Search Results

Search found 15860 results on 635 pages for 'document oriented databas'.

Page 549/635 | < Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >

  • How to have multiple instances of jQuery plugin on single page?

    - by James Skidmore
    I'm writing a simple jQuery plugin, but I'm having trouble being able to use multiple instances on a page. For instance, here is a sample plugin to illustrate my point: (function($) { $.fn.samplePlugin = function(options) { if (typeof foo != 'undefined') { alert('Already defined!'); } else { var foo = 'bar'; } }; })(jQuery); And then if I do this: $(document).ready(function(){ $('#myDiv').samplePlugin({}); // does nothing $('#myDiv2').samplePlugion({}); // alerts "Already defined!" }); This is obviously an over-simplified example to get across the point. So my question is, how do I have two separate instances of the plugin? I'd like to be able to use it across multiple instances on the same page. I'm guessing that part of the problem might be with defining the variables in a global scope. How can I define them unique to that instance of the plugin then? Thank you for your guidance!

    Read the article

  • Handling Types Defined in Plug-ins That Are No Longer Available

    - by Chris
    I am developing a .NET framework application that allows users to maintain and save "projects". A project can consist of components whose types are defined in the assemblies of the framework itself and/or in third-party assemblies that will be made available to the framework via a yet-to-be-built plug-in architecture. When a project is saved, it is simply binary-serialised to file. Projects are portable, so multiple users can load the same project into their own instances of the framework (just as different users may open the same MSWord document in their own local copies of MSWord). What's more, the plug-ins available to one user's framework might not be available to that of another. I need some way of ensuring that when a user attempts to open (i.e. deserialise) a project that includes a type whose defining assembly cannot be found (either because of a framework version incompatibility or the absence of a plug-in), the project still opens but the offending type is somehow substituted or omitted. Trouble is, the research I've done to date does not even hint at a suitable approach. Any ideas would be much appreciated, thanks.

    Read the article

  • how do I call a javacript function every 60 seconds?

    - by William
    So I'm trying to work on a Canvas demo, and I want this square to move from one side to the other, but I can't figure out how to call javascript in a way that repeats every 60 seconds. Here's what I got so far: <!DOCTYPE html> <html lang="en"> <head> <title>Canvas test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #000000;} canvas{ background-color: #ffffff;} </style> <script type="text/javascript"> var x = 50; var y = 250; function update(){ draw(); x = x + 5; } function draw(){ var canvas = document.getElementById('screen1'); if (canvas.getContext){ var ctx = canvas.getContext('2d'); ctx.fillStyle = 'rgb(236,138,68)'; ctx.fillRect(x,y,24,24); } } </script> </head> <body onLoad="setTimeout(update(), 0);"> <canvas id="screen1" width="500" height="500"></canvas> </body> </html>

    Read the article

  • Javascript tr click event with newly created rows

    - by yalechen
    I am very new to web development. I am currently using tablesorter jquery plugin to create a dynamic table, where the user can add and delete rows. I am having trouble with changing the background color of newly created rows upon clicking. It works fine with rows that are hard coded in html. Here is the relevant code: $(document).ready( function() { $('table.tablesorter td').click( function (event) { $(this).parent('tr').toggleClass('rowclick'); $(this).parent('tr').siblings().removeClass('rowclick'); }); } ) rowclick is a css class here: table.tablesorter tbody tr.rowclick td { background-color: #8dbdd8; } I have tried adding the following to my javascript function that adds a new row: var createClickHandler = function(newrow) { return function(event) { //alert(newrow.cells[0].childNodes[0].data); newrow.toggleClass('rowclick'); newrow.siblings().removeClass('rowclick'); }; } row.onclick = createClickHandler(row); The alert correctly displays the text in the first column of the row when I click the new row. However, my new rows do not respond to the css class. Anyone have any ideas? Thanks in advance.

    Read the article

  • deep linking in Excel sheets exported to html

    - by pomarc
    hello everybody, I am working on a project where I must export to html a lot of Excel files. This is pretty straightforward using automation and saving as html. The problem is that many of these sheets have links to worksheets of some other files. I must find a way to write a link to a single inner worksheet. When you export a multisheet excel file to html, excel creates a main htm file, a folder named filename_file, and inside this folder it writes down several files: a css, an xml list of files, a file that creates the tab bar and several html files named sheetxxx.htm, each one representing a worksheet. When you open the main file, you can click the menu bar at the bottom which lets you select the appropriate sheet. This is in fact a link, which replaces a frame content with the sheetxxx.htm file. When this file is loaded a javascript function that selects the right tab gets called. The exported files will be published on a web site. I will have to post process each file and replace every link to the other xls files to the matching htm file, finding a way to open the right worksheet. I think that I could add a parameter to the processed htm file link url, such as myfile.htm?sh=sheet002.htm if I want to link to the second worksheet of myfile.htm (ex myfile.xls). After I've exported them, I could inject a simple javascript into each of the main files which, when they are loaded, could retrieve the sh parameter with jQuery (this is easy) and use this to somehow replace the frSheet frame contents (where the sheets get loaded), opening the right inner sheet and not the default sheet (this is what I call deep linking) mimicking what happens when a user clicks on a tab. This last step is missing... :) I am considering different options, such as replacing the source of the $("frSheet") frame after document.ready. I'd like to hear from you any advice on what could be the best way to realize that in your opinion. any help is greately appreciated, many thanks.

    Read the article

  • Question about the evolution of interaction paradigm between web server program and content provider program?

    - by smwikipedia
    Hi experts, In my opinion, web server is responsible to deliver content to client. If it is static content like pictures and static html document, web server just deliver them as bitstream directly. If it is some dynamic content that is generated during processing client's request, the web server will not generate the conetnt itself but call some external proram to genearte the content. AFAIK, this kind of dynamice content generation technologies include the following: CGI ISAPI ... And from here, I noticed that: ...In IIS 7, modules replace ISAPI filters... Is there any others? Could anyone help me complete the above list and elabrate on or show some links to their evolution? I think it would be very helpful to understand application such as IIS, TomCat, and Apache. I once wrote a small CGI program, and though it serves as a content generator, it is still nothing but a normal standalone program. I call it normal because the CGI program has a main() entry point. But with the recenetly technology like ASP.NET, I am not writing complete program, but only some class library. Why does such radical change happens? Many thanks.

    Read the article

  • Jquery cant get facebox working inside ajax call

    - by John
    From my main page I call an ajax file via jquery, in that ajax file is some additional jquery code. Original link looks like this: <a href="/page1.php" class="guest-action notify-function"><img src="/icon1.png"></a> Then the code: $(document).ready(function(){ $('a[rel*=facebox]').facebox(); $('.guest-action').click( function() { $.get( $(this).attr('href'), function(responseText) { $.jGrowl(responseText); }); return false; }); $('.notify-function').click( function() { $(this).find('img').attr('src','/icon2.png'); $(this).attr('href','/page2.php'); $(this).removeClass('guest-action').removeClass('notify-function').attr('rel','facebox'); }); }); So basically after notify-function is clicked I am changing the icon and the url of the link, I then am removing the classes so that the click wont be ran again and add rel="facebox" to the link so that the facebox window will pop up if they try to click the new icon2.png that shows up. The problem is after I click the initial icon everything works just fine except when I try to click the new icon2.png it still executes the jgrowl code from the guest-action. But when I view the source it shows this: <a href="/page2.php" rel="facebox" class=""><img src="/icon2.png"></a> So it seemed that should work right? What am I doing wrong? I tried adding the facebox code to the main page that is calling the ajax file as well and still same issue.

    Read the article

  • Why aren't these Canvases rendering?

    - by bpapa
    I'm creating a web app that allows users to enter a number of colors, by specifying RGB values. Upon submission, the user will see a canvas with a solid rectangle drawn in the color chosen. On this page, I have 7 canvases. The first one draws just fine, but none of the rest show up. The browser is Safari. Here's the relevant code: First, the script element in the header, which defines the function I use to draw to the canvas. <script language="JavaScript" TYPE="text/javascript"><!-- function drawCanvas(canvasId, red, green, blue) { var theCanvas = document.getElementById("canvas" + canvasId); var context = theCanvas.getContext("2d"); context.clearRect(0,0,100,100); context.setFillColor(red,green,blue,1.0); context.fillRect(0,0,100,100); } // --> </script> Next, the HTML source, where I have my canvas tags and some embedded Javascript to call my drawCanvas function <canvas id="canvas0" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"><!-- drawCanvas(0,250,0,0); // --> </script> . . //more source . <canvas id="canvas1" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"><!-- drawCanvas(1,4,250,6); // --> </script> Also provided is a screenshot. As you can see, the "red" canvas comes up just fine, but the second one, which should be green, doesn't show up at all. Any ideas?

    Read the article

  • Problems using (building?) native gem extensions on OS X

    - by goodmike
    I am having trouble with some of my rubygems, in particular those that use native extensions. I am on a MacBookPro, with Snow Leopard. I have XCode 3.2.1 installed, with gcc 4.2.1. Ruby 1.8.6, because I'm lazy and a scaredy cat and don't want to upgrade yet. Ruby is running in 32-bit mode. I built this ruby from scratch when my MBP ran OSX 10.4. When I require one of the affected gems in irb, I get a Load Error for the gem extension's bundle file. For example, here's nokogigi dissing me: > require 'rubygems' = true > require 'nokogiri' LoadError: Failed to load /usr/local/lib/ruby/gems/1.8/gems/nokogiri-1.4.1/lib/nokogiri/nokogiri.bundle This is also happening with the Postgres pg and MongoDB mongo gems. My first thought was that the extensions must not be building right. But gem install wasn't throwing any errors. So I reinstalled with the verbose flag, hoping to see some helpful warnings. I've put the output in a Pastie, and the only warning I see is a consistent one about "passing argument n of ‘foo’ with different width due to prototype." I suspect that this might be an issue from upgrading to Snow Leopard, but I'm a little surprised to experience it now, since I've updated my XCode. Could it stem from running Ruby in 1.8.6? I'm embarrassed that I don't know quite enough about my Mac and OSX to know where to look next, so any guidance, even just a pointer to some document I couldn't find via Google, would be most welcome. Michael

    Read the article

  • Divs, flash and doctype :(

    - by nick
    I have a web-site, that uses colorbox, it also has flash header. Everything works fine in both ff and ie. Before ive started to use colorbox, i had little div that covered small part of flash header for menu purposes. Now, since im using colorbox, i had to declare doctype, and set wmode on flash to 'opaque', in order everything to work right way.But now i cant get that little div, to appear on top of my flash header. If anyone can help me with this, please do so.... or atleast tell me what should i read : ( im will be very gratefull for any solution. current html document structure: ... all the js and css files ... heres that div's style from corresponding css file: .cell_r0_c0{position: absolute;left: 61%;width:260;height:69; background-color: #000000; vertical-align: bottom;} I think i've allready tried all the combinations of position attribute, also tried diff z-index values, and i can't get it work the way i want. Maybe ive missed something idk. Please help me :(

    Read the article

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Making a jQuery plugin to feed Tumblr to site

    - by tylorreimer
    I have some experience with PHP and a little with JS but I'm far from anything proficient. I'm trying to make a jQuery plugin for my site that I can call in my HTML via something like this: $('.new').tumble({username: "tylor", count: 9}); Which would basically put the Tumblr list the code should make into the DIV with class 'new' in this case. Here is my code so far; the problem seems to be how to get it to pick up class/id from the original call (in the HTML) and use that in the jQuery. Here's the code so far: (function($) { $.fn.tumble = function(options){ var settings = $.extend({ username: null, // [string or array] required to get url for tumblr account count: 3, // [integer] how many posts to display? }, options); //url construction var url = "http://" + settings.username + ".tumblr.com"; var jsonurl = url + "/api/read/json?num=" + settings.count + "&callback=?"; $.getJSON(jsonurl, function(data) { var items = []; $.each(data.posts, function(id, url) { // Goes over each post in the JSON document retrieved from data URL var url = this.url; // Just assigns a variable to the url to avoid constantly writing "this.whatever" var photourl = this['photo-url-250']; // photo-url-xxx needs to be called this way due to integers in the name items.push('<li><a href="' + url + '">' + photourl + '</a></li>'); }); $('<ul/>', { // Creates an empty list html: items.join('') // Takes the values in the item array and puts 'em together }).appendTo('.new'); // I don't want this to have the class set in the jQuery itself }); //end json }; })( jQuery ); Any help you can lend would be wonderful. Thank you

    Read the article

  • Validate a XDocument against schema without the ValidationEventHandler (for use in a HTTP handler)

    - by Vaibhav Garg
    Hi everyone, (I am new to Schema validation) Regarding the following method, System.Xml.Schema.Extensions.Validate( ByVal source As System.Xml.Linq.XDocument, ByVal schemas As System.Xml.Schema.XmlSchemaSet, ByVal validationEventHandler As System.Xml.Schema.ValidationEventHandler, ByVal addSchemaInfo As Boolean) I am using it as follows inside a IHttpHandler - Try Dim xsd As XmlReader = XmlReader.Create(context.Server.MapPath("~/App_Data/MySchema.xsd")) Dim schemas As New XmlSchemaSet() : schemas.Add("myNameSpace", xsd) : xsd.Close() myXDoxumentOdj.Validate(schemas, Function(s As Object, e As ValidationEventArgs) SchemaError(s, e, context), True) Catch ex1 As Threading.ThreadAbortException 'manage schema error' Return Catch ex As Exception 'manage other errors' End Try The handler- Function SchemaError(ByVal s As Object, ByVal e As ValidationEventArgs, ByVal c As HttpContext) As Object If c Is Nothing Then c = HttpContext.Current If c IsNot Nothing Then HttpContext.Current.Response.Write(e.Message) HttpContext.Current.Response.End() End If Return New Object() End Function This is working fine for me at present but looks very weak. I do get errors when I feed it bad XML. But i want to implement it in a more elegant way. This looks like it would break for large XML etc. Is there some way to validate without the handler so that I get the document validated in one go and then deal with errors? To me it looks Async such that the call to Validate() would pass and some non deterministic time later the handler would get called with the result/errors. Is that right? Thanks and sorry for any goofy mistakes :).

    Read the article

  • Display X divs randomly out of a possible Y.

    - by Jordan
    How do I randomly display 3 divs out of a possible 10 in total? This is what I have tried so far: HTML: <div id="1">Content 1</div> <div id="2">Content 2</div> <div id="3">Content 3</div> <div id="4">Content 4</div> <div id="5">Content 5</div> <div id="6">Content 6</div> Javascript: function randomiseDiv() { // Define how many divs we have var divCount = 6; // Get our random ID (based on the total above) var randomId = Math.floor(Math.random()*divCount+1); // Get the div that's been randomly selectted var chosenDiv= document.getElementById(randomId); // If the content is available on the page if (chosenDiv) { // Update the display chosenDiv.style.display = 'block'; } } window.onload = randomiseDiv; I would prefer a PHP solution, although anything at this stage would be beneficial.

    Read the article

  • Choosing a W3C valid DOCTYPE and charset combination?

    - by George Carter
    I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

    Read the article

  • Fixed div once page is scrolled is flickering

    - by jasondavis
    I am trying to have an advertisement block/div that will be hald way down the page, once you scroll do the page to this point it will stick to the top. Here is a demo of what I am trying to do and the code I am using to do it with... http://jsfiddle.net/jasondavis/6vpA7/3/embedded/result/ In the demo it works perfectly how I am wanting it to be, however when I implement it on my live site, http://goo.gl/zuaZx it works but when you scroll down the div flickers in and out of view on each scroll or down key press. On my site to see the problem live it is the blokc on the right sidebar that says "Recommended Books" Here is the code I am using... $(document).ready( function() { $(window).scroll( function() { if ($(window).scrollTop() > $('#social-container').offset().top) $('#social').addClass('floating'); else $('#social').removeClass('floating'); } ); } );? css #social.floating { position: fixed; top: 0; }? My demo jsfiddle where it works correctly http://jsfiddle.net/jasondavis/6vpA7/3/ The only thing different on my live site is the div/id name is different. As you can see it is somewhat working on my live site except the flickering in and out of view as you scroll down the page. Anyone have any ideas why this would happen on my live site and not on my jsfiddle demo?

    Read the article

  • pdf external streams in Max OS X Preview

    - by olpa
    According to the specification, a part of a PDF document can reside in an external file. An example for an image: 2 0 obj << /Type /XObject /Subtype /Image /Width 117 /Height 117 /BitsPerComponent 8 /Length 0 /ColorSpace /DeviceRGB /FFilter /DCTDecode /F (pinguine.jpg) >> stream endstream endobj I found that this functionality does work in Adobe Acrobat 5.0 for Windows (sample PDF with the image), also I managed to view this file in Adobe Acrobat Reader 8.1.3 for Mac OS X after I found the setting "Allow external content". Unfortunately, it seems that non-Adobe tools ignore the external stream feature. I hope I'm wrong, therefore ask the question: How to enable external streams in Mac OS X? (I think that all the system Mac OS X tools use the same library, therefore say "Mac OS X" instead of "Preview".) Or maybe there could be a programming hook to emulate external streams? My task is: store a big set of images (total ˜300Mb) outside of a small PDF (˜1Mb). At some moment, I want to filter PDF through a quartz filter and get a PDF with the images embedded. Any suggestions are welcome.

    Read the article

  • ASP.NET - Webservice not being called from javascript

    - by Robert
    Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

    Read the article

  • Problem executing trackPageview with Google Analytics.

    - by dmrnj
    I'm trying to capture the clicks of certain download links and track them in Google Analytics. Here's my code var links = document.getElementsByTagName("a"); for (var i = 0; i < links.length; i++) { linkpath = links[i].pathname; if( linkpath.match(/\.(pdf|xls|ppt|doc|zip|txt)$/) || links[i].href.indexOf("mode=pdf") >=0 ){ //this matches our search addClickTracker(links[i]); } } function addClickTracker(obj){ if (obj.addEventListener) { obj.addEventListener('click', track , true); } else if (obj.attachEvent) { obj.attachEvent("on" + 'click', track); } } function track(e){ linkhref = (e.srcElement) ? e.srcElement.pathname : this.pathname; pageTracker._trackPageview(linkhref); } Everything up until the pageTracker._trackPageview() call works. In my debugging linkhref is being passed fine as a string. No abnormal characters, nothing. The issue is that, watching my http requests, Google never makes a second call to the tracking gif (as it does if you call this function in an "onclick" property). Calling the tracker from my JS console also works as expected. It's only in my listener. Could it be that my listener is not deferring the default action (loading the new page) before it has a chance to contact Google's servers? I've seen other tracking scripts that do a similar thing without any deferral.

    Read the article

  • jQuery noobie can't make a checked checkbox show an alert.

    - by Kyle Sevenoaks
    I found this answer before, to fire an alert if the button is pressed but the checkbox isn't checked. Why won't this work? <input value="1" type="checkbox" name="salgsvilkar" ID="checkbox2" style="float:left;" onclick="document.getElementById('scrollwrap').style.cssText='border-color:#85c222; background-color:#E5F7C7;';" /><label for="checkbox2" class="akslabel">Salgs og leveringsvilkår er lest og akseptert</label> </span> {literal} <script type="text/javascript"> $(function() { //checkbox $("#checkbox2").click(function(){ //if this... //alert("this")... if($("#checkbox2").is(':checked')) { alert("im checked"); } }); //button $("#fullfor_btn").click(function(e){ if(!$("#checkbox2").is(':checked')) { alert("you did not check the agree to terms..."); e.preventDefault(); } }); } </script> {/literal} This on another .tpl: <label></label> <button type="submit" class="submit" name="{$method}" id="fullfor_btn" title="Fullfør bestillingen nå" value="">&nbsp;</button> What could be going wrong? The jQuery doesn't fire anything at all.

    Read the article

  • increase number of photos from flickr using json

    - by Andrew Welch
    Hi this is my code: Is is possible to get more photos from flickr. What is the standard / default number? $(document).ready(function(){ $.getJSON("http://api.flickr.com/services/feeds/photos_public.gne?id=48719970@N07&lang=en-us&format=json&jsoncallback=?", function(data){ $.each(data.items, function(i, item){ var newurl = 'url(' + item.media.m + ')'; $("<div class='images'/>").css('background', newurl).css('backgroundPosition','top center').css('backgroundRepeat','no-repeat').appendTo("#images").wrap("<a target=\"_blank\ href='" + item.link + "'></a>"); }) $("#title").html(data.title); $("#description").html(data.description); $("#link").html("<a href='" + data.link + "' target=\"_blank\">Visit the Viget Inspiration Pool!</a>"); //Notice that the object here is "data" because that information sits outside of "items" in the JSON feed $('.jcycleimagecarousel').cycle({ fx: 'fade', speed: 300, timeout: 3000, next: '#next', prev: '#prev', pause: 1, random: 1 }); }); });

    Read the article

  • Calling jQuery method from onClick attribute in HTML

    - by Russell
    I am relatively new to implementing JQuery throughout an entire system, and I am enjoying the opportunity. I have come across one issue I would love to find the correct resolve for. Here is a simple case example of what I want to do: I have a button on a page, and on the click event I want to call a jquery function I have defined. Here is the code I have used to define my method (Page.js): (function($) { $.fn.MessageBox = function(msg) { alert(msg); }; }); And here is my HTML page: <HTML> <head> <script type="text/javascript" src="C:\Sandpit\jQueryTest\jquery-1.3.2.js"></script> <script language="javascript" src="Page.js"></script> </head> <body> <div class="Title">Welcome!</div> <input type="button" value="ahaha" onclick="$().MessageBox('msg');" /> </body> </HTML> (The above code displays the button, but clicking does nothing.) I am aware I could add the click event in the document ready event, however it seems more maintainable to put events in the HTML element instead. However I have not found a way to do this. Is there a way to call a jquery function on a button element (or any input element)? Or is there a better way to do this? Thanks

    Read the article

  • Trouble determining onclick's target

    - by pwseo
    I've tried and tried... and I can't seem to make this work in IE (tested version 6) Can anybody help me? IE complains about an error but refuses to tell which error it is... var a = document.getElementsByTagName("a"); for (i = 0; i < a.length; i++) { if (a[i].getAttribute("class") == "info-link") { a[i].onclick = function(e) { e = e || window.event; var target = e.srcElement || e.target; var info = target.parentNode.getElementsByTagName("div")[0]; if (info.style.display == "none" || info.style.display == "") { info.style.display = "block"; } else { info.style.display = "none"; } return false; } } } <div class="auxdata"> <a href="#" class="info-link">Esta questão possuí dados anexos. Clique para ver.</a> <div style="display: none;" class="info-inner"> <!-- variable stuff here --> </div> </div>

    Read the article

  • How do I get NHibernate to work with .NET Framework 2.0?

    - by Daniel Dolz
    I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

    Read the article

< Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >