Search Results

Search found 15981 results on 640 pages for 'applications openworld'.

Page 564/640 | < Previous Page | 560 561 562 563 564 565 566 567 568 569 570 571  | Next Page >

  • WPF animation/UI features performance and benchmarking

    - by Rich
    I'm working on a relatively small proof-of-concept for some line of business stuff with some fancy WPF UI work. Without even going too crazy, I'm already seeing some really poor performance when using a lot of the features that I thought were the main reason to consider WPF for UI building in the first place. I asked a question on here about why my animation was being stalled the first time it was run, and at the end what I found was that a very simple UserControl was taking almost half a second just to build its visual tree. I was able to get a work around to the symptom, but the fact that it takes that long to initialize a simple control really bothers me. Now, I'm testing my animation with and without the DropShadowEffect, and the result is night and day. A subtle drop shadow makes my control look so much nicer, but it completely ruins the smoothness of the animation. Let me not even start with the font rendering either. The calculation of my animations when the control has a bunch of gradient brushes and a drop shadow make the text blurry for about a full second and then slowly come into focus. So, I guess my question is if there are known studies, blog posts, or articles detailing which features are a hazard in the current version of WPF for business critical applications. Are things like Effects (ie. DropShadowEffect), gradient brushes, key frame animations, etc going to have too much of a negative effect on render quality (or maybe the combinations of these things)? Is the final version of WPF 4.0 going to correct some of these issues? I've read that VS2010 beta has some of these same issues and that they are supposed to be resolved by final release. Is that because of improvements to WPF itself or because half of the application will be rebuilt with the previous technology?

    Read the article

  • Creating customized .dmg files upon download

    - by Marten
    I want to distribute a cross-platform application for which the executable file is slightly different, depending on the user who downloaded it. This is done by having a placeholder string somewhere in the executable that is replaced with something user-specific upon download. The webserver that has to do these string replacements is a Linux machine. For Windows, the executable is not compressed in the installer .exe, so the string replacement is easy. For uncompressed Mac OS X .dmg files, this is also easy. However, .dmg files that are compressed with either gzip or bzip2 are not so easy. For example, in the latter case, the compressed .dmg is not one big bzip2-compressed disk image, but instead consists of a few different bzip2-compressed parts (with different block sizes) and a plist suffix. Also, decompressing and recompressing the different parts with bzip2 does not result in the original data, so I'm guessing Apple uses some different parameters to bzip2 than the command-line tool. Is there a way to generate a compressed .dmg from an uncompressed one on Linux (which does not have hdiutil)? Or maybe another suggestion for creating customized applications without pregenerating them? It should work without any input by the user.

    Read the article

  • HTML - Correct way of coding a checkbox with a Label.

    - by egarcia
    I've been using formtastic in order to generate HTML forms on rails applications. My question, however, is really HTML-related. Today I found a strange behaviour on the way formtastic generates checkboxes (fields of type :boolean on formtastic lingo). The rest of the fields (non-checkboxes) are generated this way: <li> <label for="my_textbox_field">My TextBox</label> <input id="my_textbox_field" type="text" ... > </li> Checkboxes, however, are enclosed inside their <label> tags completely - like this: <li> <label for="my_boolean_field"> <input id="my_boolean_field" type="checkbox" ... > This is my boolean field </label> </li> Formtastic phylosophy seems to be based on the Learning to Love Forms presentation. In effect, on slide 36 of that presentation this structure is suggested for checkboxes. I guess in the presentation itself the presenter explained why this was done, but it is not written on the slides. Can anyone tell me why enclosing checkboxes inside their <label> tag might be a good idea, as opposed to putting them outside, like with textboxes?

    Read the article

  • Windows could not start Apache 2 on the local computer

    - by andig
    After installing PHP 5.3, Windows is unable to start Apache 2.2. Apache's error log is empty, no error message on startup: C:\Programme\Apache\bin>httpd -k start C:\Programme\Apache\bin>httpd -k stop The Apache2.2 service is not started. C:\Programme\Apache\bin>httpd -k config Reconfiguring the Apache2.2 service The Apache2.2 service is successfully installed. Testing httpd.conf.... Errors reported here must be corrected before the service can be started. I have no clue where to look for the cause. php5apache2_2.dll is copied to the Apache modules folder. The configuration looks like this: LoadModule php5_module modules/php5apache2_2.dll PHPIniDir "C:/programme/php" Where and how can I start diagnosis? The only hint I have so far is that startup fails as soon as a PHP module is enabled in the configuration. Is there a way to get more details out of the Apache startup process? This is the http.conf: # # This is the main Apache HTTP server configuration file. It contains the # configuration directives that give the server its instructions. # See <URL:http://httpd.apache.org/docs/2.2> for detailed information. # In particular, see # <URL:http://httpd.apache.org/docs/2.2/mod/directives.html> # for a discussion of each configuration directive. # # Do NOT simply read the instructions in here without understanding # what they do. They're here only as hints or reminders. If you are unsure # consult the online docs. You have been warned. # # Configuration and logfile names: If the filenames you specify for many # of the server's control files begin with "/" (or "drive:/" for Win32), the # server will use that explicit path. If the filenames do *not* begin # with "/", the value of ServerRoot is prepended -- so "logs/foo.log" # with ServerRoot set to "C:/Programme/Apache" will be interpreted by the # server as "C:/Programme/Apache/logs/foo.log". # # NOTE: Where filenames are specified, you must use forward slashes # instead of backslashes (e.g., "c:/apache" instead of "c:\apache"). # If a drive letter is omitted, the drive on which httpd.exe is located # will be used by default. It is recommended that you always supply # an explicit drive letter in absolute paths to avoid confusion. # # ServerRoot: The top of the directory tree under which the server's # configuration, error, and log files are kept. # # Do not add a slash at the end of the directory path. If you point # ServerRoot at a non-local disk, be sure to point the LockFile directive # at a local disk. If you wish to share the same ServerRoot for multiple # httpd daemons, you will need to change at least LockFile and PidFile. # ServerRoot "C:/Programme/Apache" # # Listen: Allows you to bind Apache to specific IP addresses and/or # ports, instead of the default. See also the <VirtualHost> # directive. # # Change this to Listen on specific IP addresses as shown below to # prevent Apache from glomming onto all bound IP addresses. # #Listen 12.34.56.78:80 Listen 80 # # Dynamic Shared Object (DSO) Support # # To be able to use the functionality of a module which was built as a DSO you # have to place corresponding `LoadModule' lines at this location so the # directives contained in it are actually available _before_ they are used. # Statically compiled modules (those listed by `httpd -l') do not need # to be loaded here. # # Example: # LoadModule foo_module modules/mod_foo.so # LoadModule actions_module modules/mod_actions.so LoadModule alias_module modules/mod_alias.so LoadModule asis_module modules/mod_asis.so LoadModule auth_basic_module modules/mod_auth_basic.so #LoadModule auth_digest_module modules/mod_auth_digest.so #LoadModule authn_alias_module modules/mod_authn_alias.so #LoadModule authn_anon_module modules/mod_authn_anon.so #LoadModule authn_dbd_module modules/mod_authn_dbd.so #LoadModule authn_dbm_module modules/mod_authn_dbm.so LoadModule authn_default_module modules/mod_authn_default.so LoadModule authn_file_module modules/mod_authn_file.so #LoadModule authnz_ldap_module modules/mod_authnz_ldap.so #LoadModule authz_dbm_module modules/mod_authz_dbm.so LoadModule authz_default_module modules/mod_authz_default.so LoadModule authz_groupfile_module modules/mod_authz_groupfile.so LoadModule authz_host_module modules/mod_authz_host.so #LoadModule authz_owner_module modules/mod_authz_owner.so LoadModule authz_user_module modules/mod_authz_user.so LoadModule autoindex_module modules/mod_autoindex.so #LoadModule cache_module modules/mod_cache.so #LoadModule cern_meta_module modules/mod_cern_meta.so LoadModule cgi_module modules/mod_cgi.so #LoadModule charset_lite_module modules/mod_charset_lite.so #LoadModule dav_module modules/mod_dav.so #LoadModule dav_fs_module modules/mod_dav_fs.so #LoadModule dav_lock_module modules/mod_dav_lock.so #LoadModule dbd_module modules/mod_dbd.so #LoadModule deflate_module modules/mod_deflate.so LoadModule dir_module modules/mod_dir.so #LoadModule disk_cache_module modules/mod_disk_cache.so #LoadModule dumpio_module modules/mod_dumpio.so LoadModule env_module modules/mod_env.so #LoadModule expires_module modules/mod_expires.so #LoadModule ext_filter_module modules/mod_ext_filter.so #LoadModule file_cache_module modules/mod_file_cache.so #LoadModule filter_module modules/mod_filter.so #LoadModule headers_module modules/mod_headers.so #LoadModule ident_module modules/mod_ident.so #LoadModule imagemap_module modules/mod_imagemap.so LoadModule include_module modules/mod_include.so #LoadModule info_module modules/mod_info.so LoadModule isapi_module modules/mod_isapi.so #LoadModule ldap_module modules/mod_ldap.so #LoadModule logio_module modules/mod_logio.so LoadModule log_config_module modules/mod_log_config.so #LoadModule log_forensic_module modules/mod_log_forensic.so #LoadModule mem_cache_module modules/mod_mem_cache.so LoadModule mime_module modules/mod_mime.so #LoadModule mime_magic_module modules/mod_mime_magic.so LoadModule negotiation_module modules/mod_negotiation.so #LoadModule proxy_module modules/mod_proxy.so #LoadModule proxy_ajp_module modules/mod_proxy_ajp.so #LoadModule proxy_balancer_module modules/mod_proxy_balancer.so #LoadModule proxy_connect_module modules/mod_proxy_connect.so #LoadModule proxy_ftp_module modules/mod_proxy_ftp.so #LoadModule proxy_http_module modules/mod_proxy_http.so #LoadModule proxy_scgi_module modules/mod_proxy_scgi.so #LoadModule reqtimeout_module modules/mod_reqtimeout.so #LoadModule rewrite_module modules/mod_rewrite.so LoadModule setenvif_module modules/mod_setenvif.so #LoadModule speling_module modules/mod_speling.so #LoadModule ssl_module modules/mod_ssl.so #LoadModule status_module modules/mod_status.so #LoadModule substitute_module modules/mod_substitute.so #LoadModule unique_id_module modules/mod_unique_id.so #LoadModule userdir_module modules/mod_userdir.so #LoadModule usertrack_module modules/mod_usertrack.so #LoadModule version_module modules/mod_version.so #LoadModule vhost_alias_module modules/mod_vhost_alias.so #!! LoadModule php5_module modules/php5apache2_2.dll PHPIniDir "C:/programme/php" <IfModule !mpm_netware_module> <IfModule !mpm_winnt_module> # # If you wish httpd to run as a different user or group, you must run # httpd as root initially and it will switch. # # User/Group: The name (or #number) of the user/group to run httpd as. # It is usually good practice to create a dedicated user and group for # running httpd, as with most system services. # User daemon Group daemon </IfModule> </IfModule> # 'Main' server configuration # # The directives in this section set up the values used by the 'main' # server, which responds to any requests that aren't handled by a # <VirtualHost> definition. These values also provide defaults for # any <VirtualHost> containers you may define later in the file. # # All of these directives may appear inside <VirtualHost> containers, # in which case these default settings will be overridden for the # virtual host being defined. # # # ServerAdmin: Your address, where problems with the server should be # e-mailed. This address appears on some server-generated pages, such # as error documents. e.g. [email protected] # ServerAdmin [email protected] # # ServerName gives the name and port that the server uses to identify itself. # This can often be determined automatically, but we recommend you specify # it explicitly to prevent problems during startup. # # If your host doesn't have a registered DNS name, enter its IP address here. # #ServerName localhost:8080 # # DocumentRoot: The directory out of which you will serve your # documents. By default, all requests are taken from this directory, but # symbolic links and aliases may be used to point to other locations. # DocumentRoot "C:/data/htdocs" # # Each directory to which Apache has access can be configured with respect # to which services and features are allowed and/or disabled in that # directory (and its subdirectories). # # First, we configure the "default" to be a very restrictive set of # features. # <Directory /> Options FollowSymLinks AllowOverride None Order deny,allow Deny from all </Directory> # # Note that from this point forward you must specifically allow # particular features to be enabled - so if something's not working as # you might expect, make sure that you have specifically enabled it # below. # # # This should be changed to whatever you set DocumentRoot to. # <Directory "C:/data/htdocs"> # # Possible values for the Options directive are "None", "All", # or any combination of: # Indexes Includes FollowSymLinks SymLinksifOwnerMatch ExecCGI MultiViews # # Note that "MultiViews" must be named *explicitly* --- "Options All" # doesn't give it to you. # # The Options directive is both complicated and important. Please see # http://httpd.apache.org/docs/2.2/mod/core.html#options # for more information. # Options Indexes FollowSymLinks # # AllowOverride controls what directives may be placed in .htaccess files. # It can be "All", "None", or any combination of the keywords: # Options FileInfo AuthConfig Limit # AllowOverride None # # Controls who can get stuff from this server. # Order allow,deny Allow from all </Directory> # # DirectoryIndex: sets the file that Apache will serve if a directory # is requested. # <IfModule dir_module> DirectoryIndex index.html </IfModule> # # The following lines prevent .htaccess and .htpasswd files from being # viewed by Web clients. # <FilesMatch "^\.ht"> Order allow,deny Deny from all Satisfy All </FilesMatch> # # ErrorLog: The location of the error log file. # If you do not specify an ErrorLog directive within a <VirtualHost> # container, error messages relating to that virtual host will be # logged here. If you *do* define an error logfile for a <VirtualHost> # container, that host's errors will be logged there and not here. # ErrorLog "logs/error.log" # # LogLevel: Control the number of messages logged to the error_log. # Possible values include: debug, info, notice, warn, error, crit, # alert, emerg. # LogLevel debug <IfModule log_config_module> # # The following directives define some format nicknames for use with # a CustomLog directive (see below). # LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\"" combined LogFormat "%h %l %u %t \"%r\" %>s %b" common <IfModule logio_module> # You need to enable mod_logio.c to use %I and %O LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\" %I %O" combinedio </IfModule> # # The location and format of the access logfile (Common Logfile Format). # If you do not define any access logfiles within a <VirtualHost> # container, they will be logged here. Contrariwise, if you *do* # define per-<VirtualHost> access logfiles, transactions will be # logged therein and *not* in this file. # CustomLog "logs/access.log" common # # If you prefer a logfile with access, agent, and referer information # (Combined Logfile Format) you can use the following directive. # #CustomLog "logs/access.log" combined </IfModule> <IfModule alias_module> # # Redirect: Allows you to tell clients about documents that used to # exist in your server's namespace, but do not anymore. The client # will make a new request for the document at its new location. # Example: # Redirect permanent /foo http://localhost/bar # # Alias: Maps web paths into filesystem paths and is used to # access content that does not live under the DocumentRoot. # Example: # Alias /webpath /full/filesystem/path # # If you include a trailing / on /webpath then the server will # require it to be present in the URL. You will also likely # need to provide a <Directory> section to allow access to # the filesystem path. # # ScriptAlias: This controls which directories contain server scripts. # ScriptAliases are essentially the same as Aliases, except that # documents in the target directory are treated as applications and # run by the server when requested rather than as documents sent to the # client. The same rules about trailing "/" apply to ScriptAlias # directives as to Alias. # ScriptAlias /cgi-bin/ "C:/Programme/Apache/cgi-bin/" </IfModule> <IfModule cgid_module> # # ScriptSock: On threaded servers, designate the path to the UNIX # socket used to communicate with the CGI daemon of mod_cgid. # #Scriptsock logs/cgisock </IfModule> # # "C:/Programme/Apache/cgi-bin" should be changed to whatever your ScriptAliased # CGI directory exists, if you have that configured. # <Directory "C:/Programme/Apache/cgi-bin"> AllowOverride None Options None Order allow,deny Allow from all </Directory> # # DefaultType: the default MIME type the server will use for a document # if it cannot otherwise determine one, such as from filename extensions. # If your server contains mostly text or HTML documents, "text/plain" is # a good value. If most of your content is binary, such as applications # or images, you may want to use "application/octet-stream" instead to # keep browsers from trying to display binary files as though they are # text. # DefaultType text/plain <IfModule mime_module> # # TypesConfig points to the file containing the list of mappings from # filename extension to MIME-type. # TypesConfig conf/mime.types # # AddType allows you to add to or override the MIME configuration # file specified in TypesConfig for specific file types. # #AddType application/x-gzip .tgz # # AddEncoding allows you to have certain browsers uncompress # information on the fly. Note: Not all browsers support this. # #AddEncoding x-compress .Z #AddEncoding x-gzip .gz .tgz # # If the AddEncoding directives above are commented-out, then you # probably should define those extensions to indicate media types: # AddType application/x-compress .Z AddType application/x-gzip .gz .tgz # # AddHandler allows you to map certain file extensions to "handlers": # actions unrelated to filetype. These can be either built into the server # or added with the Action directive (see below) # # To use CGI scripts outside of ScriptAliased directories: # (You will also need to add "ExecCGI" to the "Options" directive.) # #AddHandler cgi-script .cgi # For type maps (negotiated resources): #AddHandler type-map var # # Filters allow you to process content before it is sent to the client. # # To parse .shtml files for server-side includes (SSI): # (You will also need to add "Includes" to the "Options" directive.) # #AddType text/html .shtml #AddOutputFilter INCLUDES .shtml </IfModule> # # The mod_mime_magic module allows the server to use various hints from the # contents of the file itself to determine its type. The MIMEMagicFile # directive tells the module where the hint definitions are located. # #MIMEMagicFile conf/magic # # Customizable error responses come in three flavors: # 1) plain text 2) local redirects 3) external redirects # # Some examples: #ErrorDocument 500 "The server made a boo boo." #ErrorDocument 404 /missing.html #ErrorDocument 404 "/cgi-bin/missing_handler.pl" #ErrorDocument 402 http://localhost/subscription_info.html # # # EnableMMAP and EnableSendfile: On systems that support it, # memory-mapping or the sendfile syscall is used to deliver # files. This usually improves server performance, but must # be turned off when serving from networked-mounted # filesystems or if support for these functions is otherwise # broken on your system. # #EnableMMAP off #EnableSendfile off # Supplemental configuration # # The configuration files in the conf/extra/ directory can be # included to add extra features or to modify the default configuration of # the server, or you may simply copy their contents here and change as # necessary. # Server-pool management (MPM specific) #Include conf/extra/httpd-mpm.conf # Multi-language error messages #Include conf/extra/httpd-multilang-errordoc.conf # Fancy directory listings #Include conf/extra/httpd-autoindex.conf # Language settings #Include conf/extra/httpd-languages.conf # User home directories #Include conf/extra/httpd-userdir.conf # Real-time info on requests and configuration #Include conf/extra/httpd-info.conf # Virtual hosts #Include conf/extra/httpd-vhosts.conf # Local access to the Apache HTTP Server Manual #Include conf/extra/httpd-manual.conf # Distributed authoring and versioning (WebDAV) #Include conf/extra/httpd-dav.conf # Various default settings #Include conf/extra/httpd-default.conf # Secure (SSL/TLS) connections #Include conf/extra/httpd-ssl.conf # # Note: The following must must be present to support # starting without SSL on platforms with no /dev/random equivalent # but a statically compiled-in mod_ssl. # <IfModule ssl_module> SSLRandomSeed startup builtin SSLRandomSeed connect builtin </IfModule> #!! <IfModule mod_php5.c> AddType application/x-httpd-php .php AddType application/x-httpd-php .php5 AddType application/x-httpd-php-source .phps </IfModule>

    Read the article

  • Experience migrating legacy Cobol/PL1 to Java

    - by MadMurf
    ORIGINAL Q: I'm wondering if anyone has had experience of migrating a large Cobol/PL1 codebase to Java? How automated was the process and how maintainable was the output? How did the move from transactional to OO work out? Any lessons learned along the way or resources/white papers that may be of benefit would be appreciated. EDIT 7/7: Certainly the NACA approach is interesting, the ability to continue making your BAU changes to the COBOL code right up to the point of releasing the JAVA version has merit for any organization. The argument for procedural Java in the same layout as the COBOL to give the coders a sense of comfort while familiarizing with the Java language is a valid argument for a large organisation with a large code base. As @Didier points out the $3mil annual saving gives scope for generous padding on any BAU changes going forward to refactor the code on an ongoing basis. As he puts it if you care about your people you find a way to keep them happy while gradually challenging them. The problem as I see it with the suggestion from @duffymo to Best to try and really understand the problem at its roots and re-express it as an object-oriented system is that if you have any BAU changes ongoing then during the LONG project lifetime of coding your new OO system you end up coding & testing changes on the double. That is a major benefit of the NACA approach. I've had some experience of migrating Client-Server applications to a web implementation and this was one of the major issues we encountered, constantly shifting requirements due to BAU changes. It made PM & scheduling a real challenge. Thanks to @hhafez who's experience is nicely put as "similar but slightly different" and has had a reasonably satisfactory experience of an automatic code migration from Ada to Java. Thanks @Didier for contributing, I'm still studying your approach and if I have any Q's I'll drop you a line.

    Read the article

  • StackOverFlowException - but oviously NO recursion/endless loop

    - by user567706
    Hi there, I'm now blocked by this problem the entire day, read thousands of google results, but nothing seems to reflect my problem or even come near to it... i hope any of you has a push into the right direction for me. I wrote a client-server-application (so more like 2 applications) - the client collects data about his system, as well as a screenshot, serializes all this into a XML stream (the picture as a byte[]-array]) and sends this to the server in regular intervals. The server receives the stream (via tcp), deserializes the xml to an information-object and shows the information on a windows form. This process is running stable for about 20-25 minutes at a submission interval of 3 seconds. When observing the memory usage there's nothing significant to see, also kinda stable. But after these 20-25 mins the server throws a StackOverflowException at the point where it deserializes the tcp-stream, especially when setting the Image property from the byte[]-array. I thoroughly searched for recursive or endless loops, and regarding the fact that it occurs after thousands of sucessfull intervals, i could hardly imagine that. public byte[] ImageBase { get { MemoryStream ms = new MemoryStream(); _screen.Save(ms, System.Drawing.Imaging.ImageFormat.Jpeg); return ms.GetBuffer(); } set { if (_screen != null) _screen.Dispose(); //preventing well-known image memory leak MemoryStream ms = new MemoryStream(value); try { _screen = Image.FromStream(ms); //<< EXCEPTION THROWING HERE } catch (StackOverflowException ex) //thx to new CLR management this wont work anymore -.- { Console.WriteLine(ex.Message + Environment.NewLine + ex.StackTrace); } ms.Dispose(); ms = null; } } I hope that more code would be unnecessary, or it could get very complex... Please help, i have no clue at all anymore thx Chris

    Read the article

  • What are alternatives to Win32 PulseEvent() function?

    - by Bill
    The documentation for the Win32 API PulseEvent() function (kernel32.dll) states that this function is “… unreliable and should not be used by new applications. Instead, use condition variables”. However, condition variables cannot be used across process boundaries like (named) events can. I have a scenario that is cross-process, cross-runtime (native and managed code) in which a single producer occasionally has something interesting to make known to zero or more consumers. Right now, a well-known named event is used (and set to signaled state) by the producer using this PulseEvent function when it needs to make something known. Zero or more consumers wait on that event (WaitForSingleObject()) and perform an action in response. There is no need for two-way communication in my scenario, and the producer does not need to know if the event has any listeners, nor does it need to know if the event was successfully acted upon. On the other hand, I do not want any consumers to ever miss any events. In other words, the system needs to be perfectly reliable – but the producer does not need to know if that is the case or not. The scenario can be thought of as a “clock ticker” – i.e., the producer provides a semi-regular signal for zero or more consumers to count. And all consumers must have the correct count over any given period of time. No polling by consumers is allowed (performance reasons). The ticker is just a few milliseconds (20 or so, but not perfectly regular). Raymen Chen (The Old New Thing) has a blog post pointing out the “fundamentally flawed” nature of the PulseEvent() function, but I do not see an alternative for my scenario from Chen or the posted comments. Can anyone please suggest one? Please keep in mind that the IPC signal must cross process boundries on the machine, not simply threads. And the solution needs to have high performance in that consumers must be able to act within 10ms of each event.

    Read the article

  • How can I call from my PC through my cisco ip phone?

    - by Enjoy coding
    Hi gurus, I am trying to call a telephone number fro my PC through my ip phone once my application completes its work. So I am searching for a way to access my ip phone from my PC. Please correct me if I am wrong or missing the obvious. On my PC in office selecting a phone in Microsoft office communicator and making calls from PC through my Cisco IP Phone is disabled. Is there any way i can programmatically call a external phone or mobile number from my PC as my ip phone is connected to my PC. I tried out etQuickDial and Make/Drop calls. But I am not able to find the appropriate way or setup to make calls. I also googled for any libraries and i saw some TAPI but was not able to get correct way. Please help me out with this. My cisco ip phone is 7940. My environment is Windows XP. Please let me know if you need more details. No problems with me even if you propose a solution involving coding or a non coding way of downloading and installing any applications. Thanks in advance. If you dont want me to post it here and If I need to put it in super user or server fault or some where else please direct me appropriately. I did not use any of these two before so I posted this question here.

    Read the article

  • Better why of looping to detect change.

    - by Dremation
    As of now I'm using a while(true) method to detect changes in memory. The problem with this is it's kill the applications performance. I have a list of 30 pointers that need checked as rapidly as possible for changes, without sacrificing a huge performance loss. Anyone have ideas on this? memScan = new Thread(ScanMem); public static void ScanMem() { int i = addy.Length; while (true) { Thread.Sleep(30000); //I do this to cut down on cpu usage for (int j = 0; j < i; j++) { string[] values = addy[j].Split(new char[] { Convert.ToChar(",") }); //MessageBox.Show(values[2]); try { if (Memory.Scanner.getIntFromMem(hwnd, (IntPtr)Convert.ToInt32(values[0], 16), 32).ToString() != values[1].ToString()) { //Ok, it changed lets do our work //work if (Globals.Working) return; SomeFunction("Results: " + values[2].ToString(), "Memory"); Globals.Working = true; }//end if }//end try catch { } }//end for }//end while }//end void

    Read the article

  • PyGTK, Glade, Changing the window view and threads

    - by Gaunt Face
    Heya Everyone, Forgive me if this seems like a stupid question, just so far no where on the internet can I find someone offering a solution to this and I just wanted to get some feedback from someone with more experience than myself (I've only been using python, pyGTK and Glade for 2 days now). I have a UI window displaying and it updates with messages from a thread that is handling a bluetooth connection. This is fine and I have the application closing and running quite reliably, the problem is, after a bluetooth connection is made I wish to maintain the bluetooth thread (i.e. keep the connection going) but completely change the UI of the main window. Now the impression I am getting from pyGTK applications made from glade, is that the easiest thing to do is just open a new window. Is this really the best option? Can I cut the tree of widgets off at the root, maintaining the window widget but add on a new set of widgets from a separate glade file? If opening a new window is the best option, am I right in assuming that the bluetooth thread can be kept alive during this transition, providing I update any callbacks? Any help or pointers would be great. Cheers, Matt

    Read the article

  • How do I get the Silverlight Add-On for Visual Studio 2010 and some example code?

    - by xarzu
    How do I get the Silverlight Add-On for Visual Studio 2010? And where can I find lots of example code? When the interent and html was new, one could find examples of how to build a website on a few trusted web sites. The same web sites might not be the best choice for looking for examples for Silverlight, I guess. What are the best web sites where you can look at examples -- and most importantly -- look at the source code of some examples of Silverlight? Back when MFC existed as a option that programmers might use to develop windows applications, a coder could look at a huge list of sample code and step through that code to find something that somewhat did what he was looking for and use that example code to build his own app. Is there anything like that for Silverlight? I have found the http://gallery.expression.microsoft.com/ Expression Blend Gallery and I have found the http://www.silverlight.net/community/samples/silverlight-samples/ Silverlight dot net community samples. I guess that will keep me busy for a while. Are there other sites? There are video instructions on MSDN's Channel9: http://channel9.msdn.com/tags/curso-silverlight-4/ Are there any videos in English? The video instructions look very good. Where is the links to the English versions? I was suggested this site for learning silverlight: http://channel9.msdn.com/learn/courses/Silverlight4/ This online documentation mentions "The Silverlight 4 Tools for Visual Studio 2010" which "is an add-on for Visual Studio 2010 that provides tooling for Microsoft Silverlight 4 and WCF RIA Services. It can be installed on top of either Visual Studio 2010 or Visual Web Developer 2010 Express" where can I find this? Is it shipped with Visual Studio 2010?

    Read the article

  • Link Maven OSGi to Maven NetBeans Platform Project

    - by mxro
    I am using NetBeans 6.9 Beta and I would like to accomplish the following: Set up a project representing the main application using Maven (for instance "Maven Project", "Maven NetBeans Application") Ideally, the project should only contain the necessary libraries to run in Apache Felix (I would like to be able to right-click the project and select "Run in Felix") I do not want that the project contains all the NetBean Platform APIs I would prefer to implement the modules using OSGi. For instance "Maven OSGi Bundle", "Maven NetBeans Module" + OSGi These are the problems, which I have at the moment: The standard Maven archetype ("Maven NetBeans Application") seems always to select all APIs and I have not found a way to deselect APIs - in normal NetBeans Platform Applications that can be accomplished by going to the project properties and deselected the platform modules) - I guess it has something to do with the NetBeans repository (http://bits.netbeans.org/maven2)? Do I have to create another repository? When creating normal "NetBeans Module" with OSGi support, the modules contain both NetBeans Module and OSGi meta data, which is nice. But the "Maven NetBeans Modules" have only NetBeans meta data and the Maven OSGi Bundles have only OSGi meta data). I figured out how to add modules to the project by using project / new and then placing the modules in the Maven project folder. However, I do not quite know yet how I could link to modules from other locations (NetBeans uses Maven modules, which have to be in the same directory as the project?). Below some useful links for Maven + OSGi in NetBeans wiki.netbeans.org/STS_69_Maven_OSGI NetBeans Maven OSGi Test Specification platform.netbeans.org/tutorials/nbm-maven-quickstart.html NetBeans Platform Quick Start Using Maven (6.9) wiki.netbeans.org/MavenBestPractices NetBeans Maven BestPractices maven.apache.org/pom.html#Aggregation Maven Documentation Multi-Module Projects (sorry about the missing protocol but couldn't post the message otherwise)

    Read the article

  • How to get a handle on all this middleware?

    - by jkohlhepp
    My organization has recently been wrestling the question of whether we should be incorporating different middleware products / concepts into our applications. Products we are looking at are things like Pegasystems, Oracle BPM / BPEL, BizTalk, Fair Isaac Blaze, etc., etc., etc. But I'm having a hard time getting a handle on all this. Before I go forward with evaluating the usefulness (positive or negative) of these different products I'm trying to get an understanding of all the different concepts in this space. I'm overwhelmed with an alphabet soup of BPM, ESB, SOA, CEP, WF, BRE, ERP, etc. Some products seem to cover one or more of those aspects, others focus on doing one. The terms all seem very ambiguous and conflated with each other. Is there a good resource out there to get a handle on all these different middleware concepts / patterns? A book? A website? An article that sums it up well? Bonus points if there is a resource that maps the various popular products into which pattern(s) they address. Thanks, ~ Justin

    Read the article

  • Project with multiple binaries in Eclipse CDT

    - by Robert Schneider
    I think it is quite normal to have more than one binary in a project. However, with Eclipse CDT I don't know how to set up the IDE to get things done. I know I can create several projects - one per binary. And I know I can set the dependencies per project. However, I cannot regard them as one project in Eclipse. If I'd like to share the code with a version control system (like svn), each developer has to import the projects separately. What I miss is something like the Solution (sln file) in Visual Studio. Should I create a single project and create the make files by myself? I haven't tried it out yet, but there is this 'project set' which can be ex- and imported. Is this the solution? Can this be put into version control? My goal it to put everything under version control, not only subprojects. I cannot imagine that CDT makes only sense for single-binary applications. How can I work properly?

    Read the article

  • Is there any way to access files in your source tree in Android?

    - by Chris Thompson
    Hi all, This is a bit unorthodox but I'm trying to figure out if there's a way to access files stored in the src tree of my applications apk in Android. I'm trying to use i-Jetty (Jetty implementation for Android) and rather than use it as a separate application and manually download my war file, I'd rather just bake i-jetty in. However, in order to use (easily) standard html/jsp I need to be able to give it a document root, preferably within my application's apk file. I know Android specifically works to prevent you from accessing (freely) the stuff on the actual system so this may not be possible, but I'm thinking it might be possible to access something within the apk. One option to work around this would be to have all of the files stored in the res directory and then copy them to the sdcard on startup but this wouldn't allow me to automatically remove the files on uninstall. To give you an idea of what I've tried, currently, the html files are stored in org.webtext.android Context rootContext = new Context(server_, "/", Context.SESSIONS); rootContext.setResourceBase("org/webtext/webapp"); Returns a 404 error. final URL url = this.getClassLoader().getResource("org/webtext/webapp"); Context html = new WebAppContext(url.toExternalForm(), "/"); Blows up with a NullPointerException because no URL is returned from the getResource call. Any thoughts would be greatly appreciated! Thanks, Chris

    Read the article

  • Ability to draw and record a signature as part of a form - iphone

    - by mustic
    Apolgies in advance for any errors.. new to this and am not a developer/programmer.. just have some basic unix experience. I have searched the web and struggled to find a solution to my problem when I stumbled onto this website which maybe suggested that there is a solution to my question. For work i use a windows mobile device because we have to get customers to sign and form after a customer visit. the signature being very important. On the windows device i use the notes application and am able to record details and obtain/record (using draw) a customer signature. the form is then emailed back to HQ. The format being used is a *.pwi I have downloaded and paid for several applications for my iphone which is my preferred device and cant quite find anything that does both. the critical bit here is to be able to take a signature on the phone, save the doc in a format such as .txt, .doc or .pdf where i can control the file name then be able to email back to HQ. Am i asking too much? I hope that makes sense.. Any help would be much appreciated many thanks in advance

    Read the article

  • SUA + Visual Studio + pthreads

    - by vasek7
    Hi, I cannot compile this code under SUA: #include <unistd.h> #include <stdio.h> #include <stdlib.h> #include <pthread.h> void * thread_function(void *arg) { printf("thread_function started. Arg was %s\n", (char *)arg); // pause for 3 seconds sleep(3); // exit and return a message to another thread // that may be waiting for us to finish pthread_exit ("thread one all done"); } int main() { int res; pthread_t a_thread; void *thread_result; // create a thread that starts to run ‘thread_function’ pthread_create (&a_thread, NULL, thread_function, (void*)"thread one"); printf("Waiting for thread to finish...\n"); // now wait for new thread to finish // and get any returned message in ‘thread_result’ pthread_join(a_thread, &thread_result); printf("Thread joined, it returned %s\n", (char *)thread_result); exit(0); } I'm running on Windows 7 Ultimate x64 with Visual Studio 2008 and 2010 and I have installed: Windows Subsystem for UNIX Utilities and SDK for Subsystem for UNIX-based Applications in Microsoft Windows 7 and Windows Server 2008 R2 Include directories property of Visual Studio project is set to "C:\Windows\SUA\usr\include" What I have to configure in order to compile and run (and possibly debug) pthreads programs in Visual Studio 2010 (or 2008)?

    Read the article

  • Why Java language does not offer a way to declare getters and setters of a given "field" through ann

    - by zim2001
    I actually happily design and develop JEE Applications for quite 9 years, but I realized recently that as time goes by, I feel more and more fed up of dragging all these ugly bean classes with their bunch of getters and setters. Considering a basic bean like this : public class MyBean { // needs getter AND setter private int myField1; // needs only a getter, no setter private int myField2; // needs only a setter, no getter private int myField3; /** * Get the field1 * @return the field1 */ public int getField1() { return myField1; } /** * Set the field1 * @param value the value */ public void setField1(int value) { myField1 = value; } /** * Get the field2 * @return the field2 */ public int getField2() { return myField2; } /** * Set the field3 * @param value the value */ public void setField3(int value) { myField3 = value; } } I'm dreaming of something like this : public class MyBean { @inout(public,public) private int myField1; @out(public) private int myField2; @in(public) private int myField3; } No more stupid javadoc, just tell the important thing... It would still be possible to mix annotation and written down getters or setters, to cover cases when it should do non-trivial sets and gets. In other words, annotation would auto-generate the getter / setter code piece except when a literate one is provided. Moreover, I'm also dreaming of replacing things like that : MyBean b = new MyBean(); int v = b.getField1(); b.setField3(v+1); by such : MyBean b = new MyBean(); int v = b.field1; b.field3 = v+1; In fact, writing "b.field1" on the right side of an expression would be semantically identical to write "b.getField1()", I mean as if it has been replaced by some kind of a preprocessor. It's just an idea but I'm wondering if I'm alone on that topic, and also if it has major flaws. I'm aware that this question doesn't exactly meet the SO credo (we prefer questions that can be answered, not just discussed) so I flag it community wiki...

    Read the article

  • TLS with SNI in Java clients

    - by ftrotter
    There is an ongoing discussion on the security and trust working group for NHIN Direct regarding the IP-to-domain mapping problem that is created with traditional SSL. If an HISP (as defined by NHIN Direct) wants to host thousands of NHIN Direct "Health Domains" for providers, then it will an "artificially inflated cost" to have to purchase an IP for each of those domains. Because Apache and OpenSSL have recently released TLS with support for the SNI extension, it is possible to use SNI as a solution to this problem on the server side. However, if we decide that we will allow server implementations of the NHINDirect transport layer to support TLS+SNI, then we must require that all clients support SNI too. OpenSSL based clients should do this by default and one could always us stunnel to implement an TLS+SNI aware client to proxy if your given programming language SSL implementation does not support SNI. It appears that native Java applications using OpenJDK do not yet support SNI, but I cannot get a straight answer out of that project. I know that there are OpenSSL Java libraries available but I have no idea if that would be considered viable. Can you give me a "state of the art" summary of where TLS+SNI support is for Java clients? I need a Java implementers perspective on this.

    Read the article

  • Monotouch or Titanium for rapid application development on IPhone?

    - by Ronnie
    As a .Net developer I always dreamed for the possibility to develop with my existing skills (c#) applications for the Iphone. Both programs require a Mac and the Iphone Sdk installed. Appcelerator Titanium was the first app I tried and it is based on exposing some Iphone native api to javascript so that they can be called using that language. Monotouch starts at $399 for beeing able to deploy on the Iphone and not on the Iphone simulator while Titanium is free. Monotouch (Monodevelop) has an Ide that is currently missing in Titanium (but you can use any editor like Textmate, Aptana...) I think both program generate at the end a native precompiled app (also if I am not sure about the size of the final app on the Iphone as I think the .Net framework calls are prelilnked at compilation time in Monotouch). I am also not sure about the full coverage of all the Iphone api and features. Titanium has also the advantage to enable Android app development but as a c# developer I still find Monotouch experience more like the Visual Studio one. Witch one would you choose and what are your experiences on Monotouch and Titanium?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How can I display the users profile pic using the facebook graph api?

    - by kielie
    Hi, I would like to display the users profile picture inside of my applications canvas page, is there a way to do that using the graph api? I know I can do it using FBML but I would also like to pass the profile pic to a flash game I am making, so I would have to get the profile pic from the api and send it as a variable, here is the code I have thus far, $facebook = new Facebook(array( 'appId' => FACEBOOK_APP_ID, 'secret' => FACEBOOK_SECRET_KEY, 'cookie' => true, 'domain' => 'myurl/facebook-test' )); $session = $facebook->getSession(); $uid = $facebook->getUser(); $me = $facebook->api('/me'); $updated = date("l, F j, Y", strtotime($me['updated_time'])); echo "Hello " . $me['name'] . $me['picture'] . "<br />"; echo "<div style=\"background:url(images/bg.jpg); width:760px; height:630px;\">" . "You last updated your profile on " . $updated . "</div>" . "<br /> your uid is" . $uid; Thanx in advance!

    Read the article

  • Automatically generating Regex from set of strings residing in DB C#

    - by Muhammad Adeel Zahid
    Hello Everyone i have about 100,000 strings in database and i want to if there is a way to automatically generate regex pattern from these strings. all of them are alphabetic strings and use set of alphabets from English letters. (X,W,V) is not used for example. is there any function or library that can help me achieve this target in C#. Example Strings are KHTK RAZ given these two strings my target is to generate a regex that allows patterns like (k, kh, kht,khtk, r, ra, raz ) case insensitive of course. i have downloaded and used some C# applications that help in generating regex but that is not useful in my scenario because i want a process in which i sequentially read strings from db and add rules to regex so this regex could be reused later in the application or saved on the disk. i m new to regex patterns and don't know if the thing i m asking is even possible or not. if it is not possible please suggest me some alternate approach. Any help and suggestions are highly appreciated. regards Adeel Zahid

    Read the article

  • Memory mapped files and "soft" page faults. Unavoidable?

    - by Robert Oschler
    I have two applications (processes) running under Windows XP that share data via a memory mapped file. Despite all my efforts to eliminate per iteration memory allocations, I still get about 10 soft page faults per data transfer. I've tried every flag there is in CreateFileMapping() and CreateFileView() and it still happens. I'm beginning to wonder if it's just the way memory mapped files work. If anyone there knows the O/S implementation details behind memory mapped files I would appreciate comments on the following theory: If two processes share a memory mapped file and one process writes to it while another reads it, then the O/S marks the pages written to as invalid. When the other process goes to read the memory areas that now belong to invalidated pages, this causes a soft page fault (by design) and the O/S knows to reload the invalidated page. Also, the number of soft page faults is therefore directly proportional to the size of the data write. My experiments seem to bear out the above theory. When I share data I write one contiguous block of data. In other words, the entire shared memory area is overwritten each time. If I make the block bigger the number of soft page faults goes up correspondingly. So, if my theory is true, there is nothing I can do to eliminate the soft page faults short of not using memory mapped files because that is how they work (using soft page faults to maintain page consistency). What is ironic is that I chose to use a memory mapped file instead of a TCP socket connection because I thought it would be more efficient. Note, if the soft page faults are harmless please note that. I've heard that at some point if the number is excessive, the system's performance can be marred. If soft page faults intrinsically are not significantly harmful then if anyone has any guidelines as to what number per second is "excessive" I'd like to hear that. Thanks.

    Read the article

  • From VB6 to .net via COM and Remoting...What a mess!

    - by Robert
    I have some legacy vb6 applications that need to talk to my .Net engine application. The engine provides an interface that can be connected to via .net Remoting. Now I have a stub class library that wraps all of the types that the interface exposes. The purpose of this stub is to translate my .net types into COM-friendly types. When I run this class library as a console application, it is able to connect to the engine, call various methods, and successfully return the wrapped types. The next step in the chain is to allow my VB6 application to call this COM enabled stub. This works fine for my main engine-entry type (IModelFetcher which is wrapped as COM_ModelFetcher). However, when I try and get any of the model fetcher's model types (IClientModel, wrapped as COM_IClientModel, IUserModel, wrapped as COM_IUserModel, e.t.c.), I get the following exception: [Exception - type: System.InvalidCastException 'Return argument has an invalid type.'] in mscorlib at System.Runtime.Remoting.Proxies.RealProxy.ValidateReturnArg(Object arg, Type paramType) at System.Runtime.Remoting.Proxies.RealProxy.PropagateOutParameters(IMessage msg, Object[] outArgs, Object returnValue) at System.Runtime.Remoting.Proxies.RealProxy.HandleReturnMessage(IMessage reqMsg, IMessage retMsg) at System.Runtime.Remoting.Proxies.RealProxy.PrivateInvoke(MessageData& msgData, Int32 type) at AWT.Common.AWTEngineInterface.IModelFetcher.get_ClientModel() at AWT.Common.AWTEngineCOMInterface.COM_ModelFetcher.GetClientModel() The first thing I did when I saw this was to handle the 'AppDomain.CurrentDomain.AssemblyResolve' event, and this allowed me to load the required assemblies. However, I'm still getting this exception now. My AssemblyResolve event handler is loading three assemblies correctly, and I can confirm that it does not get called prior to this exception. Can someone help me untie myself from this mess of interprocess communication?!

    Read the article

< Previous Page | 560 561 562 563 564 565 566 567 568 569 570 571  | Next Page >