Search Results

Search found 35839 results on 1434 pages for 'string utils'.

Page 556/1434 | < Previous Page | 552 553 554 555 556 557 558 559 560 561 562 563  | Next Page >

  • How to code a keyboard button to switch between 2 modes?

    - by le.shep20
    Hi! i'm doing a project, i'm not going to details but i will simplify my idea, i'm using Morse Code ( dot and dash) and i have 2 methods: convert_MorseToChar() and Convert_MorseTonum() in the convert_MorseToChar() method there is swich to compare the input from a user which will be Morse codes and mapping it to characters: private String convert_MorseToChar(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "a" break; Case "-...": MorsetoChar = "b" break; Case "-.-.": MorsetoChar = "c" break; Case "-..": MorsetoChar = "d" break; Case ".": MorsetoChar = "e" break; } } and the other method Convert_MorseToNum(), ues the SAME combinations of Morse codes but mapping them to numbers: private String Convert_MorseToNum(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "1" break; Case "-...": MorsetoChar = "2" break; Case "-.-.": MorsetoChar = "3" break; Case "-..": MorsetoChar = "4" break; Case ".": MorsetoChar = "5" break; } } now the senario is: there are 2 Textbox, one the user will write Morse codes in it and the other is for the output. The user will write dot "." and dash "-" from the keyboard and press Enter then the program will go to ONE of the 2 methods to convert the Morse codes. Now what tells the program where to go to convert?? my question is: I want to create mode key to swich between 2 modes: MorseTochar and MorseToNum. i want the down arrow key to act like a mode, when a user press the down arrow then it the program will be in MorseToChar mode, when ever the user input the program directly use the method convert_MorseToChar to convert to characters. and when the user press the down arrow agian, the prohram will swich to MorseToNum mode here when ever the user input as morsecode, the program will directly use the method Convert_MorseToNum() to convert to numbers. HOW I CAN DO THAT Pleaaaas!!! help me! Please excuse my English, English is not my native language :)

    Read the article

  • usage of try catch

    - by Muhammed Rauf K
    Which is best: Code Snippet 1 or Code Snippet 2 ? And Why? /* Code Snippet 1 * * Write try-catch in function definition */ void Main(string[] args) { AddMe(); } void AddMe() { try { // Do operations... } catch(Exception e) { } } /* Code Snippet 2 * * Write try-catch where we call the function. */ void Main(string[] args) { try { AddMe(); } catch (Exception e) { } } void AddMe() { // Do operations... }

    Read the article

  • UISearchDisplayController - how to display search result with only by scope button selected but empt

    - by billibala
    The UISearchDisplayController is very handy and implementing search is pretty straightforward. However, I bump into problem when, in my app, I want to display search result with empty search string but selected scope button. It seems like it's a must to enter some search string in order to get the search result table being initialized and displayed. Is there any ways to display search result immediately after user has picked a scope but not entered search word yet? Thanks Bill

    Read the article

  • Regex to match 0 - 999 but not blank

    - by James Cadd
    I'm working on a regex to match valid integer numbers such as the following: 0 1 99 999 However it should not allow matching an empty string. The closest I can get is: (0)|\\d{1,3} Which to me says a matching string will have either a zero or a series of digits between 1 and 3 characters long. However, empty strings still appear to match this pattern. What's the proper way to exclude empty strings from this regex?

    Read the article

  • C Programming - My program is good enough for my assignment but I know its not good

    - by Joe
    Hi there I'm just starting an assignment for uni and it's raised a question for me. I don't understand how to return a string from a function without having a memory leak. char* trim(char* line) { int start = 0; int end = strlen(line) - 1; /* find the start position of the string */ while(isspace(line[start]) != 0) { start++; } //printf("start is %d\n", start); /* find the position end of the string */ while(isspace(line[end]) != 0) { end--; } //printf("end is %d\n", end); /* calculate string length and add 1 for the sentinel */ int len = end - start + 2; /* initialise char array to len and read in characters */ int i; char* trimmed = calloc(sizeof(char), len); for(i = 0; i < (len - 1); i++) { trimmed[i] = line[start + i]; } trimmed[len - 1] = '\0'; return trimmed; } as you can see I am returning a pointer to char which is an array. I found that if I tried to make the 'trimmed' array by something like: char trimmed[len]; then the compiler would throw up a message saying that a constant was expected on this line. I assume this meant that for some reason you can't use variables as the array length when initialising an array, although something tells me that can't be right. So instead I made my array by allocating some memory to a char pointer. I understand that this function is probably waaaaay sub-optimal for what it is trying to do, but what I really want to know is: 1. Can you normally initialise an array using a variable to declare the length like: char trimmed[len]; ? 2. If I had an array that was of that type (char trimmed[]) would it have the same return type as a pointer to char (ie char*). 3. If I make my array by callocing some memory and allocating it to a char pointer, how do I free this memory. It seems to me that once I have returned this array, I can't access it to free it as it is a local variable. Many thanks in advance Joe

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Error Galleria IE7

    - by John the horn
    I am using galleria for my site [Minavet.ro][1] [1]: http://minavet.ro and this error comes up is IE7 Line:219079877 Char:2 Error:Expected identifier, string number code:0 url:http://minavet.ro Thx for your time I have given the images width and height and now the error is Line:222704333 Char:2 Error:Expected identifier, string number code:0 url:http://minavet.ro

    Read the article

  • JSON is used only for JavaScript?

    - by Bob Smith
    I am storing a JSON string in the database that represents a set of properties. In the code behind, I export it and use it for some custom logic. Essentially, I am using it only as a storage mechanism. I understand XML is better suited for this but I read that JSON is faster and preferred. Is it a good practice to use JSON if the intention is not to use the string on the client side?

    Read the article

  • MD5 hash with salt for keeping password in DB in C#

    - by abatishchev
    Could you please advise me some easy algorithm for hashing user password by MD5, but with salt for increasing reliability. Now I have this one: private static string GenerateHash(string value) { var data = System.Text.Encoding.ASCII.GetBytes(value); data = System.Security.Cryptography.MD5.Create().ComputeHash(data); return Convert.ToBase64String(data); }

    Read the article

  • List input and output audio devices in Applet

    - by Jhonny Everson
    I am running a signed applet that needs to provide the ability for the user to select the input and output audio devices ( similar to what skype provides). I borrowed the following code from other thread: import javax.sound.sampled.*; public class SoundAudit { public static void main(String[] args) { try { System.out.println("OS: "+System.getProperty("os.name")+" "+ System.getProperty("os.version")+"/"+ System.getProperty("os.arch")+"\nJava: "+ System.getProperty("java.version")+" ("+ System.getProperty("java.vendor")+")\n"); for (Mixer.Info thisMixerInfo : AudioSystem.getMixerInfo()) { System.out.println("Mixer: "+thisMixerInfo.getDescription()+ " ["+thisMixerInfo.getName()+"]"); Mixer thisMixer = AudioSystem.getMixer(thisMixerInfo); for (Line.Info thisLineInfo:thisMixer.getSourceLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Source Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}} for (Line.Info thisLineInfo:thisMixer.getTargetLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Target Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}}} } catch (Exception e) {e.printStackTrace();}} public static String AnalyzeControl(Control thisControl) { String type = thisControl.getType().toString(); if (thisControl instanceof BooleanControl) { return " Control: "+type+" (boolean)"; } if (thisControl instanceof CompoundControl) { System.out.println(" Control: "+type+ " (compound - values below)"); String toReturn = ""; for (Control children: ((CompoundControl)thisControl).getMemberControls()) { toReturn+=" "+AnalyzeControl(children)+"\n";} return toReturn.substring(0, toReturn.length()-1);} if (thisControl instanceof EnumControl) { return " Control:"+type+" (enum: "+thisControl.toString()+")";} if (thisControl instanceof FloatControl) { return " Control: "+type+" (float: from "+ ((FloatControl) thisControl).getMinimum()+" to "+ ((FloatControl) thisControl).getMaximum()+")";} return " Control: unknown type";} } But what I get: Mixer: Software mixer and synthesizer [Java Sound Audio Engine] Mixer: No details available [Microphone (Pink Front)] I was expecting the get the real list of my devices (My preferences panels shows 3 output devices and 1 Microphone). I am running on Mac OS X 10.6.7. Is there other way to get that info from Java?

    Read the article

  • How do I require that an element has either one set of attributes or another in an XSD schema?

    - by Eli Courtwright
    I'm working with an XML document where a tag must either have one set of attributes or another. For example, it needs to either look like <tag foo="hello" bar="kitty" /> or <tag spam="goodbye" eggs="world" /> e.g. <root> <tag foo="hello" bar="kitty" /> <tag spam="goodbye" eggs="world" /> </root> So I have an XSD schema where I use the xs:choice element to choose between two different attribute groups: <xsi:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema" attributeFormDefault="unqualified" elementFormDefault="qualified"> <xs:element name="root"> <xs:complexType> <xs:sequence> <xs:element maxOccurs="unbounded" name="tag"> <xs:choice> <xs:complexType> <xs:attribute name="foo" type="xs:string" use="required" /> <xs:attribute name="bar" type="xs:string" use="required" /> </xs:complexType> <xs:complexType> <xs:attribute name="spam" type="xs:string" use="required" /> <xs:attribute name="eggs" type="xs:string" use="required" /> </xs:complexType> </xs:choice> </xs:element> </xs:sequence> </xs:complexType> </xs:element> </xsi:schema> However, when using lxml to attempt to load this schema, I get the following error: >>> from lxml import etree >>> etree.XMLSchema( etree.parse("schema_choice.xsd") ) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "xmlschema.pxi", line 85, in lxml.etree.XMLSchema.__init__ (src/lxml/lxml.etree.c:118685) lxml.etree.XMLSchemaParseError: Element '{http://www.w3.org/2001/XMLSchema}element': The content is not valid. Expected is (annotation?, ((simpleType | complexType)?, (unique | key | keyref)*))., line 7 Since the error is with the placement of my xs:choice element, I've tried putting it in different places, but no matter what I try, I can't seem to use it to define a tag to have either one set of attributes (foo and bar) or another (spam and eggs). Is this even possible? And if so, then what is the correct syntax?

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • How can we define more than one table,define columns and write data in xml file ?

    - by Harikrishna
    I am writing my xml file manually. And I am writing that for storing data and retrieving data from that. I have written file like for the table PersonalInfo. <?xml version="1.0" standalone="yes"?> <PersonalInfo> <xs:schema id="PersonalInfo" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="PersonalInfo" msdata:IsDataSet="true" msdata:UseCurrentLocale="true"> <xs:complexType> <xs:choice minOccurs="0" maxOccurs="unbounded"> <xs:element name="PesonalInfo."> <xs:complexType> <xs:sequence> <!--Define Column Here....--> <xs:element name="name" type="xs:string" /> <xs:element name="address" type="xs:string" /> </xs:sequence> </xs:complexType> </xs:element> </xs:choice> </xs:complexType> </xs:element> </xs:schema> <!--First Row--> <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <!--Second Row--> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> </PersonalInfo> Please suggest any mistake with writing file here. And now I want define more than table in this file. And here I have to write data for the table like <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> Is not possible some thing writing data when defining columns EDIT : <xs:element name="name" type="xs:string",Harikrishna,Jatin.... /> <xs:element name="address" type="xs:string",India,India.... /> And how to define more than one table in a single xml file ?

    Read the article

  • Endian check in C

    - by webgenius
    Got this code snippet from some website: int num = 1; if(*(char *)&num == 1) { printf("\nLittle-Endian\n"); } else { printf("Big-Endian\n"); } Can anyone explain this step-by-step? &num - Adress of a (char *)&num - Type-cast address of a into a string *(char *)&num - Points to the first character of the string Am I missing anything here?

    Read the article

  • Filter a form using a command button on another form

    - by Shaun
    I have a form with a cmdbutton that at the moment opens another form and shows all records for several types of PartitionStyles and TrimFinishs (486 at present), I need to be able to filter the second form to show only the TrimFinish I need. Private Sub lbl600SeriesS_Click() Dim stDocName As String Dim stLinkCriteria As String stDocName = "frmModules" stLinkCriteria = "Forms!frmModules![TrimFinish] = 1" DoCmd.OpenForm stDocName, , , stLinkCriteria End Sub At the moment it shows only a new record, I know there should be 162 records using 1, what have I missed or done incorrect.

    Read the article

  • Can I make Axis2 generate a WSDL with 'unwrapped' types?

    - by Bedwyr Humphreys
    I'm trying to consume a hello world AXIS2 SOAP web service using a PHP client. The Java class is written in Netbeans and the AXIS2 aar file is generated using the Netbeans AXIS2 plugin. You've all seen it before but here's the java class: public class SOAPHello { public String sayHello(String username) { return "Hello, "+username; } } The wsdl genereated by AXIS2 seems to wrap all the parameters so that when I consume the service i have to use a crazy PHP script like this: $client = new SoapClient("http://myhost:8080/axis2/services/SOAPHello?wsdl"); $parameters["username"] = "Dave"; $response = $client->sayHello($parameters)->return; echo $response."!"; When all I really want to do is echo $client->sayHello("Dave")."!"; My question is two-fold: why is this happening? and what can I do to stop it? :) Here's are the types, message and porttype sections of the generated wsdl: <wsdl:types> <xs:schema attributeFormDefault="qualified" elementFormDefault="qualified" targetNamespace="http://soap.axis2.myhost.co.uk"> <xs:element name="sayHello"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="username" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="sayHelloResponse"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="return" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> </xs:schema> </wsdl:types> <wsdl:message name="sayHelloRequest"> <wsdl:part name="parameters" element="ns:sayHello"/> </wsdl:message> <wsdl:message name="sayHelloResponse"> <wsdl:part name="parameters" element="ns:sayHelloResponse"/> </wsdl:message> <wsdl:portType name="SOAPHelloPortType"> <wsdl:operation name="sayHello"> <wsdl:input message="ns:sayHelloRequest" wsaw:Action="urn:sayHello"/> <wsdl:output message="ns:sayHelloResponse" wsaw:Action="urn:sayHelloResponse"/> </wsdl:operation> </wsdl:portType>

    Read the article

  • Regex - find only replace occurences not touching some of them

    - by vittore
    Not very good at regex though and maybe that's a stupid question, I'm given string like "bla @a bla @a1 bla " I'm also pairs like {"a", "a2"} , {"a1", "a13"}, and am to replace @a to @a2 for first pair, and @a1 to @a13 for second one. The problem is when i use string.replace and look for @a , it also replaces @a1 but it should not. Help me with regex replace, please. Cheers

    Read the article

  • Find items is SSRS by Id

    - by chief7
    How do you find items in SSRS by ID? I tried to use the id returned by another find result, a new guid to string and small random string all of which return the same error: The ID field has a value that is not valid. --- Microsoft.ReportingServices.Diagnostics.Utilities.InvalidElementException: The ID field has a value that is not valid. Here is the code: var request = new FindItemsRequest { Conditions = new[] { new SearchCondition { Name = "ID", Value = "test"} }, Folder = "/" }; return _ssrsService .FindItems(request) .Items I'm using SSRS 2005.

    Read the article

  • Grails - Self Join

    - by WaZ
    Hi, When I write the following class, I get the following compilation error: could not resolve property How can I achive the following: class Employee{ String Name String Email Employee Manager static hasMany = [desginations:Designation] static constraints = { Name(unique:true) Email(unique:true) } Thanks, Much appreciated.

    Read the article

  • Get the type name

    - by Neir0
    How i can get full right name of generic type? For example: This code typeof(List<string>).Name return List`1 instead of List<string> How to get a right name?

    Read the article

< Previous Page | 552 553 554 555 556 557 558 559 560 561 562 563  | Next Page >