Search Results

Search found 6654 results on 267 pages for 'socket io'.

Page 56/267 | < Previous Page | 52 53 54 55 56 57 58 59 60 61 62 63  | Next Page >

  • Batch backup a harddrive without modifying access times C#

    - by johnathan-doena
    I'm trying to write a simple program that will backup my flash drive. I want it to work automatically and silently in the background, and I also want it to be as quick as possible. The thing is, resetting all the access times is useless to me, and something I want to avoid. I know I can read the access times and set them back, but I bet it will fail one day in the future. It would be much simpler to read the files without ever changing it. Also, what is the fastest way to do this? What differences would there be between, say, a flash drive and an external hard drive. I am writing this in C#, as it is the simplest way to do it and it will probably last more generations of Windows..

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • Most efficient way to write over file after reading

    - by Ryan McClure
    I'm reading in some data from a file, manipulating it, and then overwriting it to the same file. Until now, I've been doing it like so: open (my $inFile, $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... close ($inFile); open (my $outFile, $file) or die "Could not open $file: $!"; print $outFile, $retString; close ($inFile); However I realized I can just use the truncate function and open the file for read/write: open (my $inFile, '+<', $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... truncate $inFile, 0; print $inFile $retString; close ($inFile); I don't see any examples of this anywhere. It seems to work well, but am I doing it correctly? Is there a better way to do this?

    Read the article

  • Do we need seperate file path for window and linux in java

    - by Kishor Sharma
    I have a file on linux ubuntu server hosted with path name /home/kishor/project/detail/. When I made a web app in window to upload and download file from specified location i used path "c:\kishor\projects\detail\" for saving in window. For my surprise when i used window file path name in my server i am still able to get files and upload them, i.e, "c:\kishor\projects\detail\". Can anyone explain why it is working (as window and linux both use different file path pattern).

    Read the article

  • How to open files in Java Swing without JFileChooser

    - by ron
    I'm using Java Swing (GUI) and I want to add a button to my project for opening files . I don't like the JFileChooser since it opens a small window for browsing through the files of the directories . Can I use something else , instead of the JFileChooser under Java Swing ? I've tried to use elements of SWT but it didn't work , meaning is the use of the button object and then use it inside the Jframe , but that failed , so I guess SWT and Swing don't mix together? Here is the example of Java Swing with JFileChooser and I'm looking for something like this to put in my JFrame.

    Read the article

  • Read File/Directory properties with java

    - by Pizza
    How can I read the file information (for example size, line count, last modification, etc) from a file in the file-system or the directory content with JAVA? I need it for a linux operating system. Thanks Ps. This is my first question, althought I have user this forum for a while so please be kind :P

    Read the article

  • Add HTML Id's to tags in .aspx file

    - by slandau
    So I'm writing an app that lets the user select a folder, it gets all the .aspx files in that folder, and lets the users check off which ones they want to add HTML ID's to. Then they click start, and this runs private void btnStart_Click(object sender, EventArgs e) { for (int i = 0; i < listFiles.CheckedItems.Count; i++) { } } It loops through all the selected file names. How do I open each of these .aspx files in the background, and go through them and add the id="thisItemId" attribute to each tag that's like a , , , , , etc....

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How can I exclude words with apostrophes when reading into a table of strings?

    - by rearden
    ifstream fin; string temp; fin.open("engldict.txt"); if(fin.is_open()) { bool apos = false; while(!fin.eof()) { getline(fin, temp, '\n'); if(temp.length() > 2 && temp.length() < 7) { for(unsigned int i = 0; i < temp.length(); i++) { if(temp.c_str()[i] == '\'') apos = true; } if(!apos) dictionary.insert(temp); } } } This code gives me a runtime error: Unhandled exception at 0x00A50606 in Word Jumble.exe: 0xC0000005: Access violation reading location 0x00000014. and throws me a break point at: size_type size() const _NOEXCEPT { // return length of sequence return (this->_Mysize); } within the xstring header. This exception is thrown no matter what character I use, so long as it is present within the words I am reading in. I am aware that it is probably a super simple fix, but I just really need another set of eyes to see it. Thanks in advance.

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • Modifying File while in use using Java

    - by Marquinio
    Hi all, I have this recurrent Java JAR program tasks that tries to modify a file every 60seconds. Problem is that if user is viewing the file than Java program will not be able to modify the file. I get the typical IOException. Anyone knows if there is a way in Java to modify a file currently in use? Or anyone knows what would be the best way to solve this problem? I was thinking of using the File canRead(), canWrite() methods to check if file is in use. If file is in use then I'm thinking of making a backup copy of data that could not be written. Then after 60 seconds add some logic to check if backup file is empty or not. If backup file is not empty then add its contents to main file. If empty then just add new data to main file. Of course, the first thing I will always do is check if file is in use. Thanks for all your ideas.

    Read the article

  • Java I/O: How to append to an already existing text file.

    - by Joe
    Hi I am having no problem writing to or appending to a file, the only problem is that as soon as I quit the program and then run it again, it creates a new file overwriting my original file. This is a problem, as I am using the text file to keep a running tally. Is there a way to get an already created text file as an object and then append to it? Thanks in advance.

    Read the article

  • Make Directory.GetFiles() ignore protected folders

    - by Kryptic
    Hello Everyone, I'm using the Directory.GetFiles() method to get a list of files to operate on. This method throws an UnauthorizedAccessException for example when trying to access a protected folder. I would like it to simply skip over such folders and continue. How can I accomplish this with either Directory.GetFiles (preferably) or another method? Update: Here is the code that throws the exception. I am asking the user to select a directory and then retrieving the list of files. I commented out the code (so this is now whole method) that iterates through the files and the problem still occurs. The exception is thrown on the Directory.GetFiles() line. FolderBrowserDialog fbd = new FolderBrowserDialog(); DialogResult dr = fbd.ShowDialog(); if (dr == System.Windows.Forms.DialogResult.Cancel) return; string directory = fbd.SelectedPath; string[] files = Directory.GetFiles(directory, "*.html", SearchOption.AllDirectories);

    Read the article

  • iphone file download not working

    - by Anonymous
    Hi, In my app I 'm first connecting to a web service, which in return sends a url for a file. I use the url to download the file and then display it on the new view. I get the correct URL but not able to download file from that location. I have another test app which will download file from the same location and it works like a charm. following is my code for webservice-file download. This is a snippet of the code where i 'm parsing the web service xml and then pass the result to NSData for file download. Any suggestions where am i going wrong -- I 'm referring to the following tutorials. Web Service PDF Viewer if ([elementName isEqualToString:@"PRHPdfResultsResult"]) { NSLog(soapResults); UIAlertView *alert = [[UIAlertView alloc] initWithTitle:@"Report downloaded from:" message:soapResults delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; NSData *pdfData = [[NSData alloc] initWithContentsOfURL:[NSURL URLWithString:soapResults]]; //Store the Data locally as PDF File NSString *resourceDocPath = [[NSString alloc] initWithString:[[[[NSBundle mainBundle] resourcePath] stringByDeletingLastPathComponent] stringByAppendingPathComponent:@"Documents"]]; NSString *filePath = [resourceDocPath stringByAppendingPathComponent:@"myPDF.pdf"]; [pdfData writeToFile:filePath atomically:YES]; [alert show]; [alert release]; [soapResults setString:@""]; elementFound = FALSE; }

    Read the article

  • Homemade fstat to get file size, always return 0 length.

    - by Fred
    Hello, I am trying to use my own function to get the file size from a file. I'll use this to allocate memory for a data structure to hold the information on the file. The file size function looks like this: long fileSize(FILE *fp){ long start; fflush(fp); rewind(fp); start = ftell(fp); return (fseek(fp, 0L, SEEK_END) - start); } Any ideas what I'm doing wrong here?

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • Can't access my files in ASP.NET web site

    - by jumbojs
    I'm having a very difficult time. I am running windows 2008 server, I have an Able Commerce site using ASP.NET with C#. I'm writing an automated task that will ftp some xml files down into a local directory on our web server and then the program parses the xml file and saves information to our database. The problem, once I save the files to our local directory, my program has no access to the files. The NETWORK SERVICE user permissions isn't being inherited by the xml files so my program can't do anything with them. I can manually change the permissions, but this wouldn't be automated and won't work. How can I get this to work? help please, it's very frustrating.

    Read the article

  • Python: How to write data in file in specific format?

    - by sasha
    i have an array called MAC1_Val: MAC1_Val array([ 1.00000000e+00, -1.00000000e+01, -2.06306600e+02, 2.22635749e+02, 1.00000000e+00, 1.00000000e+01, 1.00000000e+01, -2.06306600e+02, 2.22635749e+02, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 1.00000000e+00, -1.08892735e+01, 1.88607749e+01, 1.03153300e+01, -1.78666757e+01, 3.33333333e-07, -3.33333333e-07, -4.21637021e-05, 4.21637021e-05, 9.98844400e-01, -1.73973001e-03, 1.20938900e-03, 1.87742948e-03, -3.33333333e-03, 6.66666667e-03, -3.33333333e-03, -2.64911064e-01, -2.60959501e+01, 2.81614422e+01, 3.33333333e-03, -6.66666667e-03, 3.33333333e-03, 0.00000000e+00, 0.00000000e+00]) and i want to write in file (.txt) values in specific format like this: 1.000000e+00 -1.000000e+01 -2.063066e+02 2.226357e+02 1.000000e+00 1.000000e+01 ....... note that are 6 digits behind floating point any suggestions how to do this? thanks in advance!

    Read the article

  • Why Doesn't This Java Code Skip Lines with #?

    - by Nathan
    I'm trying to allow an external .txt file that is read by a Java script be able to have some comments in the beginning of the file so others can easily edit it and add more to it. But if the file contains # (the sign designated for a line that is a comment) it just returns the error that there is a "Format Error in file" (the IOException - so it is getting past that first "IF"...) Can someone help? Here's the portion of the code that deals with commenting lines out of the .txt file being called earlier in the script: while ((line = br.readLine()) != null) { line = line.trim(); if (line.length() < 1 || line.charAt(0) == '#') { // ignore comments continue; } final String[] parts = line.split("="); if (parts.length != 2) { throw new IOException("Format error in file " + JLanguageTool.getDataBroker().getFromRulesDirAsUrl(getFileName()) + ", line: " + line); }

    Read the article

< Previous Page | 52 53 54 55 56 57 58 59 60 61 62 63  | Next Page >