Search Results

Search found 35991 results on 1440 pages for 'open flash chart'.

Page 551/1440 | < Previous Page | 547 548 549 550 551 552 553 554 555 556 557 558  | Next Page >

  • Have Button re-appear immediately after clicking button in ListView row

    - by Soeren
    I have 4 buttons on a page. Each button opens a modal window and let’s the user input data in a form. When the user hits the save button in the modal, a ListView appears on the page with the submitted data. The button the user clicked to open the modal window is set to visible=false, so it’s gone when the row is added to the ListView. Now there are 3 buttons and the same goes for those; when the user hits a button, a modal appears, and when the modal form is submitted, the button disappears and a row is added to the ListView. In the ListView row, there is a delete button. When this button is clicked, the row is deleted and the button that was initially clicked to add this row (and open the modal), SHOULD reappear, but it doesn’t. The row disappears, but I have to refresh the page before the button comes back. There is a ScriptManager on the masterpage, so I guess this is an AJAX partial refresh issue. I tried adding different events, but I can’t find the one that fires at the right time. I use an ObjectDataSource to fill the ListView, and the data comes from a database, wrapped in a business object. This code loads a business object in a List< and checks if the user inserted an item of a specific type. If he did, the button he used to open the modal is hidden. This works fine (maybe not the most elegant) _goals = GoalManager.GetGoalsByUser(UserID); if (_goals != null) { foreach (Goal _goalinlist in _goals) { if (_goalinlist.GoalType == 1) { Button1.Visible = false; goalid1 = true; } if (_goalinlist.GoalType == 2) { Button2.Visible = false; goalid2 = true; } if (_goalinlist.GoalType == 3) { Button3.Visible = false; goalid3 = true; } if (_goalinlist.GoalType == 4) { Button4.Visible = false; goalid4 = true; } } } As you can see, I tried setting a boolean, and then check it when the page is re-loaded. But the problem (I guess) is that the whole page isn't refreshed when the delete button is clicked in the ListView. This is the delete button in the ListView: <asp:ImageButton ID="ImageButton2" runat="server" CommandName="Delete" CausesValidation="false" ToolTip="Delete" CommandArgument='<%#Eval("GoalID")%>' ImageUrl="delete.gif" OnClientClick="return confirm('Delete this post?');" CssClass="button"/> I guess the question is, how do I make the button re-appear right after the ListView button is clicked?

    Read the article

  • How to configure a session timeout for Grails application?

    - by curd0
    In one of controllers in my Grails application I'm preserving a parameter value in a session variable like this: session.myVariable = params.myValue After that, I can access the saved value from different controllers/GSP-pages as long as I actively use the app. However, if I don't use my app for a while, even though my browser window is still open, the session variable looses it's value. Does this happens because the session expires? I was under impression that a session lives until the browser window is still open, but apparently I was wrong. What should I do to ensure all session variables I define in my Grails app don't expire until the browser is closed? Is there any way to set session timeout manually? Thank you in advance for your answers!

    Read the article

  • I keep getting a "System InvalidOperationException occurred in System Windows Forms dll" error in VB

    - by Heartrent
    I've just started learning VB.NET with VS 9.0; a small application I'm working on keeps returning an "A first chance exception of type System InvalidOperationException occurred in System Windows Forms dll" error from the Immediate Window. The application has almost zero functionality so far, it consists of a menu strip with: File About |Open |Save |Save As |Quit The only code I have written opens an Open File dialog, a Save As dialog, an About window with background sound and an OK button, and the Quit button which exits. Since there is almost no code for me to search through, I can't understand why there would be an error. The program runs just fine when I'm debugging it too.

    Read the article

  • How to fix an SSD

    - by anonymous
    I have a Samsung 128 go SSD : MZ5PA128HMCD-01000. When I'm using it : there is always I/O errors. I tried to secure-erase it. But it is impossible to create a new NTFS (or any filesystem...) partition because I still get I/O errors. I tought maybe upgrading the firmware will solve the problem. Unfortunately, I'm not able to upgrade the firmware with Samsung SSD Magician Tool ... because Magician says there is no Samsung SSD on my computer... Is there a way to make Magician recognize this Samsung MZ5PA128HMCD-01000 SSD? Is another tool available to flash any firmware on a SSD? What should I do to fix this SSD?

    Read the article

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • Why do AWS spot-instance prices spike above the "on demand" pricing?

    - by Laykes
    Amazon Pricing on Spot Instance Inconsistencies This is something which will be best explained through screenshots of a historical chart of instance pricings. If you look at a lot of the instance prices for spot instances, you will notice regular patterns of spikes. See here: As you can see, the price for this compute medium instance, regularly spikes above the on demand price. A c1.medium instance (on demand), would only cost $0.186 per hour. But for a period of a few weeks, in zone B, the price would regularly spike to $1.20. This is some 6 times the actual on demand price. It's also not isolated. If you look at zone-b again for small instances, there is a similar, spike frequently. Which goes 4x the on demand pricing. Does anyone know why this happens? Here are a few suggestions Someone entered $1.2 instead of $0.12 (I would discount this since it happened 20 times over the space of 3 weeks). Amazon regularly artifically inflate their prices by bidding on their own instances to get the most bang for their buck. (I would discount this since it would be ridiculous and bad business) Some company launched 1000 servers at once, and wants to make sure that they all launch. (I would discount this since they would presumably launch them at a price which would be below the minimum on demand price. Why would you pay above on demand for a single server?). It's a bug in their reporting?

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • Missing audio and problems playing FLV video converted from 720p .mov file with FFMPEG

    - by undefined
    I have some .mov video files recorded from a JVC GC-FM1 HD video camera in 720p mode. I have FFMPEG running on a Linux box that I upload files to and have them encoded into FLV format. The video appears to be encoding ok but there is no audio in the resulting FLV file and when I play it back in Flash Player in a browser or on Adobe Media Player, the video pauses at the start. It appears that Adobe Media Player waits for the progress bar to reach the end of the video before starting the playback - i.e. the video will load, the picture pauses, the progress bar seeks to the end as if the video was playing then when it reaches the end the video picture starts. There is no audio on the video. I am noticing this in the video player I have built with Flash 8 using an FLVPlayback component and attached seekBar. The seek bar will start moving as if the video is playing but the picture remains paused. Here are some outputs from my FFMPEG log and the command I am using to encode the video - my FFMPEG command called from PHP - $cmd = 'ffmpeg -i ' . $sourcelocation.$filename.".".$fileext . ' -ab 96k -b 700k -ar 44100 -s ' . $target['width'] . 'x' . $target['height'] . ' -ac 1 -acodec libfaac ' . $destlocation.$filename.$ext_trans .' 2>&1'; and here is the output from my error log - FFmpeg version UNKNOWN, Copyright (c) 2000-2010 Fabrice Bellard, et al. built on Jan 22 2010 11:31:03 with gcc 4.1.2 20070925 (Red Hat 4.1.2-33) configuration: --prefix=/usr --enable-static --enable-shared --enable-gpl --enable-nonfree --enable-postproc --enable-avfilter --enable-avfilter-lavf --enable-libfaac --enable-libfaad --enable-libfaadbin --enable-libgsm --enable-libmp3lame --enable-libvorbis --enable-libx264 libavutil 50. 7. 0 / 50. 7. 0 libavcodec 52.48. 0 / 52.48. 0 libavformat 52.47. 0 / 52.47. 0 libavdevice 52. 2. 0 / 52. 2. 0 libavfilter 1.17. 0 / 1.17. 0 libswscale 0. 9. 0 / 0. 9. 0 libpostproc 51. 2. 0 / 51. 2. 0 Seems stream 0 codec frame rate differs from container frame rate: 119.88 (120000/1001) -> 59.94 (60000/1001) Input #0, mov,mp4,m4a,3gp,3g2,mj2, from 'uploads/video/60974_v1.mov': Metadata: major_brand : qt minor_version : 0 compatible_brands: qt comment : JVC GC-FM1 comment-eng : JVC GC-FM1 Duration: 00:00:30.41, start: 0.000000, bitrate: 4158 kb/s Stream #0.0(eng): Video: h264, yuv420p, 640x480 [PAR 1:1 DAR 4:3], 4017 kb/s, 59.94 fps, 59.94 tbr, 90k tbn, 119.88 tbc Stream #0.1(eng): Audio: aac, 48000 Hz, stereo, s16, 128 kb/s Output #0, rawvideo, to 'uploads/video/60974_v1.jpg': Stream #0.0(eng): Video: mjpeg, yuvj420p, 320x240 [PAR 1:1 DAR 4:3], q=2-31, 200 kb/s, 90k tbn, 59.94 tbc Stream mapping: Stream #0.0 -> #0.0 Press [q] to stop encoding [h264 @ 0x8e67930]B picture before any references, skipping [h264 @ 0x8e67930]decode_slice_header error [h264 @ 0x8e67930]no frame! Error while decoding stream #0.0 [h264 @ 0x8e67930]B picture before any references, skipping [h264 @ 0x8e67930]decode_slice_header error [h264 @ 0x8e67930]no frame! Error while decoding stream #0.0 frame= 1 fps= 0 q=3.8 Lsize= 15kB time=0.02 bitrate=7271.4kbits/s dup=482 drop=0 video:15kB audio:0kB global headers:0kB muxing overhead 0.000000% Which are the important errors here - B picture before any references, skipping? decode_slice_header error? no frame? or Seems stream 0 codec frame rate differs from container frame rate: 119.88 (120000/1001) - 59.94 (60000/1001) Any advice welcome, thanks

    Read the article

  • Apache port forwarding with ZTE ZXV10 W300 router (provider specific firmware)

    - by dannote
    I'm trying to configure port forwarding for Apache 2.2 installed on Windows XP SP3 with ZTE ZXV10 W300 router. The computer has a static IP 192.168.1.2. Port forwarding is configured as following: Enable true Name Apache Protocol TCP (also tried TCP and UPD) WAN Host Start IP Address empty WAN Host End IP Address empty WAN Connection stream WAN Start Port 8080 WAN End Port 8080 LAN Host IP Address 192.168.1.2 LAN Host Start Port 8080 LAN Host End Port 8080 Port 8080 is open for both TCP and UPD in Windows Brandmauer. Apache configuration: Listen 192.168.1.2:8080 Router Firmware: Hardware Version V1.0.01 Software Version V8.0.02T03_CFA Boot Loader Version V1.1.2 The provider is COMSTAR. I'm not sure but it's said they flash routers with modified firmware. I have also tried to set up Bitcomet port forwarding on port 13514 and failed.

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Can't Install Windows 2008 R2 on Lenovo Laptop With SSD

    - by Ben
    I am trying to install Windows Server 2008 R2 on a new Lenovo X201 or T410 laptop. Setup halts with the following pop-up: A required CD/DVD device driver is missing. If you have a driver floppy disk, CD, DVD, or USB flash drive, please insert it now. Note: If the windows installation media is in the CD/DVD drive you can safely remove it for this step. The CD drive is obviously working, as it's booting from CD to get to this point. The only thing I can think is that it is to do with the fact they have SSD disks in - but that's just a guess. (Edit - One extra thing that may or may not be relevant: it's the 64 bit version of Server 2008 R2)

    Read the article

  • Install 64-bit Ubuntu or 32-bit?

    - by nitbuntu
    I'll be receiving a new notebook in a few days and was planning on running Ubuntu on it as it's compatible and the notebook has no OS pre-installed. The specifications are: Core 2 Duo, T6600, 4 GB RAM, Intel integrated graphics. I know a year or two ago, running a 64-bit version of Ubuntu was not advised due to much of the applications and plugins (e.g. Flash) only running on 32-bit. Is this still the case? Would I get better performance with 64-bit Ubuntu since I have 4 GB of RAM? Are there any downsides anymore?

    Read the article

  • Disable drop shadows around windows or the menu bar on OS X

    - by Lri
    Nocturne has an option for disabling shadows around windows. But it's only available in night mode, and changing the mode (like when opening the application) causes an annoying screen flash animation. There's no way to disable the shadow under the menu bar either. MacThemes Forum / Removing the menubar dropshadow has a link to a .psd for making special desktop backgrounds that cancel out the shadow under the menu bar. But it only works if that area of the desktop picture has a low enough brightness. Some applications that cover the desktop (like DeskShade) also cover the menu bar's shadow. That's not a real solution though. Unsanity's ShadowKiller stopped working in either 10.5 or 10.6. (It does still work on 10.7.2, but the website says "NOT compatible with Mac OS X 10.6 Leopard", and I couldn't get it to work on a 10.6 installation.) Related: How do I decrease the window shadow in Mac OS X? - Super User

    Read the article

  • gdb+osx: no output when using printf/CFShow

    - by yairchu
    I attached to a program with gdb in OSX and I want to use CFShow in the gdb console etc. However, nothing shows up. printf shows nothing as well: (gdb) call (int) printf("Hello\n") $10 = 6 (gdb) call (int) printf("Hello World!\n") $11 = 13 Apple suggests the following tip for when attaching with gdb, to make the output appear in the gdb console: (gdb) call (void) close(1) (gdb) call (void) close(2) (gdb) shell tty /dev/ttyp1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $1 = 1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $2 = 2 In xcode's gdb console tty gives "not a tty", so I tried it in gdb in a terminal. There tty does work but after redirecting stdout there's still no output. Also no output if I direct stdout to a file.. :/ Any salvation?

    Read the article

  • Converting hierarchial data into an unordered list Programmatically using asp.net/C#

    - by kranthi
    hi everyone, I've data which looks something like this. | id | name | depth | itemId | +-----+----------------------+-------+-------+ | 0 | ELECTRONICS | 0 | NULL | | 1 | TELEVISIONS | 1 | NULL | | 400 | Tube | 2 | NULL | | 432 | LCD | 3 | 1653 | | 422 | Plasma | 3 | 1633 | | 416 | Portable electronics | 3 | 1595 | | 401 | MP3 Player | 3 | 1249 | | 191 | Flash | 2 | NULL | | 555 | CD Players | 3 | 2198 | | 407 | 2 Way Radio | 3 | 1284 | | 388 | I've a problem with | 3 | 1181 | | 302 | What is your bill pa | 3 | 543 | | 203 | Where can I find my | 3 | 299 | | 201 | I would like to make | 3 | 288 | | 200 | Do you have any job | 3 | 284 | | 192 | About Us | 3 | NULL | | 199 | What can you tell me | 4 | 280 | | 198 | Do you help pr | 4 | 276 | | 197 | would someone help co| 4 | 272 | | 196 | can you help ch | 4 | 268 | | 195 | What awards has Veri | 4 | 264 | | 194 | What's the latest ne | 4 | 260 | | 193 | Can you tell me more | 4 | 256 | | 180 | Site Help | 2 | NULL | | 421 | Where are the | 3 | 1629 | | 311 | How can I access My | 3 | 557 | | 280 | Why isn't the page a | 3 | 512 | To convert the above data into unordered list based on depth, I'm using the following code int lastDepth = -1; int numUL = 0; StringBuilder output = new StringBuilder(); foreach (DataRow row in ds.Tables[0].Rows) { int currentDepth = Convert.ToInt32(row["Depth"]); if (lastDepth < currentDepth) { if (currentDepth == 0) { output.Append("<ul class=\"simpleTree\">"); output.AppendFormat("<li class=\"root\"><span><a href=\"#\" title=\"root\">root</a></span><ul><li class=\"open\" ><span><a href=\"#\" title={1}>{0}</a></span>", row["name"],row["id"]); } else { output.Append("<ul>"); if(currentDepth==1) output.AppendFormat("<li><span>{0}</span>", row["name"]); else output.AppendFormat("<li><span class=\"text\"><a href=\"#\" title={1}>{0}</a></span>", row["name"], row["id"]); } numUL++; } else if (lastDepth > currentDepth) { output.Append("</li></ul></li>"); if(currentDepth==1) output.AppendFormat("<li><span>{0}</span>", row["name"]); else output.AppendFormat("<li><span class=\"text\"><a href=\"#\" title={1}>{0}</a></span>", row["name"], row["id"]); numUL--; } else if (lastDepth > -1) { output.Append("</li>"); output.AppendFormat("<li><span class=\"text\"><a href=\"#\" title={1}>{0}</a></span>", row["name"],row["id"]); } lastDepth = currentDepth; } for (int i = 1; i <= numUL+1; i++) { output.Append("</li></ul>"); } myliteral.text=output.ToString(); But the resulting unordered list doesnt seem to be forming properly(using which i am constructing a tree).For example "Site Help" with id '180' is supposed to appear as a direct child of "Televisions" with id '1',is appearing as a direct child of 'Flash' with id '191' using my code.so in addition to considering depth,I've decided to consider itemid as well in order to get the treeview properly.Those rows of the table with itemId not equal to null are not supposed to have a child node(i.e.,they are the leaf nodes in the tree) and all the other nodes can have child nodes. Please could someone help me in constructing a proper unordered list based on my depth,itemid coulumns? Thanks.

    Read the article

  • Calling a .NET web service (WSE 3.0, WS-Security) from JAXWS-RI

    - by elduff
    I'm writing a JAXWS-RI client that must call a .NET Web Service that is using WS-Security. The service's WSDL does not contain any WS-Security info, but I have an example soap message from the service's authors and know that I must include wsse:Security headers, including X:509 tokens. I've been researching, and I've seen example of folks calling this type of web service from Axis and CXF (in conjunction with Rampart and/or WSS4J), but nothing about using plain JAXWS-RI itself. However, I'm (unfortunately) constrained to using JAXWS-RI by my gov't client. Does anyone have any examples/documentation of doing this from JAXWS-RI? I need to ultimately generate a SOAP header that looks something like the one below - this is a sample soap:header from a .NET client written by the service's authors. (Note: I've put the 'VALUE_HERE' string in places where I need to provide my own values) <soapenv:Envelope xmlns:iri="http://EOIR/IRIES" xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xenc="http://www.w3.org/2001/04/xmlenc#"> <soapenv:Header xmlns:wsa="http://www.w3.org/2005/08/addressing"> <wsse:Security xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401- wss-wssecurity-secext-1.0.xsd"> <xenc:EncryptedKey Id="VALUE_HERE"> <xenc:EncryptionMethod Algorithm="http://www.w3.org/2001/04/xmlenc#rsa-oaep-mgf1p"/> <ds:KeyInfo xmlns:ds="http://www.w3.org/2000/09/xmldsig#"> <wsse:SecurityTokenReference> <wsse:KeyIdentifier EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" ValueType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-x509-token-profile-1.0#X509v3"> VALUE_HERE </wsse:KeyIdentifier> </wsse:SecurityTokenReference> </ds:KeyInfo> <xenc:CipherData> <xenc:CipherValue>VALUE_HERE</xenc:CipherValue> </xenc:CipherData> <xenc:ReferenceList> <xenc:DataReference URI="#EncDataId-8"/> </xenc:ReferenceList> </xenc:EncryptedKey> </wsse:Security>

    Read the article

  • Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

    - by Niraj D
    I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

    Read the article

  • Why is LOGON_USER Server Variable is blank on New Windows / New Tab?

    - by Alex Papadimoulis
    We are noticing some very strange behavior on an installation of a .NET2-based webapp on Server 2008. Our app uses "old school" Integrated Windows Authentication and simply reads the LOGIN_USER server variable from the request collection. There's a good reason for this, but that's somewhat irrelevant to the question, since the underlying WindowsAuthentication code from ASP.NET does the same thing. Anyway... When you enter the URL in the browser, it loads up just fine and displays the username (from LOGIN_USER) no problem. When you click on a link within the web app, it loads the page just fine and authenticates without any problems. When you "hard refresh" (Ctrl-F5) it also works just fine. However, when you click "open in a new window" or "open in a new tab", the LOGON_USER variable is blank Any ideas? Am I missing some IIS7 setting somewhere? Tested clients are Windows 7 with IE8 or Windows XP with IE6.

    Read the article

  • Find and free disk space that is unused but unavailable (due to file system error, etc.)

    - by Voyagerfan5761
    Sometimes I get the feeling that if an app such as μTorrent allocates files on my FAT32-formatted flash drive, but then is killed or crashes (as happens more than a few times a month), that space just disappears from my file system. Whether or not that is the case, sometimes I do get a chill from wondering if I've lost hundreds of MB in available storage due to carelessness or malfunctions. Checking my disk with WinDirStat just makes it worse, because I see the huge "<Unknown>" item at the disk root staring at me, eating up well over a gigabyte. It might be FS inefficiency (due to 32 or 64kb sector/cluster size and a lot of tiny files) or it might be a glitch... Is there a tool I can download and run to check my file system and make sure that there aren't any unused allocated blocks on the disk? I want to make sure I'm not losing any disk space to I/O errors, etc.

    Read the article

  • which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

    - by ijjo
    I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

    Read the article

  • Installing fonts

    - by Lazar
    I have "white nights" trying to install Hebrew/Arabic fonts on my level 7 (API 2.1) aka Nexus emulator. I can't understand why Google guys will want to waist my skills do something helpful for the community using Hebrew/Arabic fonts. After rw mount/remount I can do it for level 3 devices, but for Nexus - nada! Why? What can be done? Real devices guys already broke this peace of hardware, but I am sitting and looking wide eyes open like a sheep. Please make me happy and give the chance to install the fonts. That's what must be done for some of us: We need system image saved on exit for tomorrow to continue the work Open emulator to work in peace cp command included with the SDK. Thanks for any help

    Read the article

< Previous Page | 547 548 549 550 551 552 553 554 555 556 557 558  | Next Page >