Search Results

Search found 15860 results on 635 pages for 'document oriented databas'.

Page 549/635 | < Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >

  • How can i change a jquery plugin's option value with my value?

    - by Pandiya Chendur
    I have just jquery pagination plugin to work... But what happens is when i click page number 2 i get the first page and when i click 3 i get second page and so on.... My initial page my current page value changes to 0 instead 1 this causes the problem... My plugin has this, jQuery.fn.pagination = function(maxentries, opts){ opts = jQuery.extend({ items_per_page:10, num_display_entries:10, current_page:0, num_edge_entries:0, link_to:"#", prev_text:"Prev", next_text:"Next", ellipse_text:"...", prev_show_always:true, next_show_always:true, callback:function(){return false;} },opts||{}); current_page is set to 0 ... I have modified the current page value in my jquery function but it doesn't seem to work.... <script type="text/javascript"> var itemsPerPage = 5; var maxNumberOfElementsHere = 17; $(document).ready(function() { getRecordspage(1, itemsPerPage); $(".pager").pagination(maxNumberOfElementsHere, { callback: getRecordspage, current_page: 1, // Look here i have changed this but it doesn't work... items_per_page: itemsPerPage, num_display_entries: 5, next_text: 'Next', prev_text: 'Prev', num_edge_entries: 1 }); }); </script>

    Read the article

  • JQuery date picker does not firing in ajax page using Rails

    - by prabu
    Hi Here I have using datepicker from JQueryUI in my public/javascript folder as effects,prototype,control,dragdrop js files. in my public folder contains jqueryui development buddle. (css,js,development-bundle) in layout/application.rhtml <%= stylesheet_link_tag 'application' %> <%=javascript_include_tag :defaults%> <%= stylesheet_link_tag '/jquery-ui/css/custom-theme/jquery-ui-1.8.1.custom.css' %> <%=javascript_include_tag "/jquery-ui/js/jquery-1.4.2.min.js"%> <%=javascript_include_tag "/jquery-ui/js/jquery-ui-1.8.1.custom.min.js"%> <script> $(document).ready(function(){ var $j=jQuery.noConflict(); $j( '#date' ).datepicker({ dateFormat: 'dd-mm-yy' }); }); </script> in home/index.rhtml <%title "Home"%> <%=link_to "Add Details" ,:action=>"add"%> <%=link_to_remote "Ajax Add Details", :update=>"add" , :url=>{ :action=>"add" }%> <div id='add' /> in home/add.rhtml <%title "Add details"%> <%form_tag :action=>"create" do%> Name : <%=text_field_tag "name" ,"",:size=>15%> DOB : <%=text_field_tag "dob","",:id=>"date"%> <%=submit_tag "Save"%> <%end%> the datepicker works when I run home/add.rhtml directly but the datepicker not work when i run ajax page home/index.rhtml Any solutions for that,????

    Read the article

  • What makes good web form styling for business applications?

    - by ProfK
    Styling forms (form elements) is something that even Eric Meyer prefers to avoid. However, most business forms, and that is where styling is at issue; 'contact us' forms are easy to style, put window estate at a premium, with more 'document level' (e.g. invoice) fields, plus 'detail level' (e.g. invoice line) fields. Factors I often find at play are: At my minimum, at least two horizontally adjacent fieldsets are required. In applications vs. public web pages, fixed positioning vs fluid layout is often better. Quantity of content is important, vs. exaggerated readability. Users know the system, and cues etc. take a back seat. In light of factors like these, is there any available guidence for styling web form based applications? Are there any CSS or JavaScript frameworks that would make my quest to style these applications better than Visual Studios still pathetic 'Auto-format' (what drugs were those people on? I will never take them.)

    Read the article

  • Which pdf elements could cause crashes?

    - by Felixyz
    This is a very general question but it's based on a specific problem. I've created a pdf reader app for the iPad and it works fine except for certain pdf pages which always crash the app. We now found out that the very same pages cause Safari to crash as well, so as I had started to suspect the problem is somewhere in Apple's pdf rendering code. From what I have been able to see, the crashing pages cause the rendering libraries to start allocating memory like mad until the app is killed. I have nothing else to help me pinpoint what triggers this process. It doesn't necessarily happen with the largest documents, or the ones with the most shapes. In fact, we haven't found any parameter that helps us predict which pages will crash and which not. Now we just discovered that running the pages through a consumer program that lets you merge docs gets rid of the problem, but I haven't been able to detect which attribute or element it is that is the key. Changing documents by hand is also not an option for us in the long run. We need to run an automated process on our server. I'm hoping someone with deeper knowledge about the pdf file format would be able to point me in a reasonable direction to look for document features that could cause this kind of behavior. All I've found so far is something about JBIG2 images, and I don't think we have any of those.

    Read the article

  • Solr/Lucene Scorer

    - by TFor
    We are currently working on a proof-of-concept for a client using Solr and have been able to configure all the features they want except the scoring. Problem is that they want scores that make results fall in buckets: Bucket 1: exact match on category (score = 4) Bucket 2: exact match on name (score = 3) Bucket 3: partial match on category (score = 2) Bucket 4: partial match on name (score = 1) First thing we did was develop a custom similarity class that would return the correct score depending on the field and an exact or partial match. The only problem now is that when a document matches on both the category and name the scores are added together. Example: searching for "restaurant" returns documents in the category restaurant that also have the word restaurant in their name and thus get a score of 5 (4+1) but they should only get 4. I assume for this to work we would need to develop a custom Scorer class but we have no clue on how to incorporate this in Solr. Another option is to create a custom SortField implementation similar to the RandomSortField already present in Solr. Maybe there is even a simpler solution that we don't know about. All suggestions welcome!

    Read the article

  • opening a new page and passing a parameter to it with Javascript

    - by recipriversexclusion
    I have a JS function that processes XML I GET from a server to dynamically create a table as below // Generate table of services by parsing the returned XML service list. function convertServiceXmlDataToTable(xml) { var tbodyElem = document.getElementById("myTbody"); var trElem, tdElem; var j = 0; $(xml).find("Service").each(function() { trElem = tbodyElem.insertRow(tbodyElem.rows.length); trElem.className = "tr" + (j % 2); // first column -> service ID var serviceID = $(this).attr("service__id"); tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col0"; tdElem.innerHTML = serviceID; // second column -> service name tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col1"; tdElem.innerHTML = "<a href=javascript:showServiceInfo(" + serviceID + ")>" + $(this).find("name").text() + "</a>"; j++; }); // each service } where showServiceInfo retrieves more detailed information about each service from the server based on the serviceID and displays it in the same page as the services table. So far so good. But, it turns out that I have to display the detailed service information in another page rather than the same page as the table. I have creates a generic service_info.html with an empty layout template, but I don't understand how to pass serviceID to this new page so that it gets customized with the detailed service info. How can I do this? Or, is there a better way to handle these situations? Thanks!

    Read the article

  • How do I get NHibernate to work with .NET Framework 2.0?

    - by Daniel Dolz
    I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

    Read the article

  • jQuery image fader slow in IE6 & 7

    - by Jamie
    Hi guys, I'm using the following jQuery script to rotate through a series of images pulled into an unordered list using PHP: function theRotator() { $('#rotator li').css({opacity: 0.0}); $('#rotator li:first').css({opacity: 1.0}); setInterval('rotate()',5000); }; function rotate() { var current = ($('#rotator li.show') ? $('#rotator li.show') : $('#rotator li:first')); var next = ((current.next().length) ? ((current.next().hasClass('show')) ? $('#rotator li:first') :current.next()) : $('#rotator li:first')); next.css({opacity: 0.0}).addClass('show').animate({opacity: 1.0}, 2000); current.animate({opacity: 0.0}, 2000).removeClass('show'); }; $(document).ready(function() { theRotator(); }); It works brilliantly in FF, Safari, Chrome and even IE8 but IE6 & 7 are really slow. Can anyone make any suggestions on making it more efficient or just work better in IE6 & 7? The script is from here btw. Thanks.

    Read the article

  • Opening a xul file in response to a toolbar extension button click

    - by Graham
    I'm currently building my first Firefox extension, and am having a little difficulty with one piece of functionality. I'd like to open a new browser tab in response to a button click on the toolbar. The new tab should contain the contents of a webpage, together with some extra buttons. At the moment I've created a separate xul file for the contents of the new tab: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <window id="myapp-report-window" title="Example 4.5.1" xmlns:html="http://www.w3.org/1999/xhtml" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script type="application/x-javascript" src="chrome://myapp/content/main.js" /> <toolbox> <toolbar id="nav-toolbar"> <toolbarbutton label="This-is-going-to-do-some-stuff"/> </toolbar> </toolbox> <iframe id="myapp-report-frame" flex="1"/> <script type="text/javascript"> function loadPage(url){ document.getElementById('myapp-report-frame').setAttribute('src',url); } </script> </window> This xul file is launched via this javascript, referenced from the main myapptoolbar.xul: gBrowser.selectedTab = gBrowser.addTab('chrome://myapp/content/report.xul'); var newTabBrowser = gBrowser.getBrowserForTab(gBrowser.selectedTab); newTabBrowser.addEventListener("load", function(){ loadPage('http://www.somedynamicallysetwebsite.com'); }, true); The problem that I'm having is that the loadPage function is not being found, so the src attribute of the iframe is never set. I'm sure it's some silly scoping problem, but I'm very new to firefox extensions (day 2!) so any help would be much appreciated. Thanks for looking! Graham

    Read the article

  • jQuery/ajax working on IIS5.1 but not IIS6

    - by Mikejh99
    I'm running a weird issue here. I have code that makes jquery ajax calls to a web service and dynamically adds controls using jquery. Everything works fine on my dev machine running IIS 5.1, but not when deployed to IIS 6. I'm using VS2010/ASP.Net 4.0, C#, jQuery 1.4.2 and jQuery UI 1.8.1. I'm using the same browser for each. It partially works though. The code will add the controls to the page, but they aren't visible until I click them (they aren't visible though). I thought this was a css issue, but the styles are there too. The ajax calls look like this: $.ajax({ url: "/WebServices/AssetManager.asmx/Assets", type: "POST", datatype: "json", async: false, data: "{'q':'" + req.term + "', 'type':'Condition'}", contentType: "application/javascript; charset=utf-8", success: function (data) { res($.map(data.d, function (item) { return { label: item.Name, value: item.Name, id: item.Id, datatype: item.DataType } })) } }) Changing the content-type makes the autocomplete fail. I've quadruple checked and all the paths are correct, there is no document footer enabled in IIS, and I'm not using IIS compression. Any idea why the page will display and work properly in IIS 5 but only partially in IIS 6? (If it failed completely, that'd make more sense!). Is it a jQuery or CSS issue?

    Read the article

  • jQuery when div is clicked update input field issue

    - by stogdilla
    Hello, I'm rather new to jquery so this may be the issue. I have a script that outputs several divs all with different text data in them. I would like it when I click one of them that an input field's value is updated to that text currently I have: <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.1/jquery.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $("a.results]").click(function() { data= this.text(); $("#updateme").val(data); }); }); </script> <p> <label>Field <input type="text" name="updateme" id="updateme"> </label> </p> <a href="#" class="results">Florida</a> <a href="#" class="results">Florida 2</a> <a href="#" class="results">Florida 3</a> How can I make it so that whatever link is clicked that is the data that gets updated into the input's value? I can get it to take one or I can script out different cases of each changing the class name but I think there has to be a way where it references whatever link is being clicked instead of what it's currently doing. Thanks in advance!

    Read the article

  • Can someone tell me why this JavaScript code isn't lining up an array in order?

    - by DarkLightA
    Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

    Read the article

  • Indexing and Searching Over Word Level Annotation Layers in Lucene

    - by dmcer
    I have a data set with multiple layers of annotation over the underlying text, such as part-of-tags, chunks from a shallow parser, name entities, and others from various natural language processing (NLP) tools. For a sentence like The man went to the store, the annotations might look like: Word POS Chunk NER ==== === ===== ======== The DT NP Person man NN NP Person went VBD VP - to TO PP - the DT NP Location store NN NP Location I'd like to index a bunch of documents with annotations like these using Lucene and then perform searches across the different layers. An example of a simple query would be to retrieve all documents where Washington is tagged as a person. While I'm not absolutely committed to the notation, syntactically end-users might enter the query as follows: Query: Word=Washington,NER=Person I'd also like to do more complex queries involving the sequential order of annotations across different layers, e.g. find all the documents where there's a word tagged person followed by the words arrived at followed by a word tagged location. Such a query might look like: Query: "NER=Person Word=arrived Word=at NER=Location" What's a good way to go about approaching this with Lucene? Is there anyway to index and search over document fields that contain structured tokens?

    Read the article

  • How do I use Core Data with the Cocoa Text Input system?

    - by the Joel
    Hobbyist Cocoa programmer here. Have been looking around all the usual places, but this seems relatively under-explained: I am writing something a little out of the ordinary. It is much simpler than, but similar to, a desktop publishing app. I want editable text boxes on a canvas, arbitrarily placed. This is document-based and I’d really like to use Core Data. Now, The cocoa text-handling system seems to deal with a four-class structure: NSTextStorage, NSLayoutManager, NSTextContainer and finally NSTextView. I have looked into these and know how to use them, sort of. Have been making some prototypes and it works for simple apps. The problem arrives when I get into persistency. I don't know how to, by way of Cocoa Bindings or something else, store the contents of NSTextStorage (= the actual text) in my managed object context. I have considered overriding methods pairs like -words, -setWords: in these objects. This would let me link the words to a String, which I know how to store in Core Data. However, I’d have to override any method that affects the text - and that seems a little much. Thankful for any insights.

    Read the article

  • JQuery tablesorter - Second click on column header doesn't resort

    - by Jonathan
    I'm using tablesorter in on a table I added to a view in django's admin (although I'm not sure this is relevant). I'm extending the html's header: {% block extrahead %} <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.js"></script> <script type="text/javascript" src="http://mysite.com/media/tablesorter/jquery.tablesorter.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#myTable").tablesorter(); } ); </script> {% endblock %} When I click on a column header, it sorts the table using this column in descending order - that's ok. When I click the same column header a second time - it does not reorder to ascending order. What's wrong with it? the table's html looks like: <table id="myTable" border="1"> <thead> <tr> <th>column_name_1</th> <th>column_name_2</th> <th>column_name_3</th> </tr> </thead> <tbody> {% for item in extra.items %} <tr> <td>{{ item.0|safe }} </td> <td>{{ item.1|safe }} </td> <td>{{ item.2|safe }} </td> </tr> {% endfor %} </tbody> </table>

    Read the article

  • jeditable table cell

    - by user666262
    Hi all, I am having an issue when using jeditable to edit a cell in a table. The project is the MVC 2 web application and the table has been put on the standard about page. How do i tell the script to call a specific method in the controller ? because it is currently just loading the entire page into the cell. This is the javascript: $(document).ready(function () { $('.editable').editable('http://localhost:2196/Home/About', { type: 'text', cancel: 'Cancel', event: 'dblclick', submit: 'OK', tooltip: 'double Click to edit...' }); }); This is the table : <% foreach (DataTableEditable.Models.Company item in (IEnumerable<DataTableEditable.Models.Company>)Model) {%> <tr id="<%= Html.Encode(item.ID) %>"> <td class="editable"><%= Html.Encode(item.Name) %> </td> <td><%= Html.Encode(item.Address) %> </td> <td><%= Html.Encode(item.Town) %> </td> </tr> <% }%> Thanks lots John

    Read the article

  • Jquery selectors question

    - by Ben
    Hi all, I am not an expert at jquery but trying to get a menu to work. Basically, I have a menu made of up to 3 levels of nested lists. The first level has a little arrow has a background image that opens or close when opening the first level list. Any other nested lists don't need to have the background image. My script opens the menu when you click on it and is also supposed to switch the first level list from a class "inactive" to a class "active". Here is the script: $(document).ready(function(){ $("#left-navigation-holder ul.level1 li.inactive").toggle(function(){ $(this).addClass("active"); }, function () { $(this).removeClass("active"); }); $("#left-navigation-holder li a").click(function(){ menu = $(this).parent('li').children('ul'); menu.toggle(); }); }); The problem is that the toggle function also happens when clicking on second and third level lists causing the arrows to toggle even if the first level list isn't clicked on. I thought using $("#left-navigation-holder ul.level1 li.inactive").toggle would limit the function to the first level list with a class "inactive". Any help would be really appreciated. Ben

    Read the article

  • IE "Microsoft JScript runtime error: Object expected"

    - by Stephen Borg
    Hi there, I have problems with regards to javascript only when using IE. The error I am getting is "Microsoft JScript runtime error: Object expected" and I have no idea why. It is then jumping into the JQuery 1.4.2 file, without giving me a proper error message. All I am doing is simply reading on page load the raw URL, and getting a query string named Search. Using that in an AJAX call to return products and put then into a DIV. No biggies, but somehow IE is managing to blow my page up :-( Any ideas? Code as follows : <script type="text/javascript"> $(document).ready(function (e) { $('.boxLoader').show(); function getParameterByName(name) { name = name.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regexS = "[\\?&]" + name + "=([^&#]*)"; var regex = new RegExp(regexS); var results = regex.exec(window.location.href); if (results == null) return ""; else return decodeURIComponent(results[1].replace(/\+/g, " ")); } var Search; Search = getParameterByName("search"); $('#searchCriteria').text(Search); $.get("/Handlers/processProducts.aspx", { SearchCriteria: Search }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); $('#searchBox').live("click", function () { $.get("/Handlers/processProducts.aspx", { SearchCriteria: $('#searchCriteria').val() }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); }); }); </script>

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to report progress of a JavaScript function?

    - by LambyPie
    I have a JavaScript function which is quite long and performs a number of tasks, I would like to report progress to the user by updating the contents of a SPAN element with a message as I go. I tried adding document.getElementById('spnProgress').innerText = ... statements throughout the function code. However, whilst the function is executing the UI will not update and so you only ever see the last message written to the SPAN which is not very helpful. My current solution is to break the task up into a number of functions, at the end of each I set the SPAN message and then "trigger" the next one with a window.setTimeout call with a very short delay (say 10ms). This yields control and allows the browser to repaint the SPAN with the updated message before starting the next step. However I find this very messy and difficult to follow the code, I'm thinking there must be a better way. Does anyone have any suggestions? Is there any way to force the SPAN to repaint without having to leave the context of the function? Thanks

    Read the article

  • Issue reading in a cell from Excel with Apache POI

    - by Nick
    I am trying to use Apache POI to read in old (pre-2007 and XLS) Excel files. My program goes to the end of the rows and iterates back up until it finds something that's not either null or empty. Then it iterates back up a few times and grabs those cells. This program works just fine reading in XLSX and XLS files made in Office 2010. I get the following error message: Exception in thread "main" java.lang.NumberFormatException: empty String at sun.misc.FloatingDecimal.readJavaFormatString(Unknown Source) at java.lang.Double.parseDouble(Unknown Source) at the line: num = Double.parseDouble(str); from the code: str = cell.toString(); if (str != "" || str != null) { System.out.println("Cell is a string"); num = Double.parseDouble(str); } else { System.out.println("Cell is numeric."); num = cell.getNumericCellValue(); } where the cell is the last cell in the document that's not empty or null. When I try to print the first cell that's not empty or null, it prints nothing, so I think I'm not accessing it correctly.

    Read the article

  • pdf external streams in Max OS X Preview

    - by olpa
    According to the specification, a part of a PDF document can reside in an external file. An example for an image: 2 0 obj << /Type /XObject /Subtype /Image /Width 117 /Height 117 /BitsPerComponent 8 /Length 0 /ColorSpace /DeviceRGB /FFilter /DCTDecode /F (pinguine.jpg) >> stream endstream endobj I found that this functionality does work in Adobe Acrobat 5.0 for Windows (sample PDF with the image), also I managed to view this file in Adobe Acrobat Reader 8.1.3 for Mac OS X after I found the setting "Allow external content". Unfortunately, it seems that non-Adobe tools ignore the external stream feature. I hope I'm wrong, therefore ask the question: How to enable external streams in Mac OS X? (I think that all the system Mac OS X tools use the same library, therefore say "Mac OS X" instead of "Preview".) Or maybe there could be a programming hook to emulate external streams? My task is: store a big set of images (total ˜300Mb) outside of a small PDF (˜1Mb). At some moment, I want to filter PDF through a quartz filter and get a PDF with the images embedded. Any suggestions are welcome.

    Read the article

  • Why doesn't Javascript recognize the HTML class attribute?

    - by Cornflake
    Can anyone help me with a Javascript question, please? Why does the following code display only message boxes with the word "null" in them? And I think there are not enough of them either. <html> <head> <script type="text/javascript"> function showElementClasses(node) { var els = node.getElementsByTagName("*"); for(var i=0,j=els.length; i<j; i++) alert(els[i].getAttribute("class")); alert("Class: " + els[i].className); } showElementClasses(document); </script> </head> <body class="bla"> <div class="myclass" style="width: 500; height: 400" id="map"></div> </body> </html>

    Read the article

  • Loading default value in a dropdown and calling onchange event

    - by J. Davidson
    Hi i have following dropdown <div class="fcolumn"> <label class="text" for="o_Id">Months:</label> <select class="textMonths" id="o_Id" name="periodName" > <option value="000">Select Period--</option> </select> </div> In the following jquery, first it loads fnLoadP() in a drop down list. Than as a default I am loading one of the values in drop down which is '10'. It loads too as default value. But it should be executing $("#o_Id").change.. which it doesn't. $(document).ready(function () { var sProfileUserId = null; $("#o_Id").change(function () { //---- }); fnLoadP(); $("select[name='pName']").val('10'); }); }); Basically my goal is. After dropdown values are loaded, to load '10' as default value and call onchange event in the dom. Please let me know how to fix it.

    Read the article

  • Jquery Returning values to original

    - by Cam
    So my script works perfectly, but here is the issue, I have buttons (Sprite action here) that are 40px height, but the top 20 only shows perfectly. When you click the button ie img the bottom 20px show perfecto! but... Issue, i included in my script a way to return all others to there default (only one should be selected) now, how can I fix this issue that I seem unable to correct as I can select multiple of them ** USERS can switch ** The last part of the script that is the issue. Thanks $(document).ready(function() { $('.form_sub').hide(); $('.theader').addClass('active'); $('.theader_t').click(function() { $('.form_header').show(); $('.form_sub').hide(); $('.theader').addClass('active'); $('.sub_theader').removeClass('active'); }); $('.sub_theader_t').click(function() { $('.form_header').hide(); $('.form_sub').show(); $('.theader').removeClass('active'); $('.sub_theader').addClass('active'); }); $('.top_head_img').click(function() { $(this).css({ position: 'relative', bottom: '20px' }).siblings().css( 'bottom', '0' ); }); }); <ul class="top_head"> <li> <a href="javascript:void(0)" onClick="selectPic5('top');"><img src="custom/images/top2.jpg" alt="Left" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('center');"><img src="custom/images/mid2.jpg" alt="Center" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('bottom');"><img src="custom/images/bot2.jpg" alt="Right" border="0" class="top_head_img"/></a> </li> </ul>

    Read the article

< Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >