Search Results

Search found 15860 results on 635 pages for 'document oriented databas'.

Page 549/635 | < Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >

  • Apache won't accept external requests

    - by Eric
    I am running Apache 2.2 on windows and I would like to access it remotely. Currently I can only access it from my local machine. I know the problem is not port forwarding because I tested it with other web servers (written in python). My httpd.conf file is below. I installed apache with the PHP installer. # # This is the main Apache HTTP server configuration file. It contains the # configuration directives that give the server its instructions. # See <URL:http://httpd.apache.org/docs/2.2> for detailed information. # In particular, see # <URL:http://httpd.apache.org/docs/2.2/mod/directives.html> # for a discussion of each configuration directive. # # Do NOT simply read the instructions in here without understanding # what they do. They're here only as hints or reminders. If you are unsure # consult the online docs. You have been warned. # # Configuration and logfile names: If the filenames you specify for many # of the server's control files begin with "/" (or "drive:/" for Win32), the # server will use that explicit path. If the filenames do *not* begin # with "/", the value of ServerRoot is prepended -- so "logs/foo.log" # with ServerRoot set to "C:/Program Files (x86)/Apache Software Foundation/Apache2.2" will be interpreted by the # server as "C:/Program Files (x86)/Apache Software Foundation/Apache2.2/logs/foo.log". # # NOTE: Where filenames are specified, you must use forward slashes # instead of backslashes (e.g., "c:/apache" instead of "c:\apache"). # If a drive letter is omitted, the drive on which httpd.exe is located # will be used by default. It is recommended that you always supply # an explicit drive letter in absolute paths to avoid confusion. # # ServerRoot: The top of the directory tree under which the server's # configuration, error, and log files are kept. # # Do not add a slash at the end of the directory path. If you point # ServerRoot at a non-local disk, be sure to point the LockFile directive # at a local disk. If you wish to share the same ServerRoot for multiple # httpd daemons, you will need to change at least LockFile and PidFile. # ServerRoot "C:/Program Files (x86)/Apache Software Foundation/Apache2.2" # # Listen: Allows you to bind Apache to specific IP addresses and/or # ports, instead of the default. See also the <VirtualHost> # directive. # # Change this to Listen on specific IP addresses as shown below to # prevent Apache from glomming onto all bound IP addresses. # #Listen 12.34.56.78:80 Listen 80 # # Dynamic Shared Object (DSO) Support # # To be able to use the functionality of a module which was built as a DSO you # have to place corresponding `LoadModule' lines at this location so the # directives contained in it are actually available _before_ they are used. # Statically compiled modules (those listed by `httpd -l') do not need # to be loaded here. # # Example: # LoadModule foo_module modules/mod_foo.so # LoadModule actions_module modules/mod_actions.so LoadModule alias_module modules/mod_alias.so LoadModule asis_module modules/mod_asis.so LoadModule auth_basic_module modules/mod_auth_basic.so #LoadModule auth_digest_module modules/mod_auth_digest.so #LoadModule authn_alias_module modules/mod_authn_alias.so #LoadModule authn_anon_module modules/mod_authn_anon.so #LoadModule authn_dbd_module modules/mod_authn_dbd.so #LoadModule authn_dbm_module modules/mod_authn_dbm.so LoadModule authn_default_module modules/mod_authn_default.so LoadModule authn_file_module modules/mod_authn_file.so #LoadModule authnz_ldap_module modules/mod_authnz_ldap.so #LoadModule authz_dbm_module modules/mod_authz_dbm.so LoadModule authz_default_module modules/mod_authz_default.so LoadModule authz_groupfile_module modules/mod_authz_groupfile.so LoadModule authz_host_module modules/mod_authz_host.so #LoadModule authz_owner_module modules/mod_authz_owner.so LoadModule authz_user_module modules/mod_authz_user.so LoadModule autoindex_module modules/mod_autoindex.so #LoadModule cache_module modules/mod_cache.so #LoadModule cern_meta_module modules/mod_cern_meta.so LoadModule cgi_module modules/mod_cgi.so #LoadModule charset_lite_module modules/mod_charset_lite.so #LoadModule dav_module modules/mod_dav.so #LoadModule dav_fs_module modules/mod_dav_fs.so #LoadModule dav_lock_module modules/mod_dav_lock.so #LoadModule dbd_module modules/mod_dbd.so #LoadModule deflate_module modules/mod_deflate.so LoadModule dir_module modules/mod_dir.so #LoadModule disk_cache_module modules/mod_disk_cache.so #LoadModule dumpio_module modules/mod_dumpio.so LoadModule env_module modules/mod_env.so #LoadModule expires_module modules/mod_expires.so #LoadModule ext_filter_module modules/mod_ext_filter.so #LoadModule file_cache_module modules/mod_file_cache.so #LoadModule filter_module modules/mod_filter.so #LoadModule headers_module modules/mod_headers.so #LoadModule ident_module modules/mod_ident.so #LoadModule imagemap_module modules/mod_imagemap.so LoadModule include_module modules/mod_include.so LoadModule info_module modules/mod_info.so LoadModule isapi_module modules/mod_isapi.so #LoadModule ldap_module modules/mod_ldap.so #LoadModule logio_module modules/mod_logio.so LoadModule log_config_module modules/mod_log_config.so #LoadModule log_forensic_module modules/mod_log_forensic.so #LoadModule mem_cache_module modules/mod_mem_cache.so LoadModule mime_module modules/mod_mime.so #LoadModule mime_magic_module modules/mod_mime_magic.so LoadModule negotiation_module modules/mod_negotiation.so #LoadModule proxy_module modules/mod_proxy.so #LoadModule proxy_ajp_module modules/mod_proxy_ajp.so #LoadModule proxy_balancer_module modules/mod_proxy_balancer.so #LoadModule proxy_connect_module modules/mod_proxy_connect.so #LoadModule proxy_ftp_module modules/mod_proxy_ftp.so #LoadModule proxy_http_module modules/mod_proxy_http.so #LoadModule reqtimeout_module modules/mod_reqtimeout.so #LoadModule rewrite_module modules/mod_rewrite.so LoadModule setenvif_module modules/mod_setenvif.so #LoadModule speling_module modules/mod_speling.so #LoadModule ssl_module modules/mod_ssl.so LoadModule status_module modules/mod_status.so #LoadModule substitute_module modules/mod_substitute.so #LoadModule unique_id_module modules/mod_unique_id.so #LoadModule userdir_module modules/mod_userdir.so #LoadModule usertrack_module modules/mod_usertrack.so #LoadModule version_module modules/mod_version.so #LoadModule vhost_alias_module modules/mod_vhost_alias.so #LoadModule php5_module "c:/php/php5apache2_2.dll" <IfModule !mpm_netware_module> <IfModule !mpm_winnt_module> # # If you wish httpd to run as a different user or group, you must run # httpd as root initially and it will switch. # # User/Group: The name (or #number) of the user/group to run httpd as. # It is usually good practice to create a dedicated user and group for # running httpd, as with most system services. # User daemon Group daemon </IfModule> </IfModule> # 'Main' server configuration # # The directives in this section set up the values used by the 'main' # server, which responds to any requests that aren't handled by a # <VirtualHost> definition. These values also provide defaults for # any <VirtualHost> containers you may define later in the file. # # All of these directives may appear inside <VirtualHost> containers, # in which case these default settings will be overridden for the # virtual host being defined. # # # ServerAdmin: Your address, where problems with the server should be # e-mailed. This address appears on some server-generated pages, such # as error documents. e.g. [email protected] # ServerAdmin [email protected] # # ServerName gives the name and port that the server uses to identify itself. # This can often be determined automatically, but we recommend you specify # it explicitly to prevent problems during startup. # # If your host doesn't have a registered DNS name, enter its IP address here. # #ServerName :80 # # DocumentRoot: The directory out of which you will serve your # documents. By default, all requests are taken from this directory, but # symbolic links and aliases may be used to point to other locations. # DocumentRoot "C:/Program Files (x86)/Apache Software Foundation/Apache2.2/htdocs" # # Each directory to which Apache has access can be configured with respect # to which services and features are allowed and/or disabled in that # directory (and its subdirectories). # # First, we configure the "default" to be a very restrictive set of # features. # <Directory /> Options FollowSymLinks AllowOverride None Order deny,allow Allow from all </Directory> # # Note that from this point forward you must specifically allow # particular features to be enabled - so if something's not working as # you might expect, make sure that you have specifically enabled it # below. # # # This should be changed to whatever you set DocumentRoot to. # <Directory "C:/Program Files (x86)/Apache Software Foundation/Apache2.2/htdocs"> # # Possible values for the Options directive are "None", "All", # or any combination of: # Indexes Includes FollowSymLinks SymLinksifOwnerMatch ExecCGI MultiViews # # Note that "MultiViews" must be named *explicitly* --- "Options All" # doesn't give it to you. # # The Options directive is both complicated and important. Please see # http://httpd.apache.org/docs/2.2/mod/core.html#options # for more information. # Options Indexes FollowSymLinks # # AllowOverride controls what directives may be placed in .htaccess files. # It can be "All", "None", or any combination of the keywords: # Options FileInfo AuthConfig Limit # AllowOverride All # # Controls who can get stuff from this server. # Order deny,allow Allow from all </Directory> # # DirectoryIndex: sets the file that Apache will serve if a directory # is requested. # <IfModule dir_module> DirectoryIndex index.html index.php index.phtml index.htm default.html default.php default.phtml default.htm </IfModule> # # The following lines prevent .htaccess and .htpasswd files from being # viewed by Web clients. # <FilesMatch "^\.ht"> Order allow,deny Deny from all Satisfy All </FilesMatch> # # ErrorLog: The location of the error log file. # If you do not specify an ErrorLog directive within a <VirtualHost> # container, error messages relating to that virtual host will be # logged here. If you *do* define an error logfile for a <VirtualHost> # container, that host's errors will be logged there and not here. # ErrorLog "logs/error.log" # # LogLevel: Control the number of messages logged to the error_log. # Possible values include: debug, info, notice, warn, error, crit, # alert, emerg. # LogLevel warn <IfModule log_config_module> # # The following directives define some format nicknames for use with # a CustomLog directive (see below). # LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\"" combined LogFormat "%h %l %u %t \"%r\" %>s %b" common <IfModule logio_module> # You need to enable mod_logio.c to use %I and %O LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\" %I %O" combinedio </IfModule> # # The location and format of the access logfile (Common Logfile Format). # If you do not define any access logfiles within a <VirtualHost> # container, they will be logged here. Contrariwise, if you *do* # define per-<VirtualHost> access logfiles, transactions will be # logged therein and *not* in this file. # CustomLog "logs/access.log" common # # If you prefer a logfile with access, agent, and referer information # (Combined Logfile Format) you can use the following directive. # #CustomLog "logs/access.log" combined </IfModule> <IfModule alias_module> # # Redirect: Allows you to tell clients about documents that used to # exist in your server's namespace, but do not anymore. The client # will make a new request for the document at its new location. # Example: # Redirect permanent /foo http:///bar # # Alias: Maps web paths into filesystem paths and is used to # access content that does not live under the DocumentRoot. # Example: # Alias /webpath /full/filesystem/path # # If you include a trailing / on /webpath then the server will # require it to be present in the URL. You will also likely # need to provide a <Directory> section to allow access to # the filesystem path. # # ScriptAlias: This controls which directories contain server scripts. # ScriptAliases are essentially the same as Aliases, except that # documents in the target directory are treated as applications and # run by the server when requested rather than as documents sent to the # client. The same rules about trailing "/" apply to ScriptAlias # directives as to Alias. # ScriptAlias /cgi-bin/ "C:/Program Files (x86)/Apache Software Foundation/Apache2.2/cgi-bin/" </IfModule> <IfModule cgid_module> # # ScriptSock: On threaded servers, designate the path to the UNIX # socket used to communicate with the CGI daemon of mod_cgid. # #Scriptsock logs/cgisock </IfModule> # # "C:/Program Files (x86)/Apache Software Foundation/Apache2.2/cgi-bin" should be changed to whatever your ScriptAliased # CGI directory exists, if you have that configured. # <Directory "C:/Program Files (x86)/Apache Software Foundation/Apache2.2/cgi-bin"> AllowOverride None Options None Order allow,deny Allow from all </Directory> # # DefaultType: the default MIME type the server will use for a document # if it cannot otherwise determine one, such as from filename extensions. # If your server contains mostly text or HTML documents, "text/plain" is # a good value. If most of your content is binary, such as applications # or images, you may want to use "application/octet-stream" instead to # keep browsers from trying to display binary files as though they are # text. # DefaultType text/plain <IfModule mime_module> # # TypesConfig points to the file containing the list of mappings from # filename extension to MIME-type. # TypesConfig conf/mime.types # # AddType allows you to add to or override the MIME configuration # file specified in TypesConfig for specific file types. # #AddType application/x-gzip .tgz # # AddEncoding allows you to have certain browsers uncompress # information on the fly. Note: Not all browsers support this. # #AddEncoding x-compress .Z #AddEncoding x-gzip .gz .tgz # # If the AddEncoding directives above are commented-out, then you # probably should define those extensions to indicate media types: # AddType application/x-compress .Z AddType application/x-gzip .gz .tgz # # AddHandler allows you to map certain file extensions to "handlers": # actions unrelated to filetype. These can be either built into the server # or added with the Action directive (see below) # # To use CGI scripts outside of ScriptAliased directories: # (You will also need to add "ExecCGI" to the "Options" directive.) # #AddHandler cgi-script .cgi # For type maps (negotiated resources): #AddHandler type-map var # # Filters allow you to process content before it is sent to the client. # # To parse .shtml files for server-side includes (SSI): # (You will also need to add "Includes" to the "Options" directive.) # #AddType text/html .shtml #AddOutputFilter INCLUDES .shtml AddType application/x-httpd-php .php AddType application/x-httpd-php .phtml </IfModule> # # The mod_mime_magic module allows the server to use various hints from the # contents of the file itself to determine its type. The MIMEMagicFile # directive tells the module where the hint definitions are located. # #MIMEMagicFile conf/magic # # Customizable error responses come in three flavors: # 1) plain text 2) local redirects 3) external redirects # # Some examples: #ErrorDocument 500 "The server made a boo boo." #ErrorDocument 404 /missing.html #ErrorDocument 404 "/cgi-bin/missing_handler.pl" #ErrorDocument 402 http:///subscription_info.html # # # EnableMMAP and EnableSendfile: On systems that support it, # memory-mapping or the sendfile syscall is used to deliver # files. This usually improves server performance, but must # be turned off when serving from networked-mounted # filesystems or if support for these functions is otherwise # broken on your system. # #EnableMMAP off #EnableSendfile off # Supplemental configuration # # The configuration files in the conf/extra/ directory can be # included to add extra features or to modify the default configuration of # the server, or you may simply copy their contents here and change as # necessary. # Server-pool management (MPM specific) #Include conf/extra/httpd-mpm.conf # Multi-language error messages #Include conf/extra/httpd-multilang-errordoc.conf # Fancy directory listings #Include conf/extra/httpd-autoindex.conf # Language settings #Include conf/extra/httpd-languages.conf # User home directories #Include conf/extra/httpd-userdir.conf # Real-time info on requests and configuration #Include conf/extra/httpd-info.conf # Virtual hosts #Include conf/extra/httpd-vhosts.conf # Local access to the Apache HTTP Server Manual #Include conf/extra/httpd-manual.conf # Distributed authoring and versioning (WebDAV) #Include conf/extra/httpd-dav.conf # Various default settings #Include conf/extra/httpd-default.conf # Secure (SSL/TLS) connections #Include conf/extra/httpd-ssl.conf # # Note: The following must must be present to support # starting without SSL on platforms with no /dev/random equivalent # but a statically compiled-in mod_ssl. # <IfModule ssl_module> SSLRandomSeed startup builtin SSLRandomSeed connect builtin </IfModule> #PHPIniDir "c:/php" #BEGIN PHP INSTALLER EDITS - REMOVE ONLY ON UNINSTALL PHPIniDir "C:/PHP/" LoadModule php5_module "C:/PHP/php5apache2_2.dll" #END PHP INSTALLER EDITS - REMOVE ONLY ON UNINSTALL P.S sorry for the shortness of this post. I am in a rush

    Read the article

  • curl post picture multipart/form-data, php cURL need help!

    - by user331071
    I'm trying to upload a picture to a specific website using php cURL but I don't really understand what parameters do I need to send because the data looks a bit weird . Here is what i got with the http analyzer Type : multipart/form-data; boundary=---------------------------182983931283 -----------------------------182983931283 Content-Disposition: form-data; name="file"; filename="Blue hills.jpg" Content-Type: image/jpeg Here appears the souce of the image itself like "ÿØÿàÿØÿàÿØÿàÿØÿàÿØÿàÿØÿà" -----------------------------182983931283 Content-Disposition: form-data; name="action" images -----------------------------182983931283 Content-Disposition: form-data; name="anonymous_email" Y -----------------------------182983931283 Content-Disposition: form-data; name="site_id" 1 -----------------------------182983931283 and so on other parameters. The issue that I have is that I don't understand what is the boundary, where do I get it from (because it doesn't appear in the html document that generates the POST and how should I make the post . If you would give me a simple example to post the above parameters to http://example.com I will definitely get the trick . Currently I'm using the following function to make the post : function processPicturesPage($title, $price, $numbedrooms, $description) { //Set the login parameters and initiate the Login process $fields = array( "changedImages" = "", "site_id" = "1", "posting_id" = "", "current_live_date" = "", "images_loaded" = "", "image_actions" = "", "title" = $title, ); foreach($fields as $key=$value) { $fields_string .= $key.'='.$value.'&'; } rtrim($fields_string,'&'); $URL = "http://www.example.com/cgi-bin/add_posting.pl"; return $this-processCurlrequest($URL, count($fields), $fields_string); } and in the processCurlrequest I have the curl options (cookies etc) and url .

    Read the article

  • Issue reading in a cell from Excel with Apache POI

    - by Nick
    I am trying to use Apache POI to read in old (pre-2007 and XLS) Excel files. My program goes to the end of the rows and iterates back up until it finds something that's not either null or empty. Then it iterates back up a few times and grabs those cells. This program works just fine reading in XLSX and XLS files made in Office 2010. I get the following error message: Exception in thread "main" java.lang.NumberFormatException: empty String at sun.misc.FloatingDecimal.readJavaFormatString(Unknown Source) at java.lang.Double.parseDouble(Unknown Source) at the line: num = Double.parseDouble(str); from the code: str = cell.toString(); if (str != "" || str != null) { System.out.println("Cell is a string"); num = Double.parseDouble(str); } else { System.out.println("Cell is numeric."); num = cell.getNumericCellValue(); } where the cell is the last cell in the document that's not empty or null. When I try to print the first cell that's not empty or null, it prints nothing, so I think I'm not accessing it correctly.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Convert XML to TCL Object

    - by pws5068
    Greetings, I'm new to TCL scripting, and I have a very very basic xml file which I need to import information from into tcl. Example of XML Document Structure: <object> <type>Hardware</type> <name>System Name</name> <description>Basic Description of System.</description> <attributes> <vendor>Dell</vendor> <contract>MM/DD/YY</contract> <supportExpiration>MM/DD/YY</supportExpiration> <location>Building 123</location> <serial>xxx-xxx-xxxx</serial> <mac>some-mac-address</mac> </attributes> </object> Etc... I've seen something called TCLXML but I'm not sure if this is the best route or even how to create the package to use it.. Any help will be greatly appreciated.

    Read the article

  • how to run click function after default behaviour of a element

    - by Somebody is in trouble
    My code <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /> <title>Untitled Document</title> <script src="jquery.js"></script> <script> $(function(){ $("body").on("click",".mes_sel",function(){ if($(".mes_sel:checked").length==0){ alert("Checked"); } else alert("Not Checked"); }); }); </script></head> <body> <input type="checkbox" class="mes_sel"> </body> </html> It is alerting checked when the textbox is unchecked because onclick is running before the checking of checkbox.How can i make the click event to run after checking/unchecking of the input

    Read the article

  • Servlet receiving data both in ISO-8859-1 and UTF-8. How to URL-decode?

    - by AJPerez
    I've a web application (well, in fact is just a servlet) which receives data from 3 different sources: Source A is a HTML document written in UTF-8, and sends the data via <form method="get">. Source B is written in ISO-8859-1, and sends the data via <form method="get">, too. Source C is written in ISO-8859-1, and sends the data via <a href="http://my-servlet-url?param=value&param2=value2&etc">. The servlet receives the request params and URL-decodes them using UTF-8. As you can expect, A works without problems, while B and C fail (you can't URL-decode in UTF-8 something that's encoded in ISO-8859-1...). I can make slight modifications to B and C, but I am not allowed to change them from ISO-8859-1 to UTF-8, which would solve all the problems. In B, I've been able to solve the problem by adding accept-charset="UTF-8" to the <form>. So the <form> sends the data in UTF-8 even with the page being ISO. What can I do to fix C? Alternatively, is there any way to determine the charset on the servlet, so I can call URL-decode with the right encoding in each case?

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • Sharepoint user details not visible to other users

    - by richardoz
    I am managing a SharePoint site that uses Form Based Authentication. We have several generic lists, document libraries and active task lists that users can create update and delete. Users can use the people pickers to select/search for everyone. But the users cannot see other users names, email addresses etc. in display lists or the people pickers. If I log in as the site collection administrator, I can see everyones details. So I know the data is available. Updated details on this problem (non-administrators) SharePoint users cannot see other users information. Example: User A assigns a task to user B. User A creates a new task and uses the people picker to find user B. User B is only visible by the login name “bname” and any information about user B is not visible or searchable within the people picker. Once user B is assigned the task, user A no longer sees the name in the task list – even though user A created it. No modified by, created by, assigned to or owner field data is visible to non-administrator users. Facts: Extranet site is configured to use Forms Based Authentication. Intranet uses windows based authentication Users of both the intranet and extranet have the same problem All databases are local The site uses SSRS integration SharePoint WSS on Windows 2003 Std -- After activating the verbose logging it looks like SharePoint is definately asking SQL server for only the user info for the currently logged in user: SELECT TOP 6 /lots-of-columns/ FROM UserData INNER MERGE JOIN Docs AS t1 ON ( 1 = 1 AND UserData.[tp_RowOrdinal] = 0 AND t1.SiteId = UserData.tp_SiteId AND t1.SiteId = @L2 AND t1.DirName = UserData.tp_DirName AND t1.LeafName = UserData.tp_LeafName AND t1.Level = UserData.tp_Level AND t1.IsCurrentVersion = 1 AND (1 = 1) ) LEFT OUTER JOIN AllUserData AS t2 ON ( UserData.[tp_Author]=t2.[tp_ID] AND UserData.[tp_RowOrdinal] = 0 AND t2.[tp_RowOrdinal] = 0 AND ( (t2.tp_IsCurrent = 1) ) AND t2.[tp_CalculatedVersion] = 0 AND t2.[tp_DeleteTransactionId] = 0x AND t2.tp_ListId = @L3 AND UserData.tp_ListId = @L4 AND t2.[tp_Author]=162 /* this is the currently logged in user */ ) WHERE (UserData.tp_IsCurrent = 1) AND UserData.tp_SiteId=@L2 AND (UserData.tp_DirName=@DN) AND UserData.tp_RowOrdinal=0 AND ( ( (UserData.[datetime1] IS NULL ) OR (UserData.[datetime1] = @L5DTP) ) AND t1.SiteId=@L2 AND (t1.DirName=@DN) ) ORDER BY UserData.[tp_Modified] Desc, UserData.[tp_ID] Asc Again, any ideas would be appreciated.

    Read the article

  • How can click on a java show link programatically?

    - by Jules
    I'm trying to develop a new feature for our vb.net order entry system. At the moment I provide an assisted paypal login which loops through transactions and copies the transactions. My program then looks at this data and copies it into text boxes. The operator then approves and saves the record. So my code uses IHTMLFormElement and loops round form elements and adds values. However I only really use this to log in to paypal. See my code... Dim theObject As Object = Nothing theObject = "https://www.paypal.com/cgi-bin/webscr?cmd=_login-run" WebBrowPayPal.AxWebBrowser1.Navigate2(theObject) While WebBrowPayPal.AxWebBrowser1.ReadyState <> tagREADYSTATE.READYSTATE_COMPLETE Application.DoEvents() End While Dim HtmlDoc As IHTMLDocument2 = CType(WebBrowPayPal.AxWebBrowser1.Document, IHTMLDocument2) Dim FormCol As IHTMLElementCollection = HtmlDoc.forms Dim iForms As Integer = FormCol.length Dim i As Integer Dim x As Integer For i = 0 To iForms - 1 Dim oForm As IHTMLFormElement = CType(FormCol.item(CType(i, Object), CType(i, Object)), IHTMLFormElement) For x = 0 To oForm.length - 1 If oForm.elements(x).tagname = "INPUT" Then If oForm.elements(x).name = "login_email" Then oForm.elements(x).value = "[email protected]" End If If oForm.elements(x).name = "login_password" Then oForm.elements(x).value = "mypassword" End If If oForm.elements(x).type = "submit" Or _ oForm.elements(x).type = "SUBMIT" Then oForm.elements(x).click() End If End If Next Next i I'm now trying this page https://www.paypal.com/uk/cgi-bin/webscr?cmd=_history&nav=0.3.0 Which is the history page, which allows you to search on the paypal transaction id. Unfortunately you need to click on 'find a transaction' which then uses some javascript to shows the post fields. So the problem is that the fields I need to use are hidden. How can I click on this java link in code ?

    Read the article

  • JQuery date picker does not firing in ajax page using Rails

    - by prabu
    Hi Here I have using datepicker from JQueryUI in my public/javascript folder as effects,prototype,control,dragdrop js files. in my public folder contains jqueryui development buddle. (css,js,development-bundle) in layout/application.rhtml <%= stylesheet_link_tag 'application' %> <%=javascript_include_tag :defaults%> <%= stylesheet_link_tag '/jquery-ui/css/custom-theme/jquery-ui-1.8.1.custom.css' %> <%=javascript_include_tag "/jquery-ui/js/jquery-1.4.2.min.js"%> <%=javascript_include_tag "/jquery-ui/js/jquery-ui-1.8.1.custom.min.js"%> <script> $(document).ready(function(){ var $j=jQuery.noConflict(); $j( '#date' ).datepicker({ dateFormat: 'dd-mm-yy' }); }); </script> in home/index.rhtml <%title "Home"%> <%=link_to "Add Details" ,:action=>"add"%> <%=link_to_remote "Ajax Add Details", :update=>"add" , :url=>{ :action=>"add" }%> <div id='add' /> in home/add.rhtml <%title "Add details"%> <%form_tag :action=>"create" do%> Name : <%=text_field_tag "name" ,"",:size=>15%> DOB : <%=text_field_tag "dob","",:id=>"date"%> <%=submit_tag "Save"%> <%end%> the datepicker works when I run home/add.rhtml directly but the datepicker not work when i run ajax page home/index.rhtml Any solutions for that,????

    Read the article

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • jquery animate from object center

    - by mtwallet
    Hi. I am trying to create a product viewer similar to the one at the bottom of this page http://www.logitech.com/en-gb/. As you can see the product animates from the center rather than top left which I think is Jquery's default. So what I am doing is trying animate the width and height and then also the offset to make it look like it animates from the center. My code looks like this: <style> body { background: black; } .box { background: #fff url('pic.jpg') no-repeat 0 0; width: 200px; height: 200px; margin: 10px 4%; float: left; } </style> <script type="text/javascript"> $(document).ready(function() { $(".box").hover(function() { $(".box").not(this).fadeTo(500, 0.5); $(this).animate({ width: 300, height: 300, left: -100, top: -100 }, 500); }, function() { $(this).animate({ width: 200, height: 200, left: 100, top: 100 }, 500); $(".box").fadeTo(500, 1); }); }); </script> I cannot seem to get this working as I want. Can anyone help with this or suggest a better technique? Many thanks

    Read the article

  • php not redirecting

    - by NSchulze
    I'm trying to write the logout of a website. When I do this I want the page to redirect to the login page. I think I'm doing it the correct way, but can't get the right result. Could you guys point me in the right direction? Relevant Code: <button onclick="logout()">Logout</button> function logout() { var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { document.location=xmlhttp.responseText; } } xmlhttp.open("GET","logout.php",true); xmlhttp.send(); } <?php session_destroy(); header("Location:http://localhost:8888/loginns.html"); mysql_close($con); ?> Thanks!

    Read the article

  • jquery CSS doesn't work in webkit

    - by Mauro74
    I'm trying to apply some css to an image tag if the image is portrait, but for some reason .css() doesn't work in webkit. Basically the image tag doesn't get the 'style' property. Here's my code: $(document).ready(function () { $('.listing .item .thumb img').each(function () { var _img = $(this); var _imgWidth = _img.outerWidth(); var _imgHeight = _img.outerHeight(); if (_imgHeight > _imgWidth) { _img.css('top', '-40%'); } }); }); <div class="listing about"> <div class="item"> <a href="#" class="thumb"> <img src="../_uploads/siteassets/images/thumb-carousel-2.jpg" /> <span class="frame"></span> </a> <span class="snippet"> <a href="#" class="title">Name Surname</a> <span class="date">Role in the company</span> <p class="description">Lorem ipsum dolor sit amet...</p> </span> </div> </div> I've tried to use .attr() instead of .css() but nothing. It doesn't work! Any idea why?

    Read the article

  • ASP.NET - Webservice not being called from javascript

    - by Robert
    Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

    Read the article

  • Hidden youtube player loses its methods

    - by zaius
    I'm controlling a embedded youtube chromeless player with javascript, and I want to hide it occasionally by setting display: none. However, when I show the player again, it loses its youtube methods. For example: <script> swfobject.embedSWF("http://www.youtube.com/apiplayer?enablejsapi=1&playerapiid=player", "player", "425", "356", "8", null, null, {allowScriptAccess: "always"}, {id: 'player'} ); var player = null; function onYouTubePlayerReady(playerId) { player = document.getElementById(playerId); player.addEventListener('onStateChange', 'playerStateChanged'); } function hidePlayer() { player.pauseVideo(); player.style.display = 'none'; } function showPlayer() { player.style.display = 'block'; player.playVideo(); } </script> <a href="#" onClick="hidePlayer();">hide</a> <a href="#" onClick="showPlayer();">show</a> <div id="player"></div> Calling hidePlayer followed by showPlayer gives this error on the playVideo call: Uncaught TypeError: Object #<an HTMLObjectElement> has no method 'playVideo' The only solution I can find is to use visibility: hidden, but that is messing with my page layout. Any other solutions out there?

    Read the article

  • Solr/Lucene Scorer

    - by TFor
    We are currently working on a proof-of-concept for a client using Solr and have been able to configure all the features they want except the scoring. Problem is that they want scores that make results fall in buckets: Bucket 1: exact match on category (score = 4) Bucket 2: exact match on name (score = 3) Bucket 3: partial match on category (score = 2) Bucket 4: partial match on name (score = 1) First thing we did was develop a custom similarity class that would return the correct score depending on the field and an exact or partial match. The only problem now is that when a document matches on both the category and name the scores are added together. Example: searching for "restaurant" returns documents in the category restaurant that also have the word restaurant in their name and thus get a score of 5 (4+1) but they should only get 4. I assume for this to work we would need to develop a custom Scorer class but we have no clue on how to incorporate this in Solr. Another option is to create a custom SortField implementation similar to the RandomSortField already present in Solr. Maybe there is even a simpler solution that we don't know about. All suggestions welcome!

    Read the article

  • Javascript JQUERY AJAX: When Are These Implemented

    - by Michael Moreno
    I'm learning javascript. Poked around this excellent site to gather intel. Keep coming across questions / answers about javascript, JQUERY, JQUERY with AJAX, javascript with JQUERY, AJAX alone. My conclusion: these are all individually powerful and useful. My confusion: how does one determine which/which combination to use ? I've concluded that javascript is readily available on most browsers. For example, I can extend a simple HTML page with <html> <body> <script type="text/javascript"> document.write("Hello World!"); </script> </body> </html> However, within the scope of Python/DJANGO, many of these questions are JQUERY and AJAX related. At which point or under what development circumstances would I conclude that javascript alone isn't going to "cut it", and I need to implement JQUERY and/or AJAX and/or some other permutation ?

    Read the article

  • Testing approach for multi-threaded software

    - by Shane MacLaughlin
    I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

    Read the article

  • How to report progress of a JavaScript function?

    - by LambyPie
    I have a JavaScript function which is quite long and performs a number of tasks, I would like to report progress to the user by updating the contents of a SPAN element with a message as I go. I tried adding document.getElementById('spnProgress').innerText = ... statements throughout the function code. However, whilst the function is executing the UI will not update and so you only ever see the last message written to the SPAN which is not very helpful. My current solution is to break the task up into a number of functions, at the end of each I set the SPAN message and then "trigger" the next one with a window.setTimeout call with a very short delay (say 10ms). This yields control and allows the browser to repaint the SPAN with the updated message before starting the next step. However I find this very messy and difficult to follow the code, I'm thinking there must be a better way. Does anyone have any suggestions? Is there any way to force the SPAN to repaint without having to leave the context of the function? Thanks

    Read the article

  • radiobutton checked on condition in jquery

    - by RememberME
    I have the following fields: <label>Company Type:</label> <label for="primary"><input onclick="javascript: $('#sec').hide('slow');$('#primary_company').find('option:first').attr('selected','selected');" type="radio" runat="server" name="companyType" id="primary" />Primary</label> <label for="secondary"><input onclick="javascript: $('#sec').show('slow');" type="radio" runat="server" name="companyType" id="secondary" />Secondary</label> <div id="sec"> <fieldset> <label for="primary_company">Primary Company:</label> <%= Html.DropDownList("primary_company", Model.SelectPrimaryCompanies, "** Select Primary Company **") %> </fieldset> If there is a primary_company, then the secondary radio button should be selected. If there is no primary_company, then the primary radio button should be selected. Here is my jQuery: $(document).ready(function() { if ($('#primary_company').val().length > 0) { $('#secondary').attr({ checked: true }); } else { $("#primary").attr('checked', true ); $('#sec').hide(); } The sec div hides and shows properly, but a radio button is never selected. I've tried .attr('checked', 'checked') and .attr({ checked: true }) and .attr('checked', true) but nothing is ever selected.

    Read the article

  • What makes good web form styling for business applications?

    - by ProfK
    Styling forms (form elements) is something that even Eric Meyer prefers to avoid. However, most business forms, and that is where styling is at issue; 'contact us' forms are easy to style, put window estate at a premium, with more 'document level' (e.g. invoice) fields, plus 'detail level' (e.g. invoice line) fields. Factors I often find at play are: At my minimum, at least two horizontally adjacent fieldsets are required. In applications vs. public web pages, fixed positioning vs fluid layout is often better. Quantity of content is important, vs. exaggerated readability. Users know the system, and cues etc. take a back seat. In light of factors like these, is there any available guidence for styling web form based applications? Are there any CSS or JavaScript frameworks that would make my quest to style these applications better than Visual Studios still pathetic 'Auto-format' (what drugs were those people on? I will never take them.)

    Read the article

  • Reading JSON with Javascript/jQuery

    - by Josephine
    I'm building a game in javascript/html5 and I'm trying to build a database of locked doors in a maze that can be loaded from and overwritten to throughout gameplay. I've found a large number of tutorials online, but nothing is working. I was wondering if someone could look at what I'm trying and let me know what I'm doing wrong. My JSON file looks like this: { "doors": [ {"left":true, "right":false, "bottom":false}, {"left":false, "right":false, "bottom":false}, {"right":false, "bottom":false, "top":false}, {"left":false, "right":false, "top":false} ] } I want to build the HTML page so that when a player collides with a door it checks if its locked or not like: if (player.x < leftDoor.x + leftDoor.width && player.x + player.width > leftDoor.x && player.y < leftDoor.y + leftDoor.height && player.y + player.height > leftDoor.y) { if(doors[0].left == true) alert("door is locked"); else window.location = ( "2.html?p1="); } However I'm having trouble reading from the JSON file itself. I've tried things like: function loadJson() { $(document).ready(function() { $.getJSON('info.json', function(doors) { alert(doors[0].left); }); }); } But nothing happens, and I need to be able to access the information in the HTML as well. I'd rather use jQuery, but I'm not opposed to straight JS if it works. I've been trying to do this for ages and I'm getting absolutely no where. If someone could help that would be amazing. Thanks!

    Read the article

< Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >