Search Results

Search found 35839 results on 1434 pages for 'string utils'.

Page 557/1434 | < Previous Page | 553 554 555 556 557 558 559 560 561 562 563 564  | Next Page >

  • Help with storing/accessing user access roles C# Winforms

    - by user222453
    Hello, firstly I would like to thank you in advance for any assistance provided. I am new to software development and have designed several Client/Server applications over the last 12 months or so, I am currently working on a project that involves a user logging in to gain access to the application and I am looking at the most efficient and "simple" method of storing the users permissions once logged in to the application which can be used throughout restricting access to certain tabs on the main form. I have created a static class called "User" detailed below: static class User { public static int _userID; public static string _moduleName; public static string _userName; public static object[] UserData(object[] _dataRow) { _userID = (int)_dataRow[0]; _userName = (string)_dataRow[1]; _moduleName = (string)_dataRow[2]; return _moduleName; } } When the user logs in and they have been authenticated, I wish to store the _moduleName objects in memory so I can control which tabs on the main form tab control they can access, for example; if the user has been assigned the following roles in the database: "Sales Ledger", "Purchase Ledger" they can only see the relevant tabs on the form, by way of using a Switch - Case block once the login form is hidden and the main form is instantiated. I can store the userID and userName variables in the main form once it loads by means of say for example: Here we process the login data from the user: DataAccess _dal = new DataAccess(); switch (_dal.ValidateLogin(txtUserName.Text, txtPassword.Text)) { case DataAccess.ValidationCode.ConnectionFailed: MessageBox.Show("Database Server Connection Failed!"); break; case DataAccess.ValidationCode .LoginFailed: MessageBox.Show("Login Failed!"); _dal.RecordLogin(out errMsg, txtUserName.Text, workstationID, false); break; case DataAccess.ValidationCode .LoginSucceeded: frmMain frmMain = new frmMain(); _dal.GetUserPrivList(out errMsg,2); //< here I access my DB and get the user permissions based on the current login. frmMain.Show(); this.Hide(); break; default: break; } private void frmMain_Load(object sender, EventArgs e) { int UserID = User._userID; } That works fine, however the _modules object contains mutiple permissions/roles depending on what has been set in the database, how can I store the multiple values and access them via a Switch-Case block? Thank you again in advance.

    Read the article

  • Weird Javascript Regex Replace Backreference Behavior

    - by arshaw
    why does the following js expression: "test1 foo bar test2".replace(/foo.bar/, "$'") result in the following string? "test1 test2 test2" is the $' in the replace string some sort of control code for including everything after the match??? this behavior was screwing with me most of the day. can anyone explain this? thanks a lot ps- this is the case in all browsers i've tested

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Need help for a complex linq query

    - by Jipy
    Ok so I've got a DataTable here's the schema DataTable dt = new DataTable(); dt.Columns.Add("word", typeof(string)); dt.Columns.Add("pronunciation", typeof(string)); The table is filled already and I'm trying to make a linq query so that i can output to the console or anywhere something like : Pronunciation : akses9~R => (list of words) I want to output the pronunciations the most common and all the words that use it.

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • Endian check in C

    - by webgenius
    Got this code snippet from some website: int num = 1; if(*(char *)&num == 1) { printf("\nLittle-Endian\n"); } else { printf("Big-Endian\n"); } Can anyone explain this step-by-step? &num - Adress of a (char *)&num - Type-cast address of a into a string *(char *)&num - Points to the first character of the string Am I missing anything here?

    Read the article

  • Bash: Correct way to Iterate over Map

    - by Lars Tackmann
    In Bash I can create a map (hashtable) with this common construction hput() { eval "$1""$2"='$3' } hget() { eval echo '${'"$1$2"'#hash}' } and then use it like this: hput capitols France Paris hput capitols Spain Madrid echo "$(hget capitols France)" But how do I best iterate over the entries in the map ?. For instance, in Java I would do: for (Map.Entry<String, String> entry : capitols.entrySet()) { System.out.println("Country " + entry.getKey() + " capital " + entry.getValue()); } is there a common way of accomplishing something similar in Bash ?.

    Read the article

  • need to display proper JP char in the output

    - by Amit
    Hello All, I am creating a string containing HTML tags and some data and storing it in 2 diff formats ( eng and Jp) and finally saving complete stirng using streamwriter in a file as HTML. Output written in English is perfect but JP output is not coming as expected ? Issue: I need to display proper JP char in the output, as of now thay are not appearing as expected..any suggestion ? Thanks in advance... Not sure but could this b b/c of encoding supported by string/stringbuilder ?

    Read the article

  • C# Spell checker Problem

    - by reggie
    I've incorporated spell check into my win forms C# project. This is my code. public void CheckSpelling() { try { // declare local variables to track error count // and information int SpellingErrors = 0; string ErrorCountMessage = string.Empty; // create an instance of a word application Microsoft.Office.Interop.Word.Application WordApp = new Microsoft.Office.Interop.Word.Application(); // hide the MS Word document during the spellcheck //WordApp.WindowState = WdWindowState.wdWindowStateMinimize; // check for zero length content in text area if (this.Text.Length > 0) { WordApp.Visible = false; // create an instance of a word document _Document WordDoc = WordApp.Documents.Add(ref emptyItem, ref emptyItem, ref emptyItem, ref oFalse); // load the content written into the word doc WordDoc.Words.First.InsertBefore(this.Text); // collect errors form new temporary document set to contain // the content of this control Microsoft.Office.Interop.Word.ProofreadingErrors docErrors = WordDoc.SpellingErrors; SpellingErrors = docErrors.Count; // execute spell check; assumes no custom dictionaries WordDoc.CheckSpelling(ref oNothing, ref oIgnoreUpperCase, ref oAlwaysSuggest, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing); // format a string to contain a report of the errors detected ErrorCountMessage = "Spell check complete; errors detected: " + SpellingErrors; // return corrected text to control's text area object first = 0; object last = WordDoc.Characters.Count - 1; this.Text = WordDoc.Range(ref first, ref last).Text; } else { // if nothing was typed into the control, abort and inform user ErrorCountMessage = "Unable to spell check an empty text box."; } WordApp.Quit(ref oFalse, ref emptyItem, ref emptyItem); System.Runtime.InteropServices.Marshal.ReleaseComObject(WordApp); // return report on errors corrected // - could either display from the control or change this to // - return a string which the caller could use as desired. // MessageBox.Show(ErrorCountMessage, "Finished Spelling Check"); } catch (Exception e) { MessageBox.Show(e.ToString()); } } The spell checker works well, the only problem is when I try to move the spell checker the main form blurs up for some reason. Also when I close the spell checker the main form is back to normal. It seems like it is opening up Microsoft word then hiding the window, only allowing the spell checker to be seen. Please help.

    Read the article

  • How to make a parameter optional in WSDL?

    - by user305069
    I have a WebService API which needs 2 of its parameters to be optional in the WSDL public wsProxy[] Insert(wsProxy[] proxies, string loginname, string password, bool returnNewData) { //code here } I need to a way to show loginname and password as optional in the WSDL. Is there any way to do this in C#. Can I maybe add an tag in front of the parameters like this [optional]loginname? I have been looking around but haven't been able to find anything so far.

    Read the article

  • List input and output audio devices in Applet

    - by Jhonny Everson
    I am running a signed applet that needs to provide the ability for the user to select the input and output audio devices ( similar to what skype provides). I borrowed the following code from other thread: import javax.sound.sampled.*; public class SoundAudit { public static void main(String[] args) { try { System.out.println("OS: "+System.getProperty("os.name")+" "+ System.getProperty("os.version")+"/"+ System.getProperty("os.arch")+"\nJava: "+ System.getProperty("java.version")+" ("+ System.getProperty("java.vendor")+")\n"); for (Mixer.Info thisMixerInfo : AudioSystem.getMixerInfo()) { System.out.println("Mixer: "+thisMixerInfo.getDescription()+ " ["+thisMixerInfo.getName()+"]"); Mixer thisMixer = AudioSystem.getMixer(thisMixerInfo); for (Line.Info thisLineInfo:thisMixer.getSourceLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Source Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}} for (Line.Info thisLineInfo:thisMixer.getTargetLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Target Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}}} } catch (Exception e) {e.printStackTrace();}} public static String AnalyzeControl(Control thisControl) { String type = thisControl.getType().toString(); if (thisControl instanceof BooleanControl) { return " Control: "+type+" (boolean)"; } if (thisControl instanceof CompoundControl) { System.out.println(" Control: "+type+ " (compound - values below)"); String toReturn = ""; for (Control children: ((CompoundControl)thisControl).getMemberControls()) { toReturn+=" "+AnalyzeControl(children)+"\n";} return toReturn.substring(0, toReturn.length()-1);} if (thisControl instanceof EnumControl) { return " Control:"+type+" (enum: "+thisControl.toString()+")";} if (thisControl instanceof FloatControl) { return " Control: "+type+" (float: from "+ ((FloatControl) thisControl).getMinimum()+" to "+ ((FloatControl) thisControl).getMaximum()+")";} return " Control: unknown type";} } But what I get: Mixer: Software mixer and synthesizer [Java Sound Audio Engine] Mixer: No details available [Microphone (Pink Front)] I was expecting the get the real list of my devices (My preferences panels shows 3 output devices and 1 Microphone). I am running on Mac OS X 10.6.7. Is there other way to get that info from Java?

    Read the article

  • iPhone colorize UILabel substrings

    - by Janosch R
    Hey, I’m parsing a twitter rss feed, and I just need to show tweets, so I don't need MGTwitterEngine. I have already set it up so I can see the complete tweet, the only thing I want it to colorize hashtags and urls. So I would need to slice up the string in different substrings, colorize the hashtags and urls and glue it together in various UILabels Is there an easier way to accomplish this? In short I need some parts of a string colored differently than others.

    Read the article

  • ASP.NET MVC BaseController to dynamically set MasterPage file

    - by rockinthesixstring
    I've built a Base Controller that all of my Controllers inherit from, and I've got it setup so that it checks the browser type and returns the appropriate MasterPageFile on the fly. I'm wondering if this is an efficient way to do this or if I should optimize it another way. Public Class BaseController : Inherits System.Web.Mvc.Controller Protected Overrides Function View(ByVal viewName As String, ByVal masterName As String, ByVal model As Object) As System.Web.Mvc.ViewResult If Request.Browser.IsMobileDevice Then Return MyBase.View(viewName, "Mobile", model) Else Return MyBase.View(viewName, "Site", model) End If End Function End Class

    Read the article

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • use bouncy castle to create public key on j2me

    - by mike
    I got the public key from the certificate, keypair is a java.security.KeyPair object String public_key = keypair.getPublic().toString(); I want to send this to the via an http connection to a J2me application. I cannot find any documentation to convert the transmitted string to a Public key that can be used to encrypt Strings. I also want the J2me to verify signed strings from the server. I want to then send the encrypted strings back to the server.

    Read the article

  • Is it possible to route a Webmethod?

    - by Philip
    I have a .aspx page with some Webmethods that I use for jQuery ajax calls. [WebMethod] public static string HelloWorld(string s) { return "Hello"+ s; } And call this with Url: /ajax/Test.aspx/HelloWorld I wonder if it is possible to route this method to another url like /ajax/helloworld/?

    Read the article

  • Visual Studio Add in.

    - by Eric Brown - Cal
    I was looking to write/get a visual studio add in. I want to be able to write descriptive log calls at the top and bottom of a function. like this log.debug("TheClass.TheMethod(string TheStringParam ="+TheStringParam+") - in"); log.debug("TheClass.TheMethod(string TheStringParam ="+TheStringParam+") - out"); Is there an adin that does this? Is there source anywhere for an add in like Ghost Doc that does reflection(or whatever) to parse the parameters and such? Thanks, Eric-

    Read the article

  • Get Attribute value in ViewEngine ASP.NET MVC 3

    - by Kushan Fernando
    I'm writting my own view engine. public class MyViewEngine : RazorViewEngine { public override ViewEngineResult FindView(ControllerContext controllerContext, string viewName, string masterName, bool useCache) { // Here, how do I get attributes defined on top of the Action ? } } ASP.NET MVC Custom Attributes within Custom View Engine Above SO Question has how to get attributes defined on top of the Controller. But I need to get attributes defined on Action.

    Read the article

  • How to design this ?

    - by Akku
    how can i make this entire process as 1 single event??? http://code.google.com/apis/visualization/documentation/dev/dsl_get_started.html and draw the chart on single click? I am new to servlets please guide me When a user clicks the "go " button with some input. The data goes to the servlet say "Test3". The servlet processes the data by the user and generates/feeds the data table dynamically Then I call the html page to draw the chart as shown in the tutorial link above. The problem is when I call the servlet it gives me a long json string in the browser as given in the tutorials "google.visualization.Query.setResponse({version:'0.6',status:'ok',sig:'1333639331',table:{cols:[{............................" Then when i manually call the html page to draw the chart i am see the chart. But when I call html page directly using the request dispatcher via the servlet I dont get the result. This is my code and o/p...... I need sugession as to how should be my approach to call the chart public class Test3 extends HttpServlet implements DataTableGenerator { protected void processRequest(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException { DataSourceHelper.executeDataSourceServletFlow(request, response, this , isRestrictedAccessMode() ); RequestDispatcher rd; rd = request.getRequestDispatcher("new.html");// it call's the html page which draws the chart as per the data added by the servlet..... rd.include(request, response);//forward(request, response); @Override public Capabilities getCapabilities() { return Capabilities.NONE; } protected boolean isRestrictedAccessMode() { return false; } @Override public DataTable generateDataTable(Query query, HttpServletRequest request) { // Create a data table. DataTable data = new DataTable(); ArrayList<ColumnDescription> cd = new ArrayList<ColumnDescription>(); cd.add(new ColumnDescription("name", ValueType.TEXT, "Animal name")); cd.add......... I get the following result along with unprocessed html page google.visualization.Query.setResponse({version:'0.6',statu..... <html> <head> <title>Getting Started Example</title> .... Entire html page as it is on the Browser. What I need is when a user clicks the go button the servlet should process the data and call the html page to draw the chart....Without the json string appearing on the browser.(all in one user click) What should be my approach or how should i design this.... there are no error in the code. since when i run the servlet i get the json string on the browser and then when i run the html page manually i get the chart drawn. So how can I do (servlet processing + html page drawing chart as final result) at one go without the long json string appearing on the browser. There is no problem with the html code....

    Read the article

  • Rails Scaffold problem # undefined method `edit_pais_path'

    - by Bruno Cordeiro
    I created a scaffold of named pais (This is a word in Portuguese of Brazil and is the same that country), i created using the follow command: ruby script\generate scaffold pais name:string abreviattion:string First I changed the inflections to my local idiom, like that: inflect.plural /^([a-zA-z]*)s$/i, '\1ses' #The plural of Pais is Paises And when I tryied to open the page on http://localhost:3000/paises I'm receiving the follow error: undefined method `edit_pais_path' for #<ActionView::Base:0x387fdf4> Thanks in advance.

    Read the article

  • Python: How efficient is subtring extraction?

    - by Cameron
    I've got the entire contents of a text file (at least a few KB) in string myStr. Will the following code create a copy of the string (less the first character) in memory? myStr = myStr[1:] I'm hoping it just refers to a different location in the same internal buffer. If not, is there a more efficient way to do this? Thanks!

    Read the article

  • How can we define more than one table,define columns and write data in xml file ?

    - by Harikrishna
    I am writing my xml file manually. And I am writing that for storing data and retrieving data from that. I have written file like for the table PersonalInfo. <?xml version="1.0" standalone="yes"?> <PersonalInfo> <xs:schema id="PersonalInfo" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="PersonalInfo" msdata:IsDataSet="true" msdata:UseCurrentLocale="true"> <xs:complexType> <xs:choice minOccurs="0" maxOccurs="unbounded"> <xs:element name="PesonalInfo."> <xs:complexType> <xs:sequence> <!--Define Column Here....--> <xs:element name="name" type="xs:string" /> <xs:element name="address" type="xs:string" /> </xs:sequence> </xs:complexType> </xs:element> </xs:choice> </xs:complexType> </xs:element> </xs:schema> <!--First Row--> <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <!--Second Row--> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> </PersonalInfo> Please suggest any mistake with writing file here. And now I want define more than table in this file. And here I have to write data for the table like <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> Is not possible some thing writing data when defining columns EDIT : <xs:element name="name" type="xs:string",Harikrishna,Jatin.... /> <xs:element name="address" type="xs:string",India,India.... /> And how to define more than one table in a single xml file ?

    Read the article

  • Log4net duplicate logging entires

    - by user210713
    I recently switched out log4net logging from using config files to being set up programmatically. This has resulted in the nhiberate entries getting repeated 2 or sometimes 3 times. Here's the code. It uses a string which looks something like this "logger1|debug,logger2|info" private void SetupLog4netLoggers() { IAppender appender = GetAppender(); SetupRootLogger(appender); foreach (string logger in Loggers) { CommaStringList parts = new CommaStringList(logger, '|'); if (parts.Count != 2) continue; AddLogger(parts[0], parts[1], appender); } log.Debug("Log4net has been setup"); } private IAppender GetAppender() { RollingFileAppender appender = new RollingFileAppender(); appender.File = LogFile; appender.AppendToFile = true; appender.MaximumFileSize = MaximumFileSize; appender.MaxSizeRollBackups = MaximumBackups; PatternLayout layout = new PatternLayout(PATTERN); layout.ActivateOptions(); appender.Layout = layout; appender.ActivateOptions(); return appender; } private void SetupRootLogger(IAppender appender) { Hierarchy hierarchy = (Hierarchy)LogManager.GetRepository(); hierarchy.Root.RemoveAllAppenders(); hierarchy.Root.AddAppender(appender); hierarchy.Root.Level = GetLevel(RootLevel); hierarchy.Configured = true; log.Debug("Root logger setup, level[" + RootLevel + "]"); } private void AddLogger(string name, string level, IAppender appender) { Logger logger = LogManager.GetRepository().GetLogger(name)as Logger; if (logger == null) return; logger.Level = GetLevel(level); logger.Additivity = false; logger.RemoveAllAppenders(); logger.AddAppender(appender); log.Debug("logger[" + name + "] added, level[" + level + "]"); } And here's an example of what we see in our logs... 2010-05-06 15:50:39,781 [1] DEBUG NHibernate.Impl.SessionImpl - running ISession.Dispose() 2010-05-06 15:50:39,781 [1] DEBUG NHibernate.Impl.SessionImpl - closing session 2010-05-06 15:50:39,781 [1] DEBUG NHibernate.AdoNet.AbstractBatcher - running BatcherImpl.Dispose(true) 2010-05-06 15:50:39,796 [1] DEBUG NHibernate.Impl.SessionImpl - running ISession.Dispose() 2010-05-06 15:50:39,796 [1] DEBUG NHibernate.Impl.SessionImpl - closing session 2010-05-06 15:50:39,796 [1] DEBUG NHibernate.AdoNet.AbstractBatcher - running BatcherImpl.Dispose(true) 2010-05-06 15:50:39,796 [1] DEBUG NHibernate.Impl.SessionImpl - running ISession.Dispose() 2010-05-06 15:50:39,796 [1] DEBUG NHibernate.Impl.SessionImpl - closing session 2010-05-06 15:50:39,796 [1] DEBUG NHibernate.AdoNet.AbstractBatcher - running BatcherImpl.Dispose(true) Any hints welcome.

    Read the article

  • Only replace first matching element using PHP's mb_ereg_replace

    - by Mark L
    Hello, I want to replace only the first matching element in a string instead of replacing every matching element in a string $str = 'abc abc abc'; $find = 'abc'; $replace = 'def'; echo mb_ereg_replace( $find, $replace, $str ); This will return "def def def". What would I need to change in the $find or $replace parameter in order to get it to return "def abc abc"?

    Read the article

< Previous Page | 553 554 555 556 557 558 559 560 561 562 563 564  | Next Page >