Search Results

Search found 19305 results on 773 pages for 'above the gods'.

Page 55/773 | < Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >

• Render Order via HTML or CSS

  - by Bullines

  What is the best practice is in the case of altering the render order of elements on a webpage. For example, I have two DIVs that are to be displayed on a page: <div id="appleSection"> <!-- Apple DIVs, content, form elements, etc --> </div> <div id="orangeSection"> <!-- Orange DIVs, content, form elements, etc --> </div> Depending on user selection (perhaps by country or something), the order which the DIVs are presented to the user can differ. Certain conditions present appleSection above orangeSection, and for other conditions, their order is reversed. If the core logic of the page is the same regardless, is it a best practice to determine order on the server-side (perhaps via two pages that differ in the order of the DIVs), or is it more appropriate to have just a single page and use CSS to control whether appleSection is above orangeSection or vice versa?

  Read the article

• Declare global variables for a batch of execution statements - sql server 2005

  - by Shrewd Demon

  hi, i have an SQL statement wherein i am trying to update the table on the client's machine. the sql statement is as follows: BEGIN TRANSACTION DECLARE @CreatedBy INT SELECT @CreatedBy = [User_Id] FROM Users WHERE UserName = 'Administrator' --//////////////////////////////////////////////////////////////////// --//////////////////////////////////////////////////////////////////// PRINT @CreatedBy --(Works fine here and shows me the output) PRINT N'Rebuilding [dbo].[Some_Master]' ALTER TABLE [dbo].[Some_Master] ADD [CreatedBy] [BIGINT] NULL, [Reason] [VARCHAR](200) NULL GO PRINT @CreatedBy --(does not work here and throws me an error) PRINT N'Updating data in [Some_Master] table' UPDATE Some_Master SET CreatedBy = @CreatedBy COMMIT TRANSACTION but i am getting the following error: Must declare the scalar variable "@CreatedBy". Now i have observed if i write the Print statement above the alter command it works fine and shows me its value, but if i try to print the value after the Alter command it throws me the error i specified above. I dont know why ?? please help! Thank you

  Read the article

• question related to UINavigation

  - by user217572

  (void)setHidesBackButton:(BOOL)hidesBackButton animated:(BOOL)animated can any 1 tell me the meaning of above statement with example?????????????

  Read the article

• Deferred printing in Java

  - by Bober02

  I have a specific issue with general console printing and I was wondering whether anyone has a solution for it. I am trying to print a dataTable which would look like sth like this: Table ---------------------- Name |Surname | ---------------------- Mike |Mikhailowish| Rafaello|Mirena | and so on. In order to print the border of the bar I need to know what the maximum length of each column value is. I don't want to go through the whole database to find that out and then again to print it. I would rather like to do sth like: System.out.printLater(s); //herejust leave a pointer to a StringBuilder you will build ... s.append("--------"); ... System.out.printAllDeferred(); I understand the above is probably in 99.99999% chances impossible, but perhaps you guys have a clever way of achieving the above?

  Read the article

• String Object. Clarification needed

  - by mac

  Guys, help me clarify. Say i have the following line in my program: jobSetupErrors.append("abc"); In the case above where jobSetupErrors is a StringBuilder(), what i see happen is: New String Object is created and assigned value "abc" value of that String object is assigned to the existing StringBuilder object If that is correct, and I add 1 more line ... jobSetupErrors.append("abc"); logger.info("abc"); In the above example are we creating String object separately 2 times? If so, would it be more proper to do something like this? String a = "abc"; jobSetupErrors.append(a); logger.info(a); Is this a better approach? Please advise

  Read the article

• ASP.NET Template Selector/Builder - Dynamic CMS

  - by Ugene

  I am currently building my own CMS for various reasons that could take a long to explain... However i am looking for a dynamic solution to create templates for pages within the CMS and all areas must be editable via the administration area, maybe large text areas broken into multiple areas, text and image area on a page etc. Following on from the above i would like to create the following: Create a new page (selecting a pre-defined template like below) http://img525.imageshack.us/img525/9872/nestedpages.png and then upon editing the page it would have created as many text editors required for each editable region or a file upload control for an image area for example. i am thinking of using nested masterpages for the design elements, just unsure the best-practice way to achieve the above (db structure etc) I somehow hope this provides enough information but are happy to answer any questions you may have. Thanks

  Read the article

• need to changed markup with jquery

  - by user357034

  I have the following markup which I do not have direct access to... <a href="javascript:void(0);" onclick="window.open('/BulkDiscounts.asp?ProductID=318&ProductCode=' + escape('LB30X40ES') + '&Orig_Price=22.95', 'Discounts', 'scrollbars,status,resizable,width=330,height=300');"><iimg src="/v/vspfiles/templates/100/images/buttons/btn_quantitydiscounts.gif" border="0" align="absmiddle"></a> I need to "rewrite" the above as follows... A few things to point out is that the title is coming from a variable escape(global_Current_ProductCode) variable=productcode in the case above it is LB30X40ES The height and weight, price and product id used in the second markup must be from the first markup. Note that these change depending on the product loaded. These are not constants. I would guess the first thing to do was to add the thickbox class. Then I am lost as to what to do next. Basically I need to open up an thickbox iframe with the modified markup.

  Read the article

• Need to create regular expression in Javascript to check the valid conditional string

  - by user1796078

  I want to create the regular expression in javascript which will check the valid conditional string like -1 OR (1 AND 2) AND 1 -1 OR (1 AND 2) -1 OR 2 -1 OR 1 OR 1 -1 AND 1 AND 1 The string should not contain 'AND' and 'OR'. For example - 1 OR 2 AND 3 is invalid. -It should be (1 OR 2) AND 3 or 1 or (2 AND 3). I tried the following Regex. It works for most of the conditions but it is failing to check the above condition. /^(\s*\(\d+\s(AND|OR)\s\d+\)|\s*\d+)((\s*(AND|OR)\s*)(\(\d+\s(AND|OR)\s\d+\)|\s*\d+))*$/ Can anyone please help me to sort out the above problem.

  Read the article

• (iphone) am I creating a leak when creating a new image from an image?

  - by Eugene

  Hi, I have following code as UIImage+Scale.h category. -(UIImage*)scaleToSize:(CGSize)size { UIGraphicsBeginImageContext(size); [self drawInRect:CGRectMake(0, 0, size.width, size.height)]; // is this scaledImage auto-released? UIImage* scaledImage = UIGraphicsGetImageFromCurrentImageContext(); UIGraphicsEndImageContext(); return scaledImage; } I use image obtained as above and use it as following. UIImage* image = [[UIImage alloc] initWithData: myData]; image = [image scaleToSize: size]; <- wouldn't this code create a leak since image(before scaling) is lost somewhere? i guess above codes work fine if image was first created with auto-release. But if image was created using 'alloc', it would create a leak in my short knowledge. How should I change scaleToSize: to guard against it? Thank you

  Read the article

• GROUP BY on multiple columns

  - by Tams

  I have a table that looks like the following - Id Reference DateAttribute1 DateAttribute2 1 MMM005 2011-09-11 2012-09-10 2 MMM005 2012-06-13 2012-09-10 3 MMM006 2012-08-22 2012-09-10 4 MMM006 2012-08-22 2012-09-11 I have handle to the id values. I would like to query such that I get the following result Id Reference DateAttribute1 DateAttribute2 2 MMM005 2012-06-13 2012-09-10 4 MMM006 2012-08-22 2012-09-11 I would like my result to be grouped by reference and then 'DateAttribute1' and then 'DateAttribute2' as such - DateAttribute1 has a priority over DateAttribute2 as you can see above in the result. How should I write my query to fetch the results in the above manner? Any solution?

  Read the article

• MYSQL - SQL query Getting single record for the similar records and populating other columns with which has more length

  - by Bujji

  Here is my case , I have a database table with below fields name place_code email phone address details estd others and example data if you look at the above example table First three records are talking about XYZ and place code 1020 . I want create a single record for these three records based on substring(name,1,4) place_code ( I am lucky here for all the similar records satisfies this condition and unique in the table .) For the other columns which record column length has max . For example again for the above 3 records email should be [email protected] , phone should be 657890 and details should be "testdetails" This should be done for all the table . (Some has single records and some has max 10 records ) Any help on query that helps me to get the desired result ? Thank You Regards Kiran

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• if non zero elements in same column count only once

  - by George

  I want to check the elements above the main diagonal and if I found non zero values , count one. If the non zero values are found in the same column ,then count just one ,not the number of the non zero values. For example , it should be count = 2 and not 3 in this example because 12 and 6 are in the same column. A= 1 11 12 4 5 6 0 7 0 #include <stdio.h> #include <stdlib.h> #include <math.h> int main( int argc, const char* argv[] ){ int Rows = 3 , Cols = 3; float *A = (float *) malloc ( Rows * Cols * sizeof (float) ); A[0] = 1.0; A[1] = 11.0; A[2] = 12.0; A[3] = 4.0; A[4] = 5.0; A[5] = 6.0; A[6] = 0.0; A[7] = 7.0; A[8] = 0.0; // print input matrix printf("\n Input matrix \n\n"); for ( int i = 0; i < Rows; i++ ) for ( int j = 0; j < Cols; j++ ) { printf("%f\t",A[ i * Cols + j ]); if( j == Cols-1 ) printf("\n"); } printf("\n"); int count = 0; for ( int j = 0 ; j < Cols; j++ ) { for ( int i = ( Rows - 1 ); i >= 0; i-- ) { // check the diagonal elements above the main diagonal if ( j > i ) { if ( ( A[ i * Cols + j ] != 0 ) ) { printf("\n Above nonzero Elmts = %f\n",( A[i * Cols + j] ) ); count++; } } } } printf("\ncount = %d\n",count ); return 0; }

  Read the article

• Executing ffmpeg from php running in apache

  - by foobar

  I was executing ffmpeg from php running inside apache. I used to get the error " error while loading shared libraries: libavdevice.so.52: cannot open shared object file: No such file or directory". It used to work perfectly if the php script was executed from the command prompt or ffpmeg was directly invoked from the command prompt. I followed the below steps to fix the apache error: Step 1: Check if the file “libavdevice.so.52? exists in the server using the following command. find / -name ‘libavdevice.so.*’ Step 2: You will get the directory in which the file “libavdevice.so.52? exists from the above command. Suppose the directory is “/usr/local/lib/” in this example. Step 3: You have to add the directory name in the file “/etc/ld.so.conf”. Step 4: Execute the command “ldconfig”. How did doing the above make a difference to apache?

  Read the article

• Calling a webservice synchronously from a Silverlight 3 application?

  - by Lasse V. Karlsen

  I am trying to reuse some .NET code that performs some calls to a data-access-layer type service. I have managed to package up both the input to the method and the output from the method, but unfortunately the service is called from inside code that I really don't want to rewrite in order to be asynchronous. Unfortunately, the webservice code generated in Silverlight only produces asynchronous methods, so I was wondering if anyone had working code that managed to work around this? I tried the recipe found here: The Easy Way To Synchronously Call WCF Services In Silverlight, but unfortunately it times out and never completes the call. Or rather, what seems to happen is that the completed event handler is called, but only after the method returns. I am suspecting that the event handler is called from a dispatcher or similar, and since I'm blocking the main thread here, it never completes until the code is actually back into the GUI loop. Or something like that. Here's my own version that I wrote before I found the above recipe, but it suffers from the same problem: public static object ExecuteRequestOnServer(Type dalInterfaceType, string methodName, object[] arguments) { string securityToken = "DUMMYTOKEN"; string input = "DUMMYINPUT"; object result = null; Exception resultException = null; object evtLock = new object(); var evt = new System.Threading.ManualResetEvent(false); try { var client = new MinGatServices.DataAccessLayerServiceSoapClient(); client.ExecuteRequestCompleted += (s, e) => { resultException = e.Error; result = e.Result; lock (evtLock) { if (evt != null) evt.Set(); } }; client.ExecuteRequestAsync(securityToken, input); try { var didComplete = evt.WaitOne(10000); if (!didComplete) throw new TimeoutException("A data access layer web service request timed out (" + dalInterfaceType.Name + "." + methodName + ")"); } finally { client.CloseAsync(); } } finally { lock (evtLock) { evt.Close(); evt = null; } } if (resultException != null) throw resultException; else return result; } Basically, both recipes does this: Set up a ManualResetEvent Hook into the Completed event The event handler grabs the result from the service call, and signals the event The main thread now starts the web service call asynchronously It then waits for the event to become signalled However, the event handler is not called until the method above has returned, hence my code that checks for evt != null and such, to avoid TargetInvocationException from killing my program after the method has timed out. Does anyone know: ... if it is possible at all in Silverlight 3 ... what I have done wrong above?

  Read the article

• google app engine db.Model in python only display user-defined fields

  - by MattM

  I'm a python newbie so I apologize in advance if this question has been asked before. I am building out an application in GAE and need to generate a report that contains the values for a user-defined subset of fields. For example, in my db model, CrashReport, I have the following fields: entry_type entry_date instance_id build_id crash_text machine_info I present a user with the above list as a checkbox group from which they select. Whichever fields the user selects, I then create a report showing all the values in the datastore, but only for the fields that they selected. For example, if from the above list, the user selects the build_id and crash_text fields, the output might look like this: build_id crash_text 0.8.2 blown gasket 0.8.2 boom! 0.8.1 crack! ... So the question is, how exactly do I only access the values for the fields which the user has defined?

  Read the article

• Database table schema design - varchar(n). Suitable choice of N

  - by morpheous

  Coming from a C background, I may be getting too anal about this and worrying unnecessarily about bits and bytes here. Still, I cant help thinking how the data is actually stored and that if I choose an N which is easily factorizable into a power of 2, the database will be more effecient in how it packs data etc. Using this "logic", I have a string field in a table which is a variable length up to 21 chars. I am tempted to use 32 instead of 21, for the reason given above - however now I am thinking that I am wasting disk space because there will be space allocated for 11 extra chars that are guaranteed to be never used. Since I envisage storing several tens of thousands of rows a day, it all adds up. Question: Mindful of all of the above, Should I declare varchar(21) or varchar(32) and why?

  Read the article

• How to model a relationship that NHibernate (or Hibernate) doesn’t easily support

  - by MylesRip

  I have a situation in which the ideal relationship, I believe, would involve Value Object Inheritance. This is unfortunately not supported in NHibernate so any solution I come up with will be less than perfect. Let’s say that: “Item” entities have a “Location” that can be in one of multiple different formats. These formats are completely different with no overlapping fields. We will deal with each Location in the format that is provided in the data with no attempt to convert from one format to another. Each Item has exactly one Location. “SpecialItem” is a subtype of Item, however, that is unique in that it has exactly two Locations. “Group” entities aggregate Items. “LocationGroup” is as subtype of Group. LocationGroup also has a single Location that can be in any of the formats as described above. Although I’m interested in Items by Group, I’m also interested in being able to find all items with the same Location, regardless of which group they are in. I apologize for the number of stipulations listed above, but I’m afraid that simplifying it any further wouldn’t really reflect the difficulties of the situation. Here is how the above could be diagrammed: Mapping Dilemma Diagram: (http://www.freeimagehosting.net/uploads/592ad48b1a.jpg) (I tried placing the diagram inline, but Stack Overflow won't allow that until I have accumulated more points. I understand the reasoning behind it, but it is a bit inconvenient for now.) Hmmm... Apparently I can't have multiple links either. :-( Analyzing the above, I make the following observations: I treat Locations polymorphically, referring to the supertype rather than the subtype. Logically, Locations should be “Value Objects” rather than entities since it is meaningless to differentiate between two Location objects that have all the same values. Thus equality between Locations should be based on field comparisons, not identifiers. Also, value objects should be immutable and shared references should not be allowed. Using NHibernate (or Hibernate) one would typically map value objects using the “component” keyword which would cause the fields of the class to be mapped directly into the database table that represents the containing class. Put another way, there would not be a separate “Locations” table in the database (and Locations would therefore have no identifiers). NHibernate (or Hibernate) do not currently support inheritance for value objects. My choices as I see them are: Ignore the fact that Locations should be value objects and map them as entities. This would take care of the inheritance mapping issues since NHibernate supports entity inheritance. The downside is that I then have to deal with aliasing issues. (Meaning that if multiple objects share a reference to the same Location, then changing values for one object’s Location would cause the location to change for other objects that share the reference the same Location record.) I want to avoid this if possible. Another downside is that entities are typically compared by their IDs. This would mean that two Location objects would be considered not equal even if the values of all their fields are the same. This would be invalid and unacceptable from the business perspective. Flatten Locations into a single class so that there are no longer inheritance relationships for Locations. This would allow Locations to be treated as value objects which could easily be handled by using “component” mapping in NHibernate. The downside in this case would be that the domain model becomes weaker, more fragile and less maintainable. Do some “creative” mapping in the hbm files in order to force Location fields to be mapped into the containing entities’ tables without using the “component” keyword. This approach is described by Colin Jack here. My situation is more complicated than the one he describes due to the fact that SpecialItem has a second Location and the fact that a different entity, LocatedGroup, also has Locations. I could probably get it to work, but the mappings would be non-intuitive and therefore hard to understand and maintain by other developers in the future. Also, I suspect that these tricky mappings would likely not be possible using Fluent NHibernate so I would use the advantages of using that tool, at least in that situation. Surely others out there have run into similar situations. I’m hoping someone who has “been there, done that” can share some wisdom. :-) So here’s the question… Which approach should be preferred in this situation? Why?

  Read the article

• ActionScript Parameter Filtering

  - by TheDarkIn1978

  i'm setting up a custom class that accepts some Number parameters, but i need to limit those parameters and would like to know the best way of doing so. currently, i'm simply calling if statements, and throwing an error if the number is above or below what's accepted. for example, there is a parameter that accepts and angle, but only between 0 and 90. in the case i've typed it as a uint so now i only have to check to see if it's above 90. there's also a parameter Number typed parameter that only accepts values between the range of 0.0 and 1.0. is my method of using if statements and throwing erros the usual way of filtering parameters?

  Read the article

• Creating a Drop-Down Menu with Javascript

  - by iceteea

  Question about logics here: What's the most elegant way to make the menu appear/disappear onmouseover/onmouseout? See the following JsBin: http://jsbin.com/owayeb/edit#source The Menu is hidden by default. If the user moves his cursor above the Link the showme() function gets called. When the user moves his cursor away the hideme() functions gets called. How would I get the Menu to persist while the user moves his mouse away from the Link to above the Menu? Or is this all the wrong school of thought?

  Read the article

• Best of both worlds: arrow keys for cursor movement or flipping through buffers.

  - by dreeves

  I really like this vim trick to use the left and right arrows to flip between buffers: "left/right arrows to switch buffers in normal mode map <right> :bn<cr> map <left> :bp<cr> (Put that in ~/.vimrc) But sometimes I'm munching on a sandwich or something when scrolling around a file and I really want the arrow keys to work normally. I think what would make most sense is for the arrow keys to have the above buffer-flipping functionality only if there are actually multiple buffers open. Is there a way to extend the above to accomplish that?

  Read the article

• Database Documentation with `SQL Doc 2`

  - by mehdi lotfi

  I use SQL Doc 2 for documentation my database. But this tools not support following expect : Add diagrams in documentation. Add Additional description for each object such as tables, columns and etc. Customize output format. Add custom link for each object. Add Analyze business description of created tables, columns and etc Some time need to explain records of each table such as records of literal tables. How Can support above request in SQL Doc 2? Do exists a tools for documentation database with above request?

  Read the article

• Need VB code for copying data from an excel sheet to another excel sheet in "sheet2"bcoz I already h

  - by Sweety

  I need a VB code for the above question.Please help.

  Read the article

• Do not want Form to display over other application windows

  - by Cat

  I am displaying a Form from one process by passing the Show method a window handle from another process. I only want this new Form to display above the passed Form, like a MessageBox. However, this newly launched Form appears above other application windows, despite: Setting Process.WindowStyle.Hidden to the Form-displaying process Overriding the ShowWithoutActivation and CreateParams properties of the Form. Making sure Form.TopMost is not true I have checked that the window handle is valid from the second process. Focus is not stolen, however. Process A: Pass (Form) window handle to a new Process B via the command line Process B: Display a new Form using Form.Show(anotherProcessWindowHandle)

  Read the article

• AngularJS: Better way to display success messages

  - by Sup

  $('body').on('click', '#save-btn', function () { $('#greetingsModal').modal('show'); }); <div id="greetingsModal" class="modal hide fade" tabindex="-1" role="dialog" aria- labelledby="myModalLabel" aria-hidden="true"> <div class="alert alert-success"> <a href="../admin/Supplier" class="close" data-dismiss="alert">x</a> <strong>Well done!</strong>. </div> I want to display a popup message using the above styles whenever 'save-btn' is clicked. The above code works fine but there is a lot of time delay by doing it this way. Is there any way to display such a alert message using angular?

  Read the article

< Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >