Search Results

Search found 6654 results on 267 pages for 'socket io'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 55/267 | < Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >

  • How can I exclude words with apostrophes when reading into a table of strings?

    - by rearden
    ifstream fin; string temp; fin.open("engldict.txt"); if(fin.is_open()) { bool apos = false; while(!fin.eof()) { getline(fin, temp, '\n'); if(temp.length() > 2 && temp.length() < 7) { for(unsigned int i = 0; i < temp.length(); i++) { if(temp.c_str()[i] == '\'') apos = true; } if(!apos) dictionary.insert(temp); } } } This code gives me a runtime error: Unhandled exception at 0x00A50606 in Word Jumble.exe: 0xC0000005: Access violation reading location 0x00000014. and throws me a break point at: size_type size() const _NOEXCEPT { // return length of sequence return (this->_Mysize); } within the xstring header. This exception is thrown no matter what character I use, so long as it is present within the words I am reading in. I am aware that it is probably a super simple fix, but I just really need another set of eyes to see it. Thanks in advance.

    Read the article

  • fortran error I/O

    - by jpcgandre
    I get this error when compiling: forrtl: severe (256): unformatted I/O to unit open for formatted transfers, unit 27, file C:\Abaqus_JOBS\w.txt The error occurs in the beginning of the analysis. At the start, the file w.txt is created but is empty. The error may be related to the fact that I want to read from an empty file. My code is: OPEN(27, FILE = "C:/Abaqus_JOBS/w.txt", status = "UNKNOWN") READ(27, *, iostat=stat) w IF (stat .NE. 0) CALL del_file(27, stat) SUBROUTINE del_file(uFile, stat) IMPLICIT NONE INTEGER uFile, stat C If the unit is not open, stat will be non-zero CLOSE(unit=uFile, status='delete', iostat=stat) END SUBROUTINE Ref: Close multiple files If you agree with my opion about the cause of the error, is there a way to solve it? Thanks

    Read the article

  • Determine if the current thread has low I/O priority

    - by Magnus Hoff
    I have a background thread that does some I/O-intensive background type work. To please the other threads and processes running, I set the thread priority to "background mode" using SetThreadPriority, like this: SetThreadPriority(GetCurrentThread(), THREAD_MODE_BACKGROUND_BEGIN); However, THREAD_MODE_BACKGROUND_BEGIN is only available in Windows Server 2008 or newer, as well as Windows Vista and newer, but the program needs to work well on Windows Server 2003 and XP as well. So the real code is more like this: if (!SetThreadPriority(GetCurrentThread(), THREAD_MODE_BACKGROUND_BEGIN)) { SetThreadPriority(GetCurrentThread(), THREAD_PRIORITY_LOWEST); } The problem with this is that on Windows XP it will totally disrupt the system by using too much I/O. I have a plan for a ugly and shameful way of mitigating this problem, but that depends on me being able to determine if the current thread has low I/O priority or not. Now, I know I can store which thread priority I ended up setting, but the control flow in the program is not really well suited for this. I would rather like to be able to test later whether or not the current thread has low I/O priority -- if it is in "background mode". GetThreadPriority does not seem to give me this information. Is there any way to determine if the current thread has low I/O priority?

    Read the article

  • Why isn't this file reading/writing program working?

    - by user320950
    This program is supposed to read files and write them. I took the file open checks out because they kept causing errors. The problem is that the files open like they are supposed to and the names are correct but nothing is on any of the text screens. Do you know what is wrong? #include<iostream> #include<fstream> #include<cstdlib> #include<iomanip> using namespace std; int main() { ifstream in_stream; // reads itemlist.txt ofstream out_stream1; // writes in items.txt ifstream in_stream2; // reads pricelist.txt ofstream out_stream3;// writes in plist.txt ifstream in_stream4;// read recipt.txt ofstream out_stream5;// write display.txt float price=' ',curr_total=0.0; int wrong=0; int itemnum=' '; char next; in_stream.open("ITEMLIST.txt", ios::in); // list of avaliable items out_stream1.open("listWititems.txt", ios::out); // list of avaliable items in_stream2.open("PRICELIST.txt", ios::in); out_stream3.open("listWitdollars.txt", ios::out); in_stream4.open("display.txt", ios::in); out_stream5.open("showitems.txt", ios::out); in_stream.close(); // closing files. out_stream1.close(); in_stream2.close(); out_stream3.close(); in_stream4.close(); out_stream5.close(); system("pause"); in_stream.setf(ios::fixed); while(in_stream.eof()) { in_stream >> itemnum; cin.clear(); cin >> next; } out_stream1.setf(ios::fixed); while (out_stream1.eof()) { out_stream1 << itemnum; cin.clear(); cin >> next; } in_stream2.setf(ios::fixed); in_stream2.setf(ios::showpoint); in_stream2.precision(2); while((price== (price*1.00)) && (itemnum == (itemnum*1))) { while (in_stream2 >> itemnum >> price) // gets itemnum and price { while (in_stream2.eof()) // reads file to end of file { in_stream2 >> itemnum; in_stream2 >> price; price++; curr_total= price++; in_stream2 >> curr_total; cin.clear(); // allows more reading cin >> next; } } } out_stream3.setf(ios::fixed); out_stream3.setf(ios::showpoint); out_stream3.precision(2); while((price== (price*1.00)) && (itemnum == (itemnum*1))) { while (out_stream3 << itemnum << price) { while (out_stream3.eof()) // reads file to end of file { out_stream3 << itemnum; out_stream3 << price; price++; curr_total= price++; out_stream3 << curr_total; cin.clear(); // allows more reading cin >> next; } return itemnum, price; } } in_stream4.setf(ios::fixed); in_stream4.setf(ios::showpoint); in_stream4.precision(2); while ( in_stream4.eof()) { in_stream4 >> itemnum >> price >> curr_total; cin.clear(); cin >> next; } out_stream5.setf(ios::fixed); out_stream5.setf(ios::showpoint); out_stream5.precision(2); out_stream5 <<setw(5)<< " itemnum " <<setw(5)<<" price "<<setw(5)<<" curr_total " <<endl; // sends items and prices to receipt.txt out_stream5 << setw(5) << itemnum << setw(5) <<price << setw(5)<< curr_total; // sends items and prices to receipt.txt out_stream5 << " You have a total of " << wrong++ << " errors " << endl; }

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • Java- FileWriter/BufferedWriter - appending to end of a text file?

    - by KP65
    I've done this before once, I'm trying to replicate what I did so far and this is what I've got: try { BufferedWriter writer = new BufferedWriter(new FileWriter("file.P", true)); System.out.println("entered"); if (!(newUserName.isEmpty()) || (newUserPass.isEmpty())){ writer.newLine(); writer.write("hellotest123"); writer.close(); } It seems to find file.P, which is just a txt file, but it doesn't seem to append anything onto it? It enters the code and passes the IF statement fine, but nothing is appended to the text file? I'm slightly stuck!

    Read the article

  • create a sparse BufferedImage in java

    - by elgcom
    I have to create an image with very large resolution, but the image is relatively "sparse", only some areas in the image need to draw. For example with following code /* this take 5GB memory */ final BufferedImage img = new BufferedImage( 36000, 36000, BufferedImage.TYPE_INT_ARGB); /* draw something */ Graphics g = img.getGraphics(); g.drawImage(....); /* output as PNG */ final File out = new File("out.png"); ImageIO.write(img, "png", out); The PNG image on the end I created is ONLY about 200~300 MB. The question is how can I avoid creating a 5GB BufferedImage at the beginning? I do need an image with large dimension, but with very sparse color information. Is there any Stream for BufferedImage so that it will not take so much memory?

    Read the article

  • Read whole ASCII file into C++ std::string

    - by Arrieta
    Hello, I need to read a whole file into memory and place it in a C++ std::string. If I were to read it into a char, the answer would be very simple: std::ifstream t; int lenght; t.open("file.txt", "r"); // open input file t.seekg(0, std::ios::end); // go to the end length = t.tellg(); // report location (this is the lenght) t.seekg(0, std::ios::beg); // go back to the beginning buffer = new char[length]; // allocate memory for a buffer of appropriate dimension t.read(buffer, length); // read the whole file into the buffer t.close(); // close file handle // ... do stuff with buffer here ... Now, I want to do the exact same thing, but using a std::string instead of a char. I want to avoid loops, i. e., I don't want to: std::ifstream t; t.open("file.txt", "r"); std::string buffer; std::string line; while(t){ std::getline(t, line); // ... append line to buffer and go on } t.close() any ideas?

    Read the article

  • Fastest way to read data from a lot of ASCII files

    - by Alsenes
    Hi guys, for a college exercise that I've already submitted I needed to read a .txt file wich contained a lot of names of images(1 in each line). Then I needed to open each image as an ascii file, and read their data(images where in ppm format), and do a series of things with them. The things is, I noticed my program was taking 70% of the time in the reading the data from the file part, instead of in the other calculations that I was doing (finding number of repetitions of each pixel with a hash table, finding diferents pixels beetween 2 images etc..), which I found quite odd to say the least. This is how the ppm format looks like: P3 //This value can be ignored when reading the file, because all image will be correctly formatted 4 4 255 //This value can be also ignored, will be always 255. 0 0 0 0 0 0 0 0 0 15 0 15 0 0 0 0 15 7 0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 0 0 0 15 0 15 0 0 0 0 0 0 0 0 0 This is how I was reading the data from the files: ifstream fdatos; fdatos.open(argv[1]); //Open file with the name of all the images const int size = 128; char file[size]; //Where I'll get the image name Image *img; while (fdatos >> file) { //While there's still images anmes left, continue ifstream fimagen; fimagen.open(file); //Open image file img = new Image(fimagen); //Create new image object with it's data file ……… //Rest of the calculations whith that image ……… delete img; //Delete image object after done fimagen.close(); //Close image file after done } fdatos.close(); And inside the image object read the data like this: const int tallafirma = 100; char firma[tallafirma]; fich_in >> std::setw(100) >> firma; // Read the P3 part, can be ignored int maxvalue, numpixels; fich_in >> height >> width >> maxvalue; // Read the next three values numpixels = height*width; datos = new Pixel[numpixels]; int r,g,b; //Don't need to be ints, max value is 256, so an unsigned char would be ok. for (int i=0; i<numpixels; i++) { fich_in >> r >> g >> b; datos[i] = Pixel( r, g ,b); } //This last part is the slow one, //I thing I should be able to read all this data in one single read //to buffer or something which would be stored in an array of unsigned chars, //and then I'd only need to to do: //buffer[0] -> //Pixel 1 - Red data //buffer[1] -> //Pixel 1 - Green data //buffer[2] -> //Pixel 1 - Blue data So, any Ideas? I think I can improve it quite a bit reading all to an array in one single call, I just don't know how that is done. Also, is it posible to know how many images will be in the "index file"? Is it posiible to know the number of lines a file has?(because there's one file name per line..) Thanks!!

    Read the article

  • best way to output a full precision double into a text file

    - by flevine100
    Hi, I need to use an existing text file to store some very precise values. When read back in, the numbers essentially need to be exactly equivalent to the ones that were originally written. Now, a normal person would use a binary file... for a number of reasons, that's not possible in this case. So... do any of you have a good way of encoding a double as a string of characters (aside from increasing the precision). My first thought was to cast the double to a char[] and write out the chars. I don't think that's going to work because some of the characters are not visible, produce sounds, and even terminate strings ('\0'... I'm talkin to you!) Thoughts?

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • How to delete duplicate/aggregate rows faster in a file using Java (no DB)

    - by S. Singh
    I have a 2GB big text file, it has 5 columns delimited by tab. A row will be called duplicate only if 4 out of 5 columns matches. Right now, I am doing dduping by first loading each coloumn in separate List , then iterating through lists, deleting the duplicate rows as it encountered and aggregating. The problem: it is taking more than 20 hours to process one file. I have 25 such files to process. Can anyone please share their experience, how they would go about doing such dduping? This dduping will be a throw away code. So, I was looking for some quick/dirty solution, to get job done as soon as possible. Here is my pseudo code (roughly) Iterate over the rows i=current_row_no. Iterate over the row no. i+1 to last_row if(col1 matches //find duplicate && col2 matches && col3 matches && col4 matches) { col5List.set(i,get col5); //aggregate } Duplicate example A and B will be duplicate A=(1,1,1,1,1), B=(1,1,1,1,2), C=(2,1,1,1,1) and output would be A=(1,1,1,1,1+2) C=(2,1,1,1,1) [notice that B has been kicked out]

    Read the article

  • What file format can I use to output a formatted text file straight from a program without having the markup be too complicated?

    - by Matt
    Premise: I am parsing a file that is quite nearly XML, but not quite. From this file I would like to extract data and output in a file that a user could open up in some program and read. To make the data reasonable, I would almost certainly need to format the text. In case it matters, I will probably be using Java to write the program. Problem: I cannot find a file format that supports formatting without having terribly complex rules and encoding problems. Attempts: I looked into a basic .txt extension first, but it does not have enough formatting advantage. I then tried a .rtf extension, but the rules for outputting text seem to be terribly complicated. It was then suggested that I used XML, but I do not understand how this file would be viewed. This appears to be probably the best solution, but I don't understand much about it. Perhaps somebody could shed some light here. In Other Words: Could somebody suggest and easy to use file format and/or shed some light on how to use XML for text formatting and viewing?

    Read the article

  • implementing a Intelligent File Transfer Software in java over TCP/IP

    - by whyjava
    Hello I am working on a proposal where we have to implement a software which can move files between one source to destination.The overall goal of this project is to create intelligent file transfer.This software will have three components :- 1) Broker : Broker is the module that communicates with other brokers, monitors files, moves files, retrieves configurations from the Configuration Manager, supplies process information for the monitor, archives files, writes all process data to log files and escalates issues if necessary 2) Configuration Manager :Configuration Manager is a web-based application used to configure and deploy the configuration to all brokers. 3) Monitor : Monitor is a web-based application used to monitor each Broker in the environment. This project has to be built up in java and protocol for file transfer in tcp/ip. Client does not want to use FTP. File Transfer seems very easy, until there are several processes who are waiting to pick the file up automatically. Several problems arise: How can we guarantee the file is received at the destination? If a file isn’t received the first time, we should try it again (even after a restart or power breakdown) ? How does the receiver knows the file that is received is complete? How can we transfer multiple files synchronously? How can we protect the bandwidth, so file transfer isn’t blocking other processes? How does one interoperate between multiple OS platforms? What about authentication? How can we monitor het workflow? Auditing / logging Archiving Can you please provide answer to some of these? Thanks

    Read the article

  • How to store a scaleable sized extensible event log?

    - by firoso
    Hello everyone! I've been contemplating writing a simple "event log" that takes a paramater list and stores event messages in a log file, trouble is, I forsee this file growing to be rather large (assume 1M entries or more) the question is, how can I implement this system without pulling teeth, I know that SQL would be a possible way to go. XML would be ideal but not really practical for scaleability if i'm not going nuts. Example Log Entry -----Time Date-------- ---------Sender----------------------- ---------Tags---------- --Message---------- 12/24/2008 24:00:00 $DOMAIN\SYSTEM\Application$ :Trivial: :Notification: It's Christmas in 1s

    Read the article

  • Do we need seperate file path for window and linux in java

    - by Kishor Sharma
    I have a file on linux ubuntu server hosted with path name /home/kishor/project/detail/. When I made a web app in window to upload and download file from specified location i used path "c:\kishor\projects\detail\" for saving in window. For my surprise when i used window file path name in my server i am still able to get files and upload them, i.e, "c:\kishor\projects\detail\". Can anyone explain why it is working (as window and linux both use different file path pattern).

    Read the article

  • c++ File input/output

    - by Myx
    Hi: I am trying to read from a file using fgets and sscanf. In my file, I have characters on each line of the while which I wish to put into a vector. So far, I have the following: FILE *fp; fp = fopen(filename, "r"); if(!fp) { fprintf(stderr, "Unable to open file %s\n", filename); return 0; } // Read file int line_count = 0; char buffer[1024]; while(fgets(buffer, 1023, fp)) { // Increment line counter line_count++; char *bufferp = buffer; ... while(*bufferp != '\n') { char *tmp; if(sscanf(bufferp, "%c", tmp) != 1) { fprintf(stderr, "Syntax error reading axiom on " "line %d in file %s\n", line_count, filename); return 0; } axiom.push_back(tmp); printf("put %s in axiom vector\n", axiom[axiom.size()-1]); // increment buffer pointer bufferp++; } } my axiom vector is defined as vector<char *> axiom;. When I run my program, I get a seg fault. It happens when I do the sscanf. Any suggestions on what I'm doing wrong?

    Read the article

  • Why does C's "fopen" take a "const char *" as its second argument?

    - by Chris Cooper
    It has always struck me as strange that the C function "fopen" takes a "const char *" as the second argument. I would think it would be easier to both read your code and implement the library's code if there were bit masks defined in stdio.h, like "IO_READ" and such, so you could do things like: FILE* myFile = fopen("file.txt", IO_READ & IO_WRITE); Is there a programmatic reason for the way it actually is, or is it just historic? (i.e. "That's just the way it is.")

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Add up values from a text file

    - by Stanley
    Hi Guys I have a text file that contains Amounts at Substring (34, 47) of each line. I need to sum Up all the Values to the End of the File. I have this code that I had started to build but I do not know how to proceed from here: public class Addup { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException, IOException { // TODO code application logic here FileInputStream fs = new FileInputStream("C:/Analysis/RL004.TXT"); BufferedReader br = new BufferedReader(new InputStreamReader(fs)); String line; while((line = br.readLine()) != null){ String num = line.substring(34, 47); double i = Double.parseDouble(num); System.out.println(i); } } } The output is like this: 1.44576457E4 2.33434354E6 4.56875685E3 The Amount is in two decimal Places and I need the result also in the Two decimal Places. What Is the Best way to achieve this?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >