Search Results

Search found 15860 results on 635 pages for 'document oriented databas'.

Page 547/635 | < Previous Page | 543 544 545 546 547 548 549 550 551 552 553 554  | Next Page >

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• How do I use HTML5's localStorage in a Google Chrome extension?

  - by davidkennedy85

  I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

  Read the article

• How to only fade content once it is ready in Jquery?

  - by Jared

  Hello, I've seen examples for load() and ready(), but they always seem to apply to the window or document body, or a div or img or something like that. I have a hover() function, and when you hover over it, it uses fadeIn() to reveal it. Problem is, the images inside the div aren't loaded yet, so it ends up just appearing anyway. I need code that will only allow the image to fade when it's contents are fully loaded. When I just plug in other selectors like the following, it doesn't work $(this).next(".menuPopup").ready(function () { //or load(), neither work fadeTo(300, 1); }); EDIT: Relevant code $( '.leftMenuProductButton' ).hover ( function () { $(this).next(".menuPopup").stop().css("opacity", 1).fadeIn('slow'); }, function () { $(this).next(".menuPopup").stop().hide(); }); HTML <div class="leftMenuProductButton"> Product 1</div> <div id="raceramps56" class="menuPopup"><IMG SRC="myimage.jpeg"> </div>

  Read the article

• Handling Types Defined in Plug-ins That Are No Longer Available

  - by Chris

  I am developing a .NET framework application that allows users to maintain and save "projects". A project can consist of components whose types are defined in the assemblies of the framework itself and/or in third-party assemblies that will be made available to the framework via a yet-to-be-built plug-in architecture. When a project is saved, it is simply binary-serialised to file. Projects are portable, so multiple users can load the same project into their own instances of the framework (just as different users may open the same MSWord document in their own local copies of MSWord). What's more, the plug-ins available to one user's framework might not be available to that of another. I need some way of ensuring that when a user attempts to open (i.e. deserialise) a project that includes a type whose defining assembly cannot be found (either because of a framework version incompatibility or the absence of a plug-in), the project still opens but the offending type is somehow substituted or omitted. Trouble is, the research I've done to date does not even hint at a suitable approach. Any ideas would be much appreciated, thanks.

  Read the article

• mvc jquery passing form values after user presses "Accept" button

  - by gdubs

  So I have a form and a submit button that posts the form to an action. But I wanted to show a popup where the user can deny or accept an agreement. Here's my jquery $(document).ready((function () { var dialog = $('#confirmation-dialog').dialog({ autoOpen: false, width: 500, height: 600, resizable: false, modal: true, buttons: { "Accept": function () { $(this).dialog('close'); $.ajax({ type: 'POST', data: {__RequestVerificationToken: $("input[name=__RequestVerificationToken]").val()} }); }, "Cancel": function () { $(this).dialog('close'); } } }); $('#registration-submit').click(function (e) { var action = $(this.form); console.log(action); var form = $('form'); dialog.dialog("open"); return false; }); })); My problem with this is that it would post, but it would only send my AntiforgeryToken, and not the values of the form. But when it goes through the TryupdateModel it would go through for some reason but will not Save (cuz of the missing data that wasn't passed on the formcollection).

  Read the article

• Event type property lost in IE-8

  - by Channel72

  I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

  Read the article

• OnSubmit does work right in the Validation plugin in jQuery

  - by novellino

  Hello, I an quite new to jQuery and I have a problem while trying to create a form. I am using the Validation plugin for validate the email (one the form's field). When I click the Submit button I want to call my own function because I want to save the data in an XML file. This is my button: (as I understood the plugin uses "submit" for understand the button) <input type="submit" name="submit" class="submit" id="submit_btn" value="Send"/> and here is the script for the validation: <script type="text/javascript"> $(document).ready(function() { //this is my form $("#contactForm").validate(); /*save the valid data in the xml*/ $(".submit").click(function() { var email = $("input#email").val(); var subject = $("input#subject").val(); var message = $("textarea#message").val(); if (email == "" || !$("#contactForm").valid()) { return false; } var dataString = 'email='+ email + '&subject=' + subject + '&message=' + message; //alert("DATA: " +dataString); $.ajax({ type: "POST", url: "SaveData.jsp", data: dataString, success: function(data){} }); return false; }); }); In general it works ok but I have two basic problems. When I click the button in the beginning having all the form empty, I get no message for the field required. Also when the data are valid and I am doing the submit, the form does not become clear after the submit. If I deleted this script code, these actions are working properly but I can not save the data! Does anyone know what is wrong? Thanks a lot!

  Read the article

• Why this class assignment is not working in IE

  - by user550750

  I've wrote this peice of code, this works fine in FF and Chrome but not in IE. Why is it? <html> <header> <style type="text/css"> .red{ color: red; } .green{ color: green; } .yellow{ color: yellow; } </style> </header> <body> <div id="mydiv" style="height: 50px">Some contents</div> <div> <input type="radio" value="1" name="change" onclick="onClick(this)">Red</input> <input type="radio" value="2" name="change" onclick="onClick(this)">Green</input> <input type="radio" value="3" name="change" onclick="onClick(this)">Yellow</input> </div> <script type="text/javascript"> function onClick(el){ var className = ""; if(el.value == 1){ className = "red"; }else if(el.value == 2){ className = "green"; }else if(el.value == 3){ className = "yellow"; } document.getElementById("mydiv").setAttribute("class", className); } </script> </body> </html>

  Read the article

• Interchange structured data between Haskell and C

  - by Eonil

  First, I'm a Haskell beginner. I'm planning integrating Haskell into C for realtime game. Haskell does logic, C does rendering. To do this, I have to pass huge complexly structured data (game state) from/to each other for each tick (at least 30 times per second). So the passing data should be lightweight. This state data may laid on sequential space on memory. Both of Haskell and C parts should access every area of the states freely. In best case, the cost of passing data can be copying a pointer to a memory. In worst case, copying whole data with conversion. I'm reading Haskell's FFI(http://www.haskell.org/haskellwiki/FFICookBook#Working_with_structs) The Haskell code look specifying memory layout explicitly. I have a few questions. Can Haskell specify memory layout explicitly? (to be matched exactly with C struct) Is this real memory layout? Or any kind of conversion required? (performance penalty) If Q#2 is true, Any performance penalty when the memory layout specified explicitly? What's the syntax #{alignment foo}? Where can I find the document about this? If I want to pass huge data with best performance, how should I do that? *PS Explicit memory layout feature which I said is just C#'s [StructLayout] attribute. Which is specifying in-memory position and size explicitly. http://www.developerfusion.com/article/84519/mastering-structs-in-c/ I'm not sure Haskell has matching linguistic construct matching with fields of C struct.

  Read the article

• radio input replacement using jquery

  - by altvali

  It may seem a bit odd to ask this since there are several solutions out there but the fact is that all of them look pretty and none of what i've seem save the input value for form submission the right way. I'm looking for something that will replace all radio inputs with divs that get special classes when they are hovered or clicked, and an input type hidden for every group of radio inputs with the same name, hidden input that will be updated with the value corresponding to the div the user clicks on. Long sentence, i know. Here's what i've come up with: $('input:radio').each(function(){ if (this.style.display!='none') { var inputName = $(this).attr('name'); var inputValue = $(this).attr('value'); var isChecked = $(this).attr('checked'); if (!$('input:hidden[name='+inputName+']').length) // if the hidden input wasn't already created $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div><input type="hidden" name="'+inputName+'" value="'+inputValue+'" />'); else{ $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div>'); if (isChecked) $('input:hidden[name='+inputName+']').attr({'value':inputValue}); } //this bind doesn't work $("#"+inputName+"X"+inputValue).click(function(){ if($('input:hidden[name='+inputName+']').val()!=inputValue){ $('input:hidden[name='+inputName+']').attr({'value':inputValue}); $('div[id*='+inputName+'].inputRadioButton').removeClass('inputRadioButtonSelected'); } if (!$("#"+inputName+"X"+inputValue).hasClass('inputRadioButtonSelected')) $("#"+inputName+"X"+inputValue).addClass('inputRadioButtonSelected'); }); } }); Please tell me how to fix it. Thank you. Edit I've found the reason. It should normally work but some of my radio inputs generated by an e-commerce software had brackets in them (e.g. id[12] ) and jQuery was parsing that. The fix is adding var inputButton = document.getElementById(inputName+"X"+inputValue); before the bind and replacing $("#"+inputName+"X"+inputValue) with $(inputButton).

  Read the article

• Any solution to IE8 bug rendering error when hiding elements?

  - by Magnar

  Bug: when hiding an element with JavaScript in IE8, the margin of still-visible other elements on the side is ignored. This bug has been introduced with IE8, since it works as expected in IE6+7 (and other browsers). <html> <head> <style> #a, #b, #c, #d {background: #ccf; padding: 4px; margin-bottom: 8px;} </style> </head> <body> <div id="a">a</div> <div id="b">b</div> <div id="c">c</div> <div id="d">d</div> <script> setTimeout(function () { document.getElementById("b").style.display = "none"; }, 1000); </script> </body> </html> When running this code, notice how a and c have a margin of 8 between them in normal browsers, but a margin of 0 in IE8. Remove the padding, and IE8 behaves like normal. Remove the timeout and IE8 behaves like normal. A border behaves the same way. I've been working with IE-bugs the last 10 years, but this has me stumped. The solution for now is to wrap the divs, and apply the margin to the outer element and other styles to the inner. But that's reminicent of horrible IE6-workarounds. Any better solutions?

  Read the article

• XmlDocument.Load() throws XmlSchemaValidationException

  - by Praetorian

  Hi, I'm trying to validate an XML document against a schema (which is embedded in my program as a resource). I got everything to work, so I tried to test for errors by adding a second sibling node in the XML at a location where the schema specifies maxOccurs="1". The problem is that my ValidationEventHandler is never getting called, also XmlDocument.Load() is throwing an XmlSchemaValidationException exception when I'd expected XmlDocument.Validate() to do that. This is the code I have: private void ValidateUserData( string xmlPath ) { var resInfo = Application.GetResourceStream( new Uri( @"MySchema.xsd", UriKind.Relative ) ); var schema = XmlSchema.Read( resInfo.Stream, SchemaValidationCallBack ); XmlSchemaSet schemaSet = new XmlSchemaSet(); schemaSet.Add( schema ); schemaSet.ValidationEventHandler += SchemaValidationCallBack; XmlReaderSettings settings = new XmlReaderSettings(); settings.Schemas = schemaSet; settings.ValidationType = ValidationType.Schema; XmlDocument doc = new XmlDocument(); using( XmlReader reader = XmlReader.Create( xmlPath, settings ) ) { doc.Load( reader ); // <-- This line throws an exception if XML is ill-formed reader.Close(); } doc.Validate( SchemaValidationCallBack );// <-- This is never reached } private void SchemaValidationCallBack( object sender, ValidationEventArgs e ) { Console.WriteLine( "SchemaValidationCallBack: " + e.Message ); } How do I get the callback to be called so I can handle validation errors? Thanks for your help!

  Read the article

• Why would this Lua optimization hack help?

  - by Ian Boyd

  i'm looking over a document that describes various techniques to improve performance of Lua script code, and i'm shocked that such tricks would be required. (Although i'm quoting Lua, i've seen similar hacks in Javascript). Why would this optimization be required: For instance, the code for i = 1, 1000000 do local x = math.sin(i) end runs 30% slower than this one: local sin = math.sin for i = 1, 1000000 do local x = sin(i) end They're re-declaring sin function locally. Why would this be helpful? It's the job of the compiler to do that anyway. Why is the programmer having to do the compiler's job? i've seen similar things in Javascript; and so obviously there must be a very good reason why the interpreting compiler isn't doing its job. What is it? i see it repeatedly in the Lua environment i'm fiddling in; people redeclaring variables as local: local strfind = strfind local strlen = strlen local gsub = gsub local pairs = pairs local ipairs = ipairs local type = type local tinsert = tinsert local tremove = tremove local unpack = unpack local max = max local min = min local floor = floor local ceil = ceil local loadstring = loadstring local tostring = tostring local setmetatable = setmetatable local getmetatable = getmetatable local format = format local sin = math.sin What is going on here that people have to do the work of the compiler? Is the compiler confused by how to find format? Why is this an issue that a programmer has to deal with? Why would this not have been taken care of in 1993? i also seem to have hit a logical paradox: Optimizatin should not be done without profiling Lua has no ability to be profiled Lua should not be optimized

  Read the article

• why limxml2 quotes starting double slash in CDATA with javascript

  - by Vincenzo

  This is my code: <?php $data = <<<EOL <?xml version="1.0"?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html> <script type="text/javascript"> //<![CDATA[ var a = 123; // JS code //]]> </script> </html> EOL; $dom = new DOMDocument(); $dom->preserveWhiteSpace = false; $dom->formatOutput = false; $dom->loadXml($data); echo '<pre>' . htmlspecialchars($dom->saveXML()) . '</pre>'; This is result: <?xml version="1.0"?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <script type="text/javascript"><![CDATA[ //]]><![CDATA[ var a = 123; // JS code //]]><![CDATA[ ]]></script></html> If and when I remove the DOCTYPE notation from XML document, CDATA works properly and leading/trailing double slash is not turned into CDATA. What is the problem here? Bug in libxml2? PHP version is 5.2.13 on Linux. Thanks.

  Read the article

• beautifulsoup can't find exist href in file

  - by young001

  I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&amp;gsid=3_5bce9b871484d3af90c89f37">next_page</a> &nbsp;<input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" />&nbsp;1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

  Read the article

• How someone using my Facebook website app can post to their pages timeline

  - by user1334414

  I have a website where businesses create content through a PHP backend system. Each time they create a new piece of content, I want it to publish to their Facebook pages timeline (not the users timeline). I have created the authenticate code: <div id="fb-root"></div> <script> window.fbAsyncInit = function() { FB.init({ appId : 'XXXXXXXXXX', status : true, cookie : true, xfbml : true, oauth : true, }); }; (function(d){ var js, id = 'facebook-jssdk'; if (d.getElementById(id)) {return;} js = d.createElement('script'); js.id = id; js.async = true; js.src = "//connect.facebook.net/en_US/all.js"; d.getElementsByTagName('head')[0].appendChild(js); }(document)); </script> <div class="fb-login-button" scope="manage_pages"> Login with Facebook </div> With manage_pages as a scope. I need to know how they can select which page they want the post to go to (if they have more than 1 page), and also how to automatically post to that pages wall when they submit the content (which is done via a PHP form). Thanks

  Read the article

• Count the no of LI then add class to parent UL.

  - by Wazdesign

  <ul class="taglib-ratings thumbs"> <li id="qezr_yourRating"> <a href="javascript:;" class="rating rate-up "></a> </li> </ul> <ul class="taglib-ratings thumbs"> <li id="qezr_yourRating"> <a href="javascript:;" class="rating rate-up "></a> </li> <li id="qezr_yourRating"> <a href="javascript:;" class="rating rate-up "></a> </li> </ul> I want to apply the class to the UL on base of the Count of the Inner LIs. Like if it has two LI then the class should be like two-thumbs Like if it has one LI then the class should be like one-thumbs I am trying this JS but not working it returns 2 jQuery(document).ready(function(){ var countLi = $(".taglib-ratings > li").size(); alert(countLi); if(countLi == 2) { $(this).parent('.taglib-ratings').addClass('2-col'); alert ('this ul has 2 li'); } else if(countLi == 1) { $(this).parent('.taglib-ratings').addClass('2-col'); alert ('this ul has 1 li'); } else if(countLi > 2) { alert ('this ul has'+ countLi +' li'); } }); Here is the JSbin link to the same. http://jsbin.com/ofeda/edit

  Read the article

• jquery animate from object center

  - by mtwallet

  Hi. I am trying to create a product viewer similar to the one at the bottom of this page http://www.logitech.com/en-gb/. As you can see the product animates from the center rather than top left which I think is Jquery's default. So what I am doing is trying animate the width and height and then also the offset to make it look like it animates from the center. My code looks like this: <style> body { background: black; } .box { background: #fff url('pic.jpg') no-repeat 0 0; width: 200px; height: 200px; margin: 10px 4%; float: left; } </style> <script type="text/javascript"> $(document).ready(function() { $(".box").hover(function() { $(".box").not(this).fadeTo(500, 0.5); $(this).animate({ width: 300, height: 300, left: -100, top: -100 }, 500); }, function() { $(this).animate({ width: 200, height: 200, left: 100, top: 100 }, 500); $(".box").fadeTo(500, 1); }); }); </script> I cannot seem to get this working as I want. Can anyone help with this or suggest a better technique? Many thanks

  Read the article

• Checking whether images loaded after page load

  - by johkar

  Determining whether an image has loaded reliably seems to be one of the great JavaScript mysteries. I have tried various scripts/script libraries which check the onload and onerror events but I have had mixed and unreliable results. Can I reliably just check the complete property (IE 6-8 and Firefox) as I have done in the script below? I simply have a page wich lists out servers and I link to an on.gif on each server. If it doesn't load I just want to load an off.gif instead. This is just for internal use...I just need it to be reliable in showing the status!!! <script type="text/javascript"> var allimgs = document.getElementsByTagName('img'); function checkImages(){ for (i = 0; i < allimgs.length; i++){ var result = Math.random(); allimgs[i].src = allimgs[i].src + '?' + result; } serverDown(); setInterval('serverDown()',5000); } window.onload=checkImages; function serverDown(){ for (i = 0; i < allimgs.length; i++){ var imgholder=new Image(); imgholder.src=allimgs[i].src; if(!allimgs[i].complete){ allimgs[i].src='off.gif'; } } } </script>

  Read the article

• Anchor as a Submit button

  - by griegs

  I have an MVC 2 application that has the following on it; <% using( Html.BeginForm("Results","Quote", FormMethod.Post, new { name="Results" })){ %> <% Html.RenderPartial("Needs", Model.needs); %> <div class="But green" style=""> <a href="." onclick="javascript:document.Results.submit();">Go</a> </div> <input type="submit" /> <%} %> Pressing the Submit button or the anchor both post back to the right ActionResult. However, when in the controller I return View(stuff..) only the Submit button will come back to the page. When the call finishes from pressing the anchor, I go to an error page informing me that the resource cannot be found. I suspect it has something to do with href="." but am unsure what to set it to.

  Read the article

• JSP: Refresh ComboBox options

  - by framara

  Hi, There's a class 'Car' with brand and model as properties. I have a list of items of this class List<Car> myCars. I need to represent in a JSP website 2 ComboBox, one for brand and another for model, that when you select the brand, in the model list only appear the ones from that brand. I don't know how to do this in a dynamic way. Any suggestion where to start? Thanks Update Ok, what I do now is send in the request a list with all the brand names, and a list of the items. The JSP code is like: <select name="manufacturer" id="id_manufacturer" onchange="return getManufacturer();"> <option value=""></option> <c:forEach items="${manufacturers}" var="man"> <option value="${man}" >${man}</option> </c:forEach> </select> <select name="model" id="id_model"> <c:forEach items="${mycars}" var="car"> <c:if test="${car.manufacturer eq man_selected}"> <option value="${car.id}">${car.model}</option> </c:if> </c:forEach> </select> <script> function getManufacturer() { man_selected = document.getElementById('id_manufacturer').value; } </script> How do I do to refresh the 'model' select options according to the selected 'man_selected' ?

  Read the article

• I would like to interactively detect when an ActiveX component has been installed, and asynchronousl

  - by Brian Stinar

  Hello, I am working on a website, and I would like to refresh a portion of the page after an ActiveX component has been installed. I have a general idea of how to do this with polling, which I am working on getting going : function detectComponentThenSleep(){ try{ // Call what I want ActiveX for, if the method is available, or // ActiveXComponent.object == null --- test for existance document.getElementById("ActiveXComponent").someMethod(); } catch{ // Try again, if the method is not available setTimeout(detectComponentThenSleep, 100); } } However, what I would REALLY like to do is something like this: ActiveXObject.addListener("onInstall", myfunction); I don't actually have the source for the ActiveX component, but I have complete control of the page I am hosting it on. I would like to use JavaScript, if possible, to accomplish this. So, my question is 1.) will this actually work with the polling method? and 2.) Is there an interrupt/listener like way of doing this? I am sure I am missing something with connecting the dots here, I can already detect if the component is present, but I am having trouble doing this asynchronously. Thank you very much for your time and help, -Brian J. Stinar-

  Read the article

• How do I use a jQuery not selector to select relative URLs?

  - by Matt

  I'm working on a little jQuery script to add Google Analytics pageTracker onclick data to all relative URLs on my forum, allowing me to track clicks to external sites. I don't want to add the onclick to internal links on forum.sitename or sitename, and I don't want to add them to any hrefs marked # or that start with /. My script below works nicely, but for one minor problem! All of the forum's URLs are relative and don't start with /. I appear to have no way to change that, so need to modify the jQuery below to prevent it adding the onclick to links like as it currently does. What I want to do, is to write a .not() function like .not("[href!^=http") to prevent jQuery from adding the onclick to any hrefs which do not start with http. However, .not() appears not to support this. I'm new to jQuery and can't figure this out. Any pointers would be massively appreciated. $(document).ready(function(){ // Get URL from a href var URL = $("a").attr('href'); // Add pageTracker data for GA tracking $("a") .not("[href^=#]") .not("[href^=http://forum.sitename]") .not("[href^=http://www.sitename]") .attr("onclick","pageTracker._trackEvent('Outgoing_Links', 'Forum', " + URL + ");") ; }); Thanks!

  Read the article

• [jquery] multiple resizables acting strange

  - by Noweem

  Hi there everyone, I'm trying to place multiple resizable and draggable div's on one page that move (vertically) inside their own parent div. you can take a look at http://bit.ly/bCutBE However, these div's act really strange when I want to resize them, especially from the north side, they kind of move out of the screen very fast, while they shouldn't be able to get outside the parent div. I only want the div to be able to move and resize vertically inside it's parent, the dragging-part works pretty good, but the resize part give this problem. I can't really describe it better than this, but take a look for yourself and it will be clear immediately when you try to resize one of the coloured div's: move it a little downwards and try to resize it from the north side. the problem seems to be caused by the containment: 'parent', line of the resizable. when I delete this line it works fine, but then the coloured blocks don't stay in their parent, and I want them to stay inside their parent. I hope someone can help me with this... the jquery code I used: $(document).ready(function(){ $(".move") .draggable({ containment: 'parent', grid: [50,50], axis: 'y' }) .resizable({ containment: 'parent', grid: [50,50], handles: 'n, s', minHeight: 50 }); });

  Read the article

• jquery ajax post not working with .load in codeigniter

  - by bravo

  i wish to .load multiple views result with jquery ajax the original code (js) $(document).ready(function(){ $("#uid").change( function(){ var uid=$("#uid").val(); $.ajax({ type: "POST", url: "<?= site_url('sp_profile/ajax_userdetail') ?>", dataType: "json", data: "uid="+uid, cache:false, success: function(data){ $("#content").html(data); } }); return false; }); }); this return only one result in what if i want to load 3 results like in <div id="content"></div> <div id="content1"></div> <div id="content2"></div> content could be userid content2 could be user first name content3 could be user last name my js should using .load instead of html right? let me know if i'm wrong. success: function(data){ $("#content").load("<?= site_url('sp_profile/ajax_userdetail')?>"); $("#content2").load("<?= site_url('sp_profile/ajax_userdetail')?>"); $("#content3").load("<?= site_url('sp_profile/ajax_userdetail')?>"); } i stuck with this thing for whole day.. please anyone show me the right way to do the controller and js code.

  Read the article

< Previous Page | 543 544 545 546 547 548 549 550 551 552 553 554  | Next Page >