Search Results

Search found 15860 results on 635 pages for 'document oriented databas'.

Page 549/635 | < Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • php not redirecting

    - by NSchulze
    I'm trying to write the logout of a website. When I do this I want the page to redirect to the login page. I think I'm doing it the correct way, but can't get the right result. Could you guys point me in the right direction? Relevant Code: <button onclick="logout()">Logout</button> function logout() { var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { document.location=xmlhttp.responseText; } } xmlhttp.open("GET","logout.php",true); xmlhttp.send(); } <?php session_destroy(); header("Location:http://localhost:8888/loginns.html"); mysql_close($con); ?> Thanks!

    Read the article

  • JQuery date picker does not firing in ajax page using Rails

    - by prabu
    Hi Here I have using datepicker from JQueryUI in my public/javascript folder as effects,prototype,control,dragdrop js files. in my public folder contains jqueryui development buddle. (css,js,development-bundle) in layout/application.rhtml <%= stylesheet_link_tag 'application' %> <%=javascript_include_tag :defaults%> <%= stylesheet_link_tag '/jquery-ui/css/custom-theme/jquery-ui-1.8.1.custom.css' %> <%=javascript_include_tag "/jquery-ui/js/jquery-1.4.2.min.js"%> <%=javascript_include_tag "/jquery-ui/js/jquery-ui-1.8.1.custom.min.js"%> <script> $(document).ready(function(){ var $j=jQuery.noConflict(); $j( '#date' ).datepicker({ dateFormat: 'dd-mm-yy' }); }); </script> in home/index.rhtml <%title "Home"%> <%=link_to "Add Details" ,:action=>"add"%> <%=link_to_remote "Ajax Add Details", :update=>"add" , :url=>{ :action=>"add" }%> <div id='add' /> in home/add.rhtml <%title "Add details"%> <%form_tag :action=>"create" do%> Name : <%=text_field_tag "name" ,"",:size=>15%> DOB : <%=text_field_tag "dob","",:id=>"date"%> <%=submit_tag "Save"%> <%end%> the datepicker works when I run home/add.rhtml directly but the datepicker not work when i run ajax page home/index.rhtml Any solutions for that,????

    Read the article

  • jquery animate from object center

    - by mtwallet
    Hi. I am trying to create a product viewer similar to the one at the bottom of this page http://www.logitech.com/en-gb/. As you can see the product animates from the center rather than top left which I think is Jquery's default. So what I am doing is trying animate the width and height and then also the offset to make it look like it animates from the center. My code looks like this: <style> body { background: black; } .box { background: #fff url('pic.jpg') no-repeat 0 0; width: 200px; height: 200px; margin: 10px 4%; float: left; } </style> <script type="text/javascript"> $(document).ready(function() { $(".box").hover(function() { $(".box").not(this).fadeTo(500, 0.5); $(this).animate({ width: 300, height: 300, left: -100, top: -100 }, 500); }, function() { $(this).animate({ width: 200, height: 200, left: 100, top: 100 }, 500); $(".box").fadeTo(500, 1); }); }); </script> I cannot seem to get this working as I want. Can anyone help with this or suggest a better technique? Many thanks

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

  • How to report progress of a JavaScript function?

    - by LambyPie
    I have a JavaScript function which is quite long and performs a number of tasks, I would like to report progress to the user by updating the contents of a SPAN element with a message as I go. I tried adding document.getElementById('spnProgress').innerText = ... statements throughout the function code. However, whilst the function is executing the UI will not update and so you only ever see the last message written to the SPAN which is not very helpful. My current solution is to break the task up into a number of functions, at the end of each I set the SPAN message and then "trigger" the next one with a window.setTimeout call with a very short delay (say 10ms). This yields control and allows the browser to repaint the SPAN with the updated message before starting the next step. However I find this very messy and difficult to follow the code, I'm thinking there must be a better way. Does anyone have any suggestions? Is there any way to force the SPAN to repaint without having to leave the context of the function? Thanks

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

  • What makes good web form styling for business applications?

    - by ProfK
    Styling forms (form elements) is something that even Eric Meyer prefers to avoid. However, most business forms, and that is where styling is at issue; 'contact us' forms are easy to style, put window estate at a premium, with more 'document level' (e.g. invoice) fields, plus 'detail level' (e.g. invoice line) fields. Factors I often find at play are: At my minimum, at least two horizontally adjacent fieldsets are required. In applications vs. public web pages, fixed positioning vs fluid layout is often better. Quantity of content is important, vs. exaggerated readability. Users know the system, and cues etc. take a back seat. In light of factors like these, is there any available guidence for styling web form based applications? Are there any CSS or JavaScript frameworks that would make my quest to style these applications better than Visual Studios still pathetic 'Auto-format' (what drugs were those people on? I will never take them.)

    Read the article

  • Add an event to HTML elements with a specific class.

    - by Juan C. Rois
    Hello everybody, I'm working on a modal window, and I want to make the function as reusable as possible. Said that, I want to set a few anchor tags with a class equals to "modal", and when a particular anchor tag is clicked, get its Id and pass it to a function that will execute another function based on the Id that was passed. This is what I have so far: // this gets an array with all the elements that have a class equals to "modal" var anchorTrigger = document.getElementsByClassName('modal'); Then I tried to set the addEventListener for each item in the array by doing this: var anchorTotal = anchorTrigger.length; for(var i = 0; i < anchorTotal ; i++){ anchorTrigger.addEventListener('click', fireModal, false); } and then run the last function "fireModal" that will open the modal, like so: function fireModal(){ //some more code here ... } My problem is that in the "for" loop, I get an error saying that anchorTrigger.addEvent ... is not a function. I can tell that the error might be related to the fact that I'm trying to set up the "addEventListener" to an array as oppose to individual elements, but I don't know what I'm supposed to do. Any help would be greatly appreciated.

    Read the article

  • Solr/Lucene Scorer

    - by TFor
    We are currently working on a proof-of-concept for a client using Solr and have been able to configure all the features they want except the scoring. Problem is that they want scores that make results fall in buckets: Bucket 1: exact match on category (score = 4) Bucket 2: exact match on name (score = 3) Bucket 3: partial match on category (score = 2) Bucket 4: partial match on name (score = 1) First thing we did was develop a custom similarity class that would return the correct score depending on the field and an exact or partial match. The only problem now is that when a document matches on both the category and name the scores are added together. Example: searching for "restaurant" returns documents in the category restaurant that also have the word restaurant in their name and thus get a score of 5 (4+1) but they should only get 4. I assume for this to work we would need to develop a custom Scorer class but we have no clue on how to incorporate this in Solr. Another option is to create a custom SortField implementation similar to the RandomSortField already present in Solr. Maybe there is even a simpler solution that we don't know about. All suggestions welcome!

    Read the article

  • How do I get NHibernate to work with .NET Framework 2.0?

    - by Daniel Dolz
    I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

    Read the article

  • Google Charts - Adding Tooltip to Colorized Column Chart

    - by David K
    I created a column chart with google charts that has a different color assigned to each column using the following posting: Assign different color to each bar in a google chart But now I'm trying to figure out how to customize the tooltips for each column to also include the number of users in addition to the percent, so "raw_data[i][1]" I would like it to look like "70% (80 Users)" I understand that there is "data.addColumn({type:'number',role:'tooltip'});" but I'm having trouble understanding how to implement it for this use-case. function drawAccountsChart() { var data = new google.visualization.DataTable(); var raw_data = [ ['Parents', 80, 160], ['Students', 94, 128], ['Teachers', 78, 90], ['Admins', 68, 120], ['Staff', 97, 111] ]; data.addColumn('string', 'Columns'); for (var i = 0; i < raw_data.length; ++i) { data.addColumn('number', raw_data[i][0]); } data.addRows(1); for (var i = 0; i < raw_data.length; ++i) { data.setValue(0, i+1, raw_data[i][1]/raw_data[i][2]*100); } var options = { height:220, chartArea: { left:30, width: "70%", height: "70%" }, backgroundColor: { fill:"transparent" }, tooltop:{ textStyle: {fontSize: "12px",}}, vAxis: {minValue: 0} }; var formatter = new google.visualization.NumberFormat({ suffix: '%', fractionDigits: 1 }); formatter.format(data, 1); formatter.format(data, 2); formatter.format(data, 3); formatter.format(data, 4); formatter.format(data, 5); var chart = new google.visualization.ColumnChart(document.getElementById('emailAccountsChart')); chart.draw(data, options); }

    Read the article

  • JQuery error in IE, works with FF. Maybe a problem with live.

    - by olve
    Hello. I have an ASP.net MVC2 application. In wich I'm using JQuery to alter all table rows so I can click anywhere in any row to trigger a click event on a link in the clicked row. The tables is created using MVC's built in partialview ajax. Here is my JQuery script. <script type="text/javascript"> $(document).ready(function () { $('table tr').live('click',function (event) { $('#asplink', this).trigger('click'); }) .live('mouseenter',function (event) { this.bgColor = 'lightblue'; }) .live('mouseleave', function (event) { this.bgColor = 'white'; }); }); </script> And this is the first part of the partial view code that creates the table. <% foreach (var item in Model.JobHeaderData) { %> <tr> <td> <a id="asplink" href="http://localhost/sagstyring/EditJob.asp?JobDataID=<%: item.JobDataId %>&JobNumId=<%: item.JobNumID%>&JobNum=<%: item.JobNumID%>&DepId=1&User_Id=<%:ViewData["UserId"]%>" onclick="window.open(this.href,'Rediger sag <%: item.JobNumID %> ', 'status=0, toolbar=0, location=0, menubar=0, directories=0, resizeable=0, scrollbars=0, width=900, height=700'); return false;">Rediger</a> </td> In firefox this works perfectly. In IE, JQuery crashes when I click on a row. If I debug the page in IE. I get this. Out of stack space In jquery-1.4.1.js line 1822 // Trigger the event, it is assumed that "handle" is a function var handle = jQuery.data( elem, "handle" ); if ( handle ) { handle.apply( elem, data ); } I'm no eagle at javascript, so I'm pretty much stuck.

    Read the article

  • Returning an integer from a select box - JavaScript

    - by Ross
    Very simply, I want to be able to access the year from the select box as an integer. In my test, my alertbox is telling me the value is undefined. <form name="form1" method="post" action=""> <label>birth year <select name="birth year" id="dueYear"> <OPTION VALUE='' SELECTED>--Year--</OPTION> <OPTION VALUE='2011'>2011</OPTION> <OPTION VALUE='2010'>2010</OPTION> <OPTION VALUE='2009'>2009</OPTION></SELECT> </select> </label> </form> <script type="text/javascript"> var dueDateYear = parseInt(document.getElementById("dueYear")); </script> <button onclick="alert(dueDateYear)">Click Me!</button> All I want it to do, is tell me the year I have selected -- any help would be appreciated, I am a newbie :(

    Read the article

  • Indexing and Searching Over Word Level Annotation Layers in Lucene

    - by dmcer
    I have a data set with multiple layers of annotation over the underlying text, such as part-of-tags, chunks from a shallow parser, name entities, and others from various natural language processing (NLP) tools. For a sentence like The man went to the store, the annotations might look like: Word POS Chunk NER ==== === ===== ======== The DT NP Person man NN NP Person went VBD VP - to TO PP - the DT NP Location store NN NP Location I'd like to index a bunch of documents with annotations like these using Lucene and then perform searches across the different layers. An example of a simple query would be to retrieve all documents where Washington is tagged as a person. While I'm not absolutely committed to the notation, syntactically end-users might enter the query as follows: Query: Word=Washington,NER=Person I'd also like to do more complex queries involving the sequential order of annotations across different layers, e.g. find all the documents where there's a word tagged person followed by the words arrived at followed by a word tagged location. Such a query might look like: Query: "NER=Person Word=arrived Word=at NER=Location" What's a good way to go about approaching this with Lucene? Is there anyway to index and search over document fields that contain structured tokens?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • jQuery UI - Sortable isn't firing?

    - by Kenny Bones
    Hi, I'm trying to get the jQuery UI sortable plugin to work and I've created a list that looks like this: <ul id="sortable"> <li>Item 1</li> <li>Item 2</li> <li>Item 3</li> <li>Item 4</li> <li>Item 5</li> </ul> And I've included the plugin script files: $(function() { $("#sortable").sortable(); alert('test'); $("#sortable").disableSelection(); }); So I just tried putting the alert box before .sortable is run and the alertbox is showing. But putting it after .sortable isn't working. Which means that .sortable is failing right? I've included the scripts and put them in the head of the html document. <script type="text/javascript" src="js/jquery.ui.core.min.js"></script> <script type="text/javascript" src="js/jquery.ui.mouse.min.js"></script> <script type="text/javascript" src="js/jquery.ui.sortable.min.js"></script> <script type="text/javascript" src="js/jquery.ui.widget.min.js"></script> Which is correct right? And the function that actually runs .sortable is in a merged js file along with all other js snippets and plugins.

    Read the article

  • Syntax for documenting JSON structure

    - by Roman A. Taycher
    So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

    Read the article

  • Which pdf elements could cause crashes?

    - by Felixyz
    This is a very general question but it's based on a specific problem. I've created a pdf reader app for the iPad and it works fine except for certain pdf pages which always crash the app. We now found out that the very same pages cause Safari to crash as well, so as I had started to suspect the problem is somewhere in Apple's pdf rendering code. From what I have been able to see, the crashing pages cause the rendering libraries to start allocating memory like mad until the app is killed. I have nothing else to help me pinpoint what triggers this process. It doesn't necessarily happen with the largest documents, or the ones with the most shapes. In fact, we haven't found any parameter that helps us predict which pages will crash and which not. Now we just discovered that running the pages through a consumer program that lets you merge docs gets rid of the problem, but I haven't been able to detect which attribute or element it is that is the key. Changing documents by hand is also not an option for us in the long run. We need to run an automated process on our server. I'm hoping someone with deeper knowledge about the pdf file format would be able to point me in a reasonable direction to look for document features that could cause this kind of behavior. All I've found so far is something about JBIG2 images, and I don't think we have any of those.

    Read the article

  • Embedding XSL Stylesheet into XML

    - by user700996
    I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

    Read the article

  • jQuery - Unchecking checkboxes that act like radio buttons

    - by Cecil
    Hey All, I have the following jQuery code to make my checkboxes act like radio buttons, so that only 1 of the 3 can be checked at a time. <script type="text/javascript" language="javascript"> $(document).ready(function() { $("#testing input:checkbox").change(function(){ var checkname = $(this).attr("name"); $("input:checkbox[name='" + checkname + "']").removeAttr("checked"); this.checked = true; }); }); </script> The checkboxes are layed out like the following: <input type="checkbox" id="testing" name="testing" value="B"> <input type="checkbox" id="testing" name="testing" value="I"> <input type="checkbox" id="testing" name="testing" value="A"> This works exactly how i want it to work, not a problem, except once i click one of the 3, i cant unclick it so that none of them are checked, this is what i want to happen, so along with being only able to click one at a time, im able to uncheck them completely. Any help would be grand :)

    Read the article

  • undefined method `key?' for nil:NilClass when using MongoMapper

    - by Radek Slupik
    I set up a new Rails application by following these instructions. I generated a new controller and added resources :tickets to the routes file. Hexapoda::Application.routes.draw do resources :tickets end This is the controller (`/app/controllers/tickets_controller.rb'). class TicketsController < ApplicationController def index @tickets = Ticket.all end end I then added a new model Ticket in /app/models/ticket.rb. class Ticket include MongoMapper::Document key :summary, String, :required => true end Here's the view (/app/views/index.html.erb): <h1>Tickets#index</h1> <p>Find me in app/views/tickets/index.html.erb</p> Now when I go to /tickets in my browser, I get an error message. NoMethodError in TicketsController#index undefined method `key?' for nil:NilClass I have no idea what's going on. What could be the problem? I'm using Rails 3.2.5 and MongoMapper 0.11.1.

    Read the article

  • How do I use HTML5's localStorage in a Google Chrome extension?

    - by davidkennedy85
    I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

    Read the article

  • Can someone tell me why this JavaScript code isn't lining up an array in order?

    - by DarkLightA
    Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

    Read the article

  • How to select LI except first and second ?

    - by Wazdesign
    Here is the structure of the content, I want to select all LI except the first two (ie no-link) jQuery(document).ready(function(){ var nosubnav = jQuery('.first-level li:not(:has(ul))'); var nosubnavsize = jQuery('.first-level li:not(:has(ul))').size(); jQuery(nosubnav).css('border' , '1px solid red'); alert('List item which does not have submenu '+nosubnavsize); }); div class="navigation-container"> <ul class="first-level"> <li><a href="#">No Link</a></li> <li><a href="#">No Link</a></li> <li><a href="#">Link 1</a></li> <li><a href="#">Link 2</a> <ul> <li><a href="#">Link2.1</a></li> <li><a href="#">Link2.2</a> <ul> <li><a href="#">Link 2.2.1</a></li> </ul> </li> </ul> </li> <li><a href="#">Link </a></li> </ul> </div> related Question : http://stackoverflow.com/questions/2771801/how-to-count-li-which-does-not-have-ul

    Read the article

< Previous Page | 545 546 547 548 549 550 551 552 553 554 555 556  | Next Page >