s] a string that is suitable as Unicode literal in Python source code So, they should have roughly the same behaviour. BUT, they appear to treat single quotes differently: >>> print """before '" \0 after""".encode('string-escape') before \'" \x00 after >>> print """before '" \0 after""".encode('unicode-escape') before '" \x00 after The string_escape escapes the single quote while the Unicode one does not. Is it safe to assume that I can simply: >>> escaped = my_string.encode('unicode-escape').replace("'", "\\'") ...and get the expected behaviour?

    Read the article

  • How to validate phone number(US format) in Java?

    - by Maxood
    I just want to know where am i wrong here: import java.io.*; class Tokens{ public static void main(String[] args) { //String[] result = "this is a test".split(""); String[] result = "4543 6546 6556".split(""); boolean flag= true; String num[] = {"0","1","2","3","4","5","6","7","8","9"}; String specialChars[] = {"-","@","#","*"," "}; for (int x=1; x<result.length; x++) { for (int y=0; y<num.length; y++) { if ((result[x].equals(num[y]))) { flag = false; continue; } else { flag = true; } if (flag == true) break; } if (flag == false) break; } System.out.println(flag); } }

    Read the article

  • how to have minimum AreaRegistrations with putting duplicated elements in single place

    - by Sadegh
    hi all, i have several AreaRegistration classes which one each registers own routes and each one have some duplicated elements such as bolded text in below: context.MapRoute("Search", "**{culture}/{style}**/search", new { **culture = cultureValue, style = styleValue,** controller = "search", action = "default" }, new { **culture = new CultureRouteConstraint(), style = new StyleRouteConstraint()** }); how i can have minimum AreaRegistrations with putting duplicated elements in single place which handles that? this is possible?

    Read the article

  • Obtaining Index value of dictionary

    - by Maudise
    I have a piece of code which looks at the following public Test As Dictionary(Of String, String()) Which is brought in tester = New Dictionary(Of String, String()) tester.add("Key_EN", {"Option 1_EN", "Option 2_EN", "Option 3_EN"}) tester.add("Key_FR", {"Option 1_FR", "Option 2_FR", "Option 3_FR"}) tester.add("Key_DE", {"Option 1_DE", "Option 2_DE", "Option 3_DE"}) There's then a combo box which looks at the following dim Language as string Language = "_EN" ' note this is done by a drop down combo box to select _EN or _FR etc. cboTestBox.items.AddRange(tester("Key" & Language)) What I need to be able to do is to see what index position the answer is in and convert it back to the Key_EN. So, for example _DE is selected, then the options of "Option 1_DE", "Option 2_DE", "Option 3_DE" would be displayed. If they chose Option 3_DE then I need to be able to convert this to Option 3_EN. Many thanks Maudise

    Read the article

  • parse json news feed array android

    - by user1827260
    I have an json feed from bbc in this format { "name": "ticker", "entries": [ { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, { "headline": "text", "prompt": "LATEST", "isBreaking": "false", "mediaType": "Standard", "url": "" }, etc........... My code is as follows: ArrayList mylist = new ArrayList(); JSONObject json = JSONfunctions.getJSONfromURL("http:/......"); try{ JSONArray item = json.getJSONArray("entries"); for (int i = 0; i<item.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); JSONObject e = item.getJSONObject(i); JSONObject title = e.JSONObject("headline"); map.put("title", "Title:" + e.getString("headline"); } It gives me the error "java.lang.String cannot be converted to JSONObject" I also tried leaving out JSONObject title = e.JSONObject("headline"); and it gives me a path error (note

    Read the article

  • Java spliting strings

    - by N0b
    Hi I've got a Java problem. I'm trying split a string when ever a " " occurs, for example the sentence test abc. Then move the first letter in each word from first to last. I got the moving the letter to work on the original string using String text = JOptionPane.showInputDialog(null,"Skriv in en normal text:"); char firstLetter = text.charAt(0); normal = text.substring(1,text.length()+0) + firstLetter; So my question is how would I split the string then start moving the letters around in each part of the cut string? Thanks in advance

    Read the article

  • Adding an ID or Class in Ruby on Rails?

    - by Probocop
    I've got the following code for a search form, but how would I add an ID or a class to the submit button? <% form_tag '/wine/search/', :method => 'get' do %> <%= label_tag "Search" %> <%= text_field_tag :search_string, params[:search_string] %> <%= submit_tag "Go" %> <% end %> Thanks

    Read the article

< Previous Page | 533 534 535 536 537 538 539 540 541 542 543 544  | Next Page >