Search Results

Search found 15860 results on 635 pages for 'document oriented databas'.

Page 549/635 | < Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >

  • Lights off effect and jquery placement on wordpress

    - by Alexander Santiago
    I'm trying to implement a lights on/off on single posts of my wordpress theme. I know that I have to put this code on my css, which I did already: #the_lights{ background-color:#000; height:1px; width:1px; position:absolute; top:0; left:0; display:none; } #standout{ padding:5px; background-color:white; position:relative; z-index:1000; } Now this is the code that I'm having trouble with: function getHeight() { if ($.browser.msie) { var $temp = $("").css("position", "absolute") .css("left", "-10000px") .append($("body").html()); $("body").append($temp); var h = $temp.height(); $temp.remove(); return h; } return $("body").height(); } $(document).ready(function () { $("#the_lights").fadeTo(1, 0); $("#turnoff").click(function () { $("#the_lights").css("width", "100%"); $("#the_lights").css("height", getHeight() + "px"); $("#the_lights").css({‘display’: ‘block’ }); $("#the_lights").fadeTo("slow", 1); }); $("#soft").click(function () { $("#the_lights").css("width", "100%"); $("#the_lights").css("height", getHeight() + "px"); $("#the_lights").css("display", "block"); $("#the_lights").fadeTo("slow", 0.8); }); $("#turnon").click(function () { $("#the_lights").css("width", "1px"); $("#the_lights").css("height", "1px"); $("#the_lights").css("display", "block"); $("#the_lights").fadeTo("slow", 0); }); }); I think it's a jquery. Where do I place it and how do I call it's function? Been stuck on this thing for 6 hours now and any help would be greatly appreciated...

    Read the article

  • IE "Microsoft JScript runtime error: Object expected"

    - by Stephen Borg
    Hi there, I have problems with regards to javascript only when using IE. The error I am getting is "Microsoft JScript runtime error: Object expected" and I have no idea why. It is then jumping into the JQuery 1.4.2 file, without giving me a proper error message. All I am doing is simply reading on page load the raw URL, and getting a query string named Search. Using that in an AJAX call to return products and put then into a DIV. No biggies, but somehow IE is managing to blow my page up :-( Any ideas? Code as follows : <script type="text/javascript"> $(document).ready(function (e) { $('.boxLoader').show(); function getParameterByName(name) { name = name.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regexS = "[\\?&]" + name + "=([^&#]*)"; var regex = new RegExp(regexS); var results = regex.exec(window.location.href); if (results == null) return ""; else return decodeURIComponent(results[1].replace(/\+/g, " ")); } var Search; Search = getParameterByName("search"); $('#searchCriteria').text(Search); $.get("/Handlers/processProducts.aspx", { SearchCriteria: Search }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); $('#searchBox').live("click", function () { $.get("/Handlers/processProducts.aspx", { SearchCriteria: $('#searchCriteria').val() }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); }); }); </script>

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • Question about the evolution of interaction paradigm between web server program and content provider program?

    - by smwikipedia
    Hi experts, In my opinion, web server is responsible to deliver content to client. If it is static content like pictures and static html document, web server just deliver them as bitstream directly. If it is some dynamic content that is generated during processing client's request, the web server will not generate the conetnt itself but call some external proram to genearte the content. AFAIK, this kind of dynamice content generation technologies include the following: CGI ISAPI ... And from here, I noticed that: ...In IIS 7, modules replace ISAPI filters... Is there any others? Could anyone help me complete the above list and elabrate on or show some links to their evolution? I think it would be very helpful to understand application such as IIS, TomCat, and Apache. I once wrote a small CGI program, and though it serves as a content generator, it is still nothing but a normal standalone program. I call it normal because the CGI program has a main() entry point. But with the recenetly technology like ASP.NET, I am not writing complete program, but only some class library. Why does such radical change happens? Many thanks.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • 'send' button error 401

    - by jjd
    I'm having a strange error with 'Send' button I have the following code on my page <div id="fb-root"></div> <script type="text/javascript"> (function(d, s, id) { var js, fjs = d.getElementsByTagName(s)[0]; if (d.getElementById(id)) return; js = d.createElement(s); js.id = id; js.src = "//connect.facebook.net/en_US/all.js#xfbml=1&amp;appId=<myAppId>"; fjs.parentNode.insertBefore(js, fjs); }(document, 'script', 'facebook-jssdk')); </script> <br/> <fb:like send="true" width="450" show_faces="true"></fb:like> The 'send' button works fine if I access the application via IP address, but if I use a domain name, Facebook returns The page at http://<...>.com:8080/pages/question.jsf could not be reached because the server returned status code 401. Meantime 'like' button works fine. The application front-end is built with JSF2+Primefaces. Any ideas would be appreciated Thanks

    Read the article

  • macro collapse all in solution visual studio 2010

    - by rod
    Hi All, I found the CollapseAll macro online that has worked for me in vs2005 and vs2008. However, this half way works in vs2010. It looks like it only collapses the top nodes and not any subnodes that may be expanded? any ideas? Thanks, rod. Sub CollapseAll() ' Get the the Solution Explorer tree Dim UIHSolutionExplorer As UIHierarchy UIHSolutionExplorer = DTE.Windows.Item(Constants.vsext_wk_SProjectWindow).Object() ' Check if there is any open solution If (UIHSolutionExplorer.UIHierarchyItems.Count = 0) Then ' MsgBox("Nothing to collapse. You must have an open solution.") Return End If ' Get the top node (the name of the solution) Dim UIHSolutionRootNode As UIHierarchyItem UIHSolutionRootNode = UIHSolutionExplorer.UIHierarchyItems.Item(1) UIHSolutionRootNode.DTE.SuppressUI = True ' Collapse each project node Dim UIHItem As UIHierarchyItem For Each UIHItem In UIHSolutionRootNode.UIHierarchyItems 'UIHItem.UIHierarchyItems.Expanded = False If UIHItem.UIHierarchyItems.Expanded Then Collapse(UIHItem) End If Next ' Select the solution node, or else when you click ' on the solution window ' scrollbar, it will synchronize the open document ' with the tree and pop ' out the corresponding node which is probably not what you want. UIHSolutionRootNode.Select(vsUISelectionType.vsUISelectionTypeSelect) UIHSolutionRootNode.DTE.SuppressUI = False End Sub Private Sub Collapse(ByVal item As UIHierarchyItem) For Each eitem As UIHierarchyItem In item.UIHierarchyItems If eitem.UIHierarchyItems.Expanded AndAlso eitem.UIHierarchyItems.Count > 0 Then Collapse(eitem) End If Next item.UIHierarchyItems.Expanded = False End Sub End Module

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

  • Why doesn't Javascript recognize the HTML class attribute?

    - by Cornflake
    Can anyone help me with a Javascript question, please? Why does the following code display only message boxes with the word "null" in them? And I think there are not enough of them either. <html> <head> <script type="text/javascript"> function showElementClasses(node) { var els = node.getElementsByTagName("*"); for(var i=0,j=els.length; i<j; i++) alert(els[i].getAttribute("class")); alert("Class: " + els[i].className); } showElementClasses(document); </script> </head> <body class="bla"> <div class="myclass" style="width: 500; height: 400" id="map"></div> </body> </html>

    Read the article

  • JQuery fadeIn fadeOut loop issue

    - by Tarun
    I am trying to create a jQuery fadeIn fadeout effect for my page content using the code below. $(document).ready(function (){ $("#main").click(function(){ $("#content").fadeOut(800, function(){ $("#content").load("main.html", function(){ $("#content").fadeIn(800); }); }); }); $("#gallery").click(function(){ $("#content").fadeOut(800, function(){ $("#content").load("gallery.html", function(){ $("#content").fadeIn(800); }); }); }); }); So whenever a user clicks on either the main link or gallery link, the old content fades out and new content fades in. The problem I am facing is that for every link I have to repeat the same code again and again. So I tried to use a loop to simplify this but it doesn't work. Here is my code: var p = ["#main","#gallery", "#contact"]; var q = ["main.html", "gallery.html", "contact.html"]; for (i=0;i<=(p.length-1);i++){ $(p[i]).click(function(){ $("#content").fadeOut(500, function(){ $("#content").load(q[i], function(){ $("#content").fadeIn(500); }); }); }); } It works fine when I write repeat the scripts for each link but it doesn't work when I combine them in a loop. I only get the FadeOut effect and nothing happens after that. This might be a very simple issue or may be something deep into jQuery. Any hint or help is greatly appreciated. TK

    Read the article

  • Testing approach for multi-threaded software

    - by Shane MacLaughlin
    I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

    Read the article

  • Jquery cant get facebox working inside ajax call

    - by John
    From my main page I call an ajax file via jquery, in that ajax file is some additional jquery code. Original link looks like this: <a href="/page1.php" class="guest-action notify-function"><img src="/icon1.png"></a> Then the code: $(document).ready(function(){ $('a[rel*=facebox]').facebox(); $('.guest-action').click( function() { $.get( $(this).attr('href'), function(responseText) { $.jGrowl(responseText); }); return false; }); $('.notify-function').click( function() { $(this).find('img').attr('src','/icon2.png'); $(this).attr('href','/page2.php'); $(this).removeClass('guest-action').removeClass('notify-function').attr('rel','facebox'); }); }); So basically after notify-function is clicked I am changing the icon and the url of the link, I then am removing the classes so that the click wont be ran again and add rel="facebox" to the link so that the facebox window will pop up if they try to click the new icon2.png that shows up. The problem is after I click the initial icon everything works just fine except when I try to click the new icon2.png it still executes the jgrowl code from the guest-action. But when I view the source it shows this: <a href="/page2.php" rel="facebox" class=""><img src="/icon2.png"></a> So it seemed that should work right? What am I doing wrong? I tried adding the facebox code to the main page that is calling the ajax file as well and still same issue.

    Read the article

  • how do I call a javacript function every 60 seconds?

    - by William
    So I'm trying to work on a Canvas demo, and I want this square to move from one side to the other, but I can't figure out how to call javascript in a way that repeats every 60 seconds. Here's what I got so far: <!DOCTYPE html> <html lang="en"> <head> <title>Canvas test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #000000;} canvas{ background-color: #ffffff;} </style> <script type="text/javascript"> var x = 50; var y = 250; function update(){ draw(); x = x + 5; } function draw(){ var canvas = document.getElementById('screen1'); if (canvas.getContext){ var ctx = canvas.getContext('2d'); ctx.fillStyle = 'rgb(236,138,68)'; ctx.fillRect(x,y,24,24); } } </script> </head> <body onLoad="setTimeout(update(), 0);"> <canvas id="screen1" width="500" height="500"></canvas> </body> </html>

    Read the article

  • jQuery when div is clicked update input field issue

    - by stogdilla
    Hello, I'm rather new to jquery so this may be the issue. I have a script that outputs several divs all with different text data in them. I would like it when I click one of them that an input field's value is updated to that text currently I have: <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.1/jquery.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $("a.results]").click(function() { data= this.text(); $("#updateme").val(data); }); }); </script> <p> <label>Field <input type="text" name="updateme" id="updateme"> </label> </p> <a href="#" class="results">Florida</a> <a href="#" class="results">Florida 2</a> <a href="#" class="results">Florida 3</a> How can I make it so that whatever link is clicked that is the data that gets updated into the input's value? I can get it to take one or I can script out different cases of each changing the class name but I think there has to be a way where it references whatever link is being clicked instead of what it's currently doing. Thanks in advance!

    Read the article

  • treeview dynamically populated

    - by Laziale
    Hello everyone - I have this treeview control where I want to put uploaded files on the server. I want to be able to create the nodes and the child nodes dynamically from the database. I am using this query for getting the data from DB: SELECT c.Category, d.DocumentName FROM Categories c INNER JOIN DocumentUserFile d ON c.ID = d.CategoryId WHERE d.UserId = '9rge333a-91b5-4521-b3e6-dfb49b45237c' The result from that query is this one: Agendas transactions.pdf Minutes accounts.pdf I want to have the treeview sorted that way too. I am trying with this piece of code: TreeNode tn = new TreeNode(); TreeNode tnSub = new TreeNode(); foreach (DataRow dt in tblTreeView.Rows) { tn.Text = dt[0].ToString(); tn.Value = dt[0].ToString(); tnSub.Text = dt[1].ToString(); tnSub.NavigateUrl = "../downloading.aspx?file=" + dt[1].ToString() +"&user=" + userID; tn.ChildNodes.Add(tnSub); tvDocuments.Nodes.Add(tn); } I am getting the treeview populated nicely for the 1st category and the document under that category, but I can't get it to work when I want to show more documents under that category, or even more complicate to show new category beneath the 1st one with documents from that category. How can I solve this? I appreciate the answers a lot. Thanks, Laziale

    Read the article

  • ASP.NET - Webservice not being called from javascript

    - by Robert
    Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

    Read the article

  • Choosing a W3C valid DOCTYPE and charset combination?

    - by George Carter
    I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

    Read the article

  • increase number of photos from flickr using json

    - by Andrew Welch
    Hi this is my code: Is is possible to get more photos from flickr. What is the standard / default number? $(document).ready(function(){ $.getJSON("http://api.flickr.com/services/feeds/photos_public.gne?id=48719970@N07&lang=en-us&format=json&jsoncallback=?", function(data){ $.each(data.items, function(i, item){ var newurl = 'url(' + item.media.m + ')'; $("<div class='images'/>").css('background', newurl).css('backgroundPosition','top center').css('backgroundRepeat','no-repeat').appendTo("#images").wrap("<a target=\"_blank\ href='" + item.link + "'></a>"); }) $("#title").html(data.title); $("#description").html(data.description); $("#link").html("<a href='" + data.link + "' target=\"_blank\">Visit the Viget Inspiration Pool!</a>"); //Notice that the object here is "data" because that information sits outside of "items" in the JSON feed $('.jcycleimagecarousel').cycle({ fx: 'fade', speed: 300, timeout: 3000, next: '#next', prev: '#prev', pause: 1, random: 1 }); }); });

    Read the article

  • How can I bind a simple Javascript array to an MVC3 controller action method?

    - by Sergio Tapia
    Here is the javascript code I use to create the array and send it on it's way: <script type="text/javascript" language="javascript"> $(document).ready(function () { $("#update-cart-btn").click(function() { var items = []; $(".item").each(function () { var productKey = $(this).find("input[name='item.ProductId']").val(); var productQuantity = $(this).find("input[type='text']").val(); items[productKey] = productQuantity; }); $.ajax({ type: "POST", url: "@Url.Action("UpdateCart", "Cart")", data: items, success: function () { alert("Successfully updated your cart!"); } }); }); }); </script> The items object is properly constructed with the values I need. What data type must my object be on the backend of my controller? I tried this but the variable remains null and is not bound. [Authorize] [HttpPost] public ActionResult UpdateCart(object[] items) // items remains null. { // Some magic here. return RedirectToAction("Index"); }

    Read the article

  • Javascript tr click event with newly created rows

    - by yalechen
    I am very new to web development. I am currently using tablesorter jquery plugin to create a dynamic table, where the user can add and delete rows. I am having trouble with changing the background color of newly created rows upon clicking. It works fine with rows that are hard coded in html. Here is the relevant code: $(document).ready( function() { $('table.tablesorter td').click( function (event) { $(this).parent('tr').toggleClass('rowclick'); $(this).parent('tr').siblings().removeClass('rowclick'); }); } ) rowclick is a css class here: table.tablesorter tbody tr.rowclick td { background-color: #8dbdd8; } I have tried adding the following to my javascript function that adds a new row: var createClickHandler = function(newrow) { return function(event) { //alert(newrow.cells[0].childNodes[0].data); newrow.toggleClass('rowclick'); newrow.siblings().removeClass('rowclick'); }; } row.onclick = createClickHandler(row); The alert correctly displays the text in the first column of the row when I click the new row. However, my new rows do not respond to the css class. Anyone have any ideas? Thanks in advance.

    Read the article

  • Validate a XDocument against schema without the ValidationEventHandler (for use in a HTTP handler)

    - by Vaibhav Garg
    Hi everyone, (I am new to Schema validation) Regarding the following method, System.Xml.Schema.Extensions.Validate( ByVal source As System.Xml.Linq.XDocument, ByVal schemas As System.Xml.Schema.XmlSchemaSet, ByVal validationEventHandler As System.Xml.Schema.ValidationEventHandler, ByVal addSchemaInfo As Boolean) I am using it as follows inside a IHttpHandler - Try Dim xsd As XmlReader = XmlReader.Create(context.Server.MapPath("~/App_Data/MySchema.xsd")) Dim schemas As New XmlSchemaSet() : schemas.Add("myNameSpace", xsd) : xsd.Close() myXDoxumentOdj.Validate(schemas, Function(s As Object, e As ValidationEventArgs) SchemaError(s, e, context), True) Catch ex1 As Threading.ThreadAbortException 'manage schema error' Return Catch ex As Exception 'manage other errors' End Try The handler- Function SchemaError(ByVal s As Object, ByVal e As ValidationEventArgs, ByVal c As HttpContext) As Object If c Is Nothing Then c = HttpContext.Current If c IsNot Nothing Then HttpContext.Current.Response.Write(e.Message) HttpContext.Current.Response.End() End If Return New Object() End Function This is working fine for me at present but looks very weak. I do get errors when I feed it bad XML. But i want to implement it in a more elegant way. This looks like it would break for large XML etc. Is there some way to validate without the handler so that I get the document validated in one go and then deal with errors? To me it looks Async such that the call to Validate() would pass and some non deterministic time later the handler would get called with the result/errors. Is that right? Thanks and sorry for any goofy mistakes :).

    Read the article

  • Can't get jQuery to wokr with Prototype - tried everything....

    - by thinkfuture
    Ok so here is the situation. Been pulling my hair out on this one. I'm a noob at this. Only been using rails for about 6 weeks. I'm using the standard setup package, and my code leverages prototype helpers heavily. Like I said, noob ;) So I'm trying to put in some jQuery effects, like PrettyPhoto. But what happens is that when the page is first loaded, PrettyPhoto works great. However, once someone uses a Prototype helper, like a link created with link_to_remote, Prettyphoto stops working. I've tried jRails, all of the fixes proposed on the JQuery site to stop conflicts... http://docs.jquery.com/Using_jQuery_with_Other_Libraries ...even done some crazy things likes renaming all of the $ in prototype.js to $$$ to no avail. Either the prototype helpers break, or jQuery breaks. Seems nothing I do can get these to work together. Any ideas? Here is part of my application.html.erb <%= javascript_include_tag 'application' %> <%= javascript_include_tag 'tooltip' %> <%= javascript_include_tag 'jquery' %> <%= javascript_include_tag 'jquery-ui' %> <%= javascript_include_tag "jquery.prettyPhoto" %> <%= javascript_include_tag 'prototype' %> <%= javascript_include_tag 'scriptalicious' %> </head> <body> <script type="text/javascript" charset="utf-8"> jQuery(document).ready( function() { jQuery("a[rel^='prettyPhoto']").prettyPhoto(); }); </script> If I put prototype before jquery, the prototype helpers don't work If I put the noconflict clause in, neither works. Thanks in advance! Chris

    Read the article

  • Problem uploading app to google app engine

    - by Oberon
    I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

    Read the article

  • Multiple dispatching issue

    - by user1440263
    I try to be synthetic: I'm dispatching an event from a MovieClip (customized symbol in library) this way: public function _onMouseDown(e:MouseEvent){ var obj = {targetClips:["tondo"],functionString:"testFF"}; dispatchEvent(new BridgeEvent(BridgeEvent.BRIDGE_DATA,obj)); } The BridgeEvent class is the following: package events { import flash.events.EventDispatcher; import flash.events.Event; public class BridgeEvent extends Event { public static const BRIDGE_DATA:String = "BridgeData"; public var data:*; public function BridgeEvent(type:String, data:*) { this.data = data; super(type, true); } } } The document class listens to the event this way: addEventListener(BridgeEvent.BRIDGE_DATA,eventSwitcher); In eventSwitcher method I have a simple trace("received"). What happens: when I click the MovieClip the trace action gets duplicated and the output window writes many "received" (even if the click is only one). What happens? How do I prevent this behaviour? What is causing this? Any help is appreciated. [SOLVED] I'm sorry, you will not believe this. A colleague, to make me a joke, converted the MOUSE_DOWN handler to MOUSE_OVER.

    Read the article

  • Calling jQuery method from onClick attribute in HTML

    - by Russell
    I am relatively new to implementing JQuery throughout an entire system, and I am enjoying the opportunity. I have come across one issue I would love to find the correct resolve for. Here is a simple case example of what I want to do: I have a button on a page, and on the click event I want to call a jquery function I have defined. Here is the code I have used to define my method (Page.js): (function($) { $.fn.MessageBox = function(msg) { alert(msg); }; }); And here is my HTML page: <HTML> <head> <script type="text/javascript" src="C:\Sandpit\jQueryTest\jquery-1.3.2.js"></script> <script language="javascript" src="Page.js"></script> </head> <body> <div class="Title">Welcome!</div> <input type="button" value="ahaha" onclick="$().MessageBox('msg');" /> </body> </HTML> (The above code displays the button, but clicking does nothing.) I am aware I could add the click event in the document ready event, however it seems more maintainable to put events in the HTML element instead. However I have not found a way to do this. Is there a way to call a jquery function on a button element (or any input element)? Or is there a better way to do this? Thanks

    Read the article

< Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >