Search Results

Search found 15081 results on 604 pages for 'passing by reference'.

Page 564/604 | < Previous Page | 560 561 562 563 564 565 566 567 568 569 570 571  | Next Page >

  • how to send put request with data as an xml element, from JavaScript ?

    - by Sarang
    Hi everyone, My data is an xml element & I want send PUT request with JavaScript. How do I do this ? For reference : Update Cell As per fredrik suggested, I did this : function submit(){ var xml = "<entry>" + "<id>https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1</id>" + "<link rel=\"edit\" type=\"application/atom+xml\"" + "href=\"https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/worksheetId/private/full/R2C1\"/>" + "<gs:cell row=\"2\" col=\"1\" inputValue=\"300\"/>" + "</entry>"; document.getElementById('submitForm').submit(xml); } </script> </head> <body> <form id="submitForm" method="put" action="https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1"> <input type="submit" value="submit" onclick="submit()"/> </form> However, it doesn't write back but positively it returns xml file like : <?xml version='1.0' encoding='UTF-8'?> <entry xmlns='http://www.w3.org/2005/Atom' xmlns:gs='http://schemas.google.com/spreadsheets/2006' xmlns:batch='http://schemas.google.com/gdata/batch'> <id>https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1</id> <updated>2011-01-11T07:35:09.767Z</updated> <category scheme='http://schemas.google.com/spreadsheets/2006' term='http://schemas.google.com/spreadsheets/2006#cell'/> <title type='text'>A2</title> <content type='text'></content> <link rel='self' type='application/atom+xml' href='https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1'/> <link rel='edit' type='application/atom+xml' href='https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1/1ekg'/> <gs:cell row='2' col='1' inputValue=''></gs:cell> </entry> Any further solution for the same ?

    Read the article

  • Android Multiple objects in SimpleAdapter

    - by Adam Sherratt
    I have a need (unless you can think of a better way) of passing multiple objects to a custom list adapter. I know that I'm barking up the wrong tree here, and would appreciate someone setting me on the right course! Thanks playlistadapter = new MyPlaylistAdapter(MyApplication.getAppContext(), songsList, retained_songsList, folderMode, R.layout.file_view, new String[] { "songTitle","songAlbum", "songPath" }, new int[] { R.id.checkTextView, R.id.text2, R.id.text3 }); And my adapter class: public class MyPlaylistAdapter extends SimpleAdapter{ private ArrayList <Song> songsList = new ArrayList<Song>(); private ArrayList <Song> retained_songsList = new ArrayList<Song>(); private ArrayList<Song> playlistcheck = new ArrayList<Song>(); private String folderMode; private String TAG = "AndroidMediaCenter"; public MyPlaylistAdapter(Context context,List<Song> SongsList, List<Song> Retained_songsList, String FolderMode,int resource, String[] from, int[] to) { super(context, null, resource, from, to); songsList.clear(); songsList.addAll(SongsList); Log.i(TAG, "MyPlayListAdapter Songslist = " + songsList.size()); retained_songsList.clear(); retained_songsList.addAll(Retained_songsList); folderMode = FolderMode; } public View getView(int position, View convertView, ViewGroup parent) { //PlayListViewHolder holder; CheckedTextView checkTextView; TextView text2; TextView text3; if (convertView == null) { LayoutInflater inflater = (LayoutInflater) MyApplication.getAppContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); //LayoutInflater inflater=getLayoutInflater(); convertView=inflater.inflate(R.layout.file_view, parent, false); //convertView.setBackgroundColor(0xFF00FF00 ); //holder = new PlayListViewHolder(); checkTextView = (CheckedTextView) convertView.findViewById(R.id.checkTextView); text2 = (TextView) convertView.findViewById(R.id.text2); text3 = (TextView) convertView.findViewById(R.id.text3); //convertView.setTag(holder); } else { //holder = (PlayListViewHolder) convertView.getTag(); } //put something into textviews String tracks = null; String tracks_Details = null; String trackspath = null; tracks = songsList.get(position).getSongTitle(); tracks_Details = songsList.get(position).getAlbum() + " (" + songsList.get(position).getArtist() + ")"; trackspath = songsList.get(position).getSongPath(); checkTextView = (CheckedTextView) convertView.findViewById(R.id.checkTextView); text2 = (TextView) convertView.findViewById(R.id.text2); text3 = (TextView) convertView.findViewById(R.id.text3); checkTextView.setText(tracks); if(folderMode.equals("Playlists")){ checkTextView.setBackgroundColor(Color.GREEN); checkTextView.setChecked(false); try { int listsize_rs = retained_songsList.size(); for (int j = 0; j<listsize_rs;j++){ if((retained_songsList.get(j).getSongPath()).equals(songsList.get(position).getSongPath())){ checkTextView.setBackgroundColor(Color.TRANSPARENT); //Need to check here whether the checkedtextview is ticked or not checkTextView.setChecked(true); playlistcheck.add(songsList.get(position)); break; } } } catch (Exception e) { e.printStackTrace(); } }else { //Need to check here whether the checkedtextview is ticked or not try { if (songsList.get(position).getSongCheckedStatus()==true){ checkTextView.setChecked(true); }else{ checkTextView.setChecked(false); } } catch (Exception e) { e.printStackTrace(); } } text2.setText(tracks_Details); text3.setText(trackspath); Log.i(TAG, "MyPlayListAdapter Songslist = " + songsList.size()); return convertView; } } However, this doesn't inflate, throwing the following errors: 10-26 23:11:09.464: E/AndroidRuntime(2826): FATAL EXCEPTION: main 10-26 23:11:09.464: E/AndroidRuntime(2826): java.lang.RuntimeException: Error receiving broadcast Intent { act=android.intent.action.GetMusicComplete flg=0x10 } in com.Nmidia.AMC.MusicActivity$18@414c5770 10-26 23:11:09.464: E/AndroidRuntime(2826): at android.app.LoadedApk$ReceiverDispatcher$Args.run(LoadedApk.java:765) 10-26 23:11:09.464: E/AndroidRuntime(2826): at android.os.Handler.handleCallback(Handler.java:615) 10-26 23:11:09.464: E/AndroidRuntime(2826): at android.os.Handler.dispatchMessage(Handler.java:92) 10-26 23:11:09.464: E/AndroidRuntime(2826): at android.os.Looper.loop(Looper.java:137) 10-26 23:11:09.464: E/AndroidRuntime(2826): at android.app.ActivityThread.main(ActivityThread.java:4745) 10-26 23:11:09.464: E/AndroidRuntime(2826): at java.lang.reflect.Method.invokeNative(Native Method) 10-26 23:11:09.464: E/AndroidRuntime(2826): at java.lang.reflect.Method.invoke(Method.java:511) 10-26 23:11:09.464: E/AndroidRuntime(2826): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:786) 10-26 23:11:09.464: E/AndroidRuntime(2826): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:553) 10-26 23:11:09.464: E/AndroidRuntime(2826): at dalvik.system.NativeStart.main(Native Method) 10-26 23:11:09.464: E/AndroidRuntime(2826): Caused by: java.lang.NullPointerException 10-26 23:11:09.464: E/AndroidRuntime(2826): at android.widget.SimpleAdapter.getCount(SimpleAdapter.java:93) 10-26 23:11:09.464: E/AndroidRuntime(2826): at android.widget.ListView.setAdapter(ListView.java:460) 10-26 23:11:09.464: E/AndroidRuntime(2826): at com.Nmidia.AMC.MusicActivity.setFilterMusic(MusicActivity.java:1230) 10-26 23:11:09.464: E/AndroidRuntime(2826): at com.Nmidia.AMC.MusicActivity$18.onReceive(MusicActivity.java:996) 10-26 23:11:09.464: E/AndroidRuntime(2826): at android.app.LoadedApk$ReceiverDispatcher$Args.run(LoadedApk.java:755) 10-26 23:11:09.464: E/AndroidRuntime(2826): ... 9 more

    Read the article

  • How do I check for the existence of an external file with XSL?

    - by LOlliffe
    I've found a lot of examples that reference Java and C for this, but how do I, or can I, check for the existence of an external file with XSL. First, I realize that this is only a snippet, but it's part of a huge stylesheet, so I'm hoping it's enough to show my issue. <!-- Use this template for Received SMSs --> <xsl:template name="ReceivedSMS"> <!-- Set/Declare "SMSname" variable (local, evaluates per instance) --> <xsl:variable name="SMSname"> <xsl:value-of select=" following-sibling::Name"/> </xsl:variable> <fo:table font-family="Arial Unicode MS" font-size="8pt" text-align="start"> <fo:table-column column-width=".75in"/> <fo:table-column column-width="6.75in"/> <fo:table-body> <fo:table-row> <!-- Cell contains "speakers" icon --> <fo:table-cell display-align="after"> <fo:block text-align="start"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> What I'd like to do, is put in an "if" statement, surronding the {$SMSname}.jpg line. That is: <fo:block text-align="start"> <xsl:if test="exists( the external file {$SMSname}.jpg)"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> </xsl:if> <xsl:if test="not(exists( the external file {$SMSname}.jpg))"> <fo:external-graphic src="../images/unknown.jpg" content-height="0.6in"/> </xsl:if> </fo:block> Because of "grouping", etc., I'm using XSLT 2.0. I hope that this is something that can be done. I hope even more that it's something simple. As always, thanks in advance for any help. LO

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • Rails 3 NameError (cannot remove Object::Version) error

    - by Jeff D
    Can anyone point me at what might be causing this error? There is no ApplicationTrace, and it locks the server hard on my development machine. I think it has something to do with the way rails reloads your classes in development mode, and it appears to have something to do with a Version constant. I can't find a reference to this though. Can anyone point me in the direction of what would cause this? activesupport (3.0.3) lib/active_support/dependencies.rb:645:in `remove_const' activesupport (3.0.3) lib/active_support/dependencies.rb:645:in `remove_constant' activesupport (3.0.3) lib/active_support/dependencies.rb:645:in `instance_eval' activesupport (3.0.3) lib/active_support/dependencies.rb:645:in `remove_constant' activesupport (3.0.3) lib/active_support/dependencies.rb:521:in `remove_unloadable_constants!' activesupport (3.0.3) lib/active_support/dependencies.rb:521:in `each' activesupport (3.0.3) lib/active_support/dependencies.rb:521:in `remove_unloadable_constants!' activesupport (3.0.3) lib/active_support/dependencies.rb:317:in `clear' railties (3.0.3) lib/rails/application/bootstrap.rb:60:in `_callback_after_7' activesupport (3.0.3) lib/active_support/callbacks.rb:419:in `_run_call_callbacks' actionpack (3.0.3) lib/action_dispatch/middleware/callbacks.rb:44:in `call' rack (1.2.1) lib/rack/sendfile.rb:107:in `call' actionpack (3.0.3) lib/action_dispatch/middleware/remote_ip.rb:48:in `call' actionpack (3.0.3) lib/action_dispatch/middleware/show_exceptions.rb:46:in `call' railties (3.0.3) lib/rails/rack/logger.rb:13:in `call' rack (1.2.1) lib/rack/runtime.rb:17:in `call' activesupport (3.0.3) lib/active_support/cache/strategy/local_cache.rb:72:in `call' rack (1.2.1) lib/rack/lock.rb:11:in `call' rack (1.2.1) lib/rack/lock.rb:11:in `synchronize' rack (1.2.1) lib/rack/lock.rb:11:in `call' actionpack (3.0.3) lib/action_dispatch/middleware/static.rb:30:in `call' railties (3.0.3) lib/rails/application.rb:168:in `call' railties (3.0.3) lib/rails/application.rb:77:in `send' railties (3.0.3) lib/rails/application.rb:77:in `method_missing' railties (3.0.3) lib/rails/rack/log_tailer.rb:14:in `call' rack (1.2.1) lib/rack/content_length.rb:13:in `call' rack (1.2.1) lib/rack/handler/webrick.rb:52:in `service' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/httpserver.rb:104:in `service' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/httpserver.rb:65:in `run' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/server.rb:173:in `start_thread' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/server.rb:162:in `start' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/server.rb:162:in `start_thread' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/server.rb:95:in `start' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/server.rb:92:in `each' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/server.rb:92:in `start' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/server.rb:23:in `start' /Volumes/files/jeffdeville/.rvm/rubies/ree-1.8.7-2010.02/lib/ruby/1.8/webrick/server.rb:82:in `start' rack (1.2.1) lib/rack/handler/webrick.rb:13:in `run' rack (1.2.1) lib/rack/server.rb:213:in `start' railties (3.0.3) lib/rails/commands/server.rb:65:in `start' railties (3.0.3) lib/rails/commands.rb:30 railties (3.0.3) lib/rails/commands.rb:27:in `tap' railties (3.0.3) lib/rails/commands.rb:27 script/rails:6:in `require' script/rails:6

    Read the article

  • Assembly Load and loading the "sub-modules" dependencies - "cannot fild the file specified"

    - by Ted
    There are several questions out there that ask the same question. However the answers they received I cannot understand, so here goes: Similar questions: http://stackoverflow.com/questions/1874277/dynamically-load-assembly-and-manually-force-path-to-get-referenced-assemblies ; http://stackoverflow.com/questions/22012/loading-assemblies-and-its-dependencies-closed The question in short: I need to figure out how dependencies, ie References in my modules can be loaded dynamically. Right now I am getting "The system cannot find the file specified" on Assemblies referenced in my so called modules. I cannot really get how to use the AssemblyResolve event... The longer version I have one application, MODULECONTROLLER, that loads separate modules. These "separate modules" are located in well-known subdirectories, like appBinDir\Modules\Module1 appBinDir\Modules\Module2 Each directory contains all the DLLs that exists in the bin-directory of those projects after a build. So the MODULECONTROLLER loads all the DLLs contained in those folders using this code: byte[] bytes = File.ReadAllBytes(dllFileFullPath); Assembly assembly = null; assembly = Assembly.Load(bytes); I am, as you can see, loading the byte[]-array (so I dont lock the DLL-files). Now, in for example MODULE1, I have a static reference called MyGreatXmlProtocol. The MyGreatXmlProtocol.dll then also exists in the directory appBinDir\Modules\Module1 and is loaded using the above code When code in the MODULE1 tries to use this MyGreatXmlProtocol, I get: Could not load file or assembly 'MyGreatXmlProtocol, Version=1.0.3797.26527, Culture=neutral, PublicKeyToken=null' or one of its dependencies. The system cannot find the file specified. So, in a post (like this one) they say that To my understanding reflection will load the main assembly and then search the GAC for the referenced assemblies, if it cannot find it there, you can then incorparate an assemblyResolve event: First; is it really needed to use the AssemblyResolve-event to make this work? Shouldnt my different MODULEs themself load their DLLs, as they are statically referenced? Second; if AssemblyResolve is the way to go - how do I use it? I have attached a handler to the Event but I never get anything on MyGreatXmlProctol... === EDIT === CODE regarding the AssemblyResolve-event handler: public GUI() { InitializeComponent(); AppDomain.CurrentDomain.AssemblyResolve += new ResolveEventHandler(CurrentDomain_AssemblyResolve); ... } // Assembly CurrentDomain_AssemblyResolve(object sender, ResolveEventArgs args) { Console.WriteLine(args.Name); return null; } Hope I wasnt too fuzzy =) Thx

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • Displaying a notification when bluetooth is disconnected - Android

    - by Ryan T
    I am trying to create a program that will display a notification to the user if a Blue tooth device suddenly comes out of range from my Android device. I currently have the following code but no notification is displayed. I was wondering if it was possible I shouldn't use ACTION_ACL_DISCONNECTED because I believe the bluetooth stack would be expecting packets that state a disconnect is requested. My requirements state that the bluetooth device will disconnect without warning. Thank you for any assistance! BluetoothNotification.java: //This is where the notification is created. import android.app.Activity; import android.app.Notification; import android.app.NotificationManager; import android.app.PendingIntent; import android.content.Context; import android.content.Intent; import android.os.Bundle; import android.app.Activity; import android.app.Notification; import android.app.NotificationManager; import android.app.PendingIntent; import android.content.Context; import android.content.Intent; import android.os.Bundle; public class BluetoothNotification extends Activity { public static final int NOTIFICATION_ID = 1; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); /** Define configuration for our notification */ int icon = R.drawable.logo; CharSequence tickerText = "This is a sample notification"; long when = System.currentTimeMillis(); Context context = getApplicationContext(); CharSequence contentTitle = "Sample notification"; CharSequence contentText = "This notification has been generated as a result of BT Disconnecting"; Intent notificationIntent = new Intent(this, BluetoothNotification.class); PendingIntent contentIntent = PendingIntent.getActivity(this, 0, notificationIntent, 0); /** Initialize the Notification using the above configuration */ final Notification notification = new Notification(icon, tickerText, when); notification.setLatestEventInfo(context, contentTitle, contentText, contentIntent); /** Retrieve reference from NotificationManager */ String ns = Context.NOTIFICATION_SERVICE; final NotificationManager mNotificationManager = (NotificationManager) getSystemService(ns); mNotificationManager.notify(NOTIFICATION_ID, notification); finish(); } } Snippet from OnCreate: //Located in Controls.java IntentFilter filter1 = new IntentFilter(BluetoothDevice.ACTION_ACL_DISCONNECTED); this.registerReceiver(mReceiver, filter1); Snippet from Controls.java: private final BroadcastReceiver mReceiver = new BroadcastReceiver() { @Override public void onReceive(Context context, Intent intent) { String action = intent.getAction(); BluetoothDevice device = intent.getParcelableExtra(BluetoothDevice.EXTRA_DEVICE); if (BluetoothDevice.ACTION_ACL_DISCONNECTED.equals(action)) { //Device has disconnected NotificationManager nm = (NotificationManager) getSystemService(NOTIFICATION_SERVICE); } } };

    Read the article

  • Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • What is the best practice to segment c#.net projects based on a single base project

    - by Anthony
    Honestly, I can't word my question any better without describing it. I have a base project (with all its glory, dlls, resources etc) which is a CMS. I need to use this project as a base for othe custom bake projects. This base project is to be maintained and updated among all custom bake projects. I use subversion (Collabnet and Tortise SVN) I have two questions: 1 - Can I use subversion to share the base project among other projects What I mean here is can I "Checkout" the base project into another "Checked Out" project and have both update and commit seperatley. So, to paint a picture, let's say I am working on a custom project and I modify the core/base prject in some way (which I know will suit the others) can I then commit those changes and upon doing so when I update the base project in the other "Checked out" resources will it pull the changes? In short, I would like not to have to manually deploy updated core files whenever I make changes into each seperate project. 2 - If I create a custom file (let's say an webcontrol or aspx page etc) can I have it compile seperatley from the base project Another tricky one to explain. When I publish my web application it creates DLLs based on the namespaces of projects attached to it. So I may have a number of DLLs including the "Website's" namespace DLL, which could simply be website. I want to be able to make a seperate, custom, control which does not compile into those DLLs as the custom files should not rely on those DLLS to run. Is it as simple to set a seperate namespace for those files like CustomFiles.ProjectName for example? Think of the whole idea as adding modules to the .NET project, I don't want the module's code in any of the core DLLs but I do need for module to be able to access the core dlls. (There is no need for the core project to access the module code as it should be one way only in theory, though I reckon it woould not be possible anyway without using JSON/SOAP or something like that, maybe I am wrong.) I want to create a pluggable environment much like that of Joomla/Wordpress as since PHP generally doesn't have to be compiled first I see this is the reason why all this is possible/easy. The idea is to allow pluggable themes, modules etc etc. (I haven't tried simply adding .NET themes after compile/publish but I am assuming this is possible anyway? OR does the compiler need to reference items in the files?)

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • Spring's JdbcDaoSupport (using MySQL Connector/J) fails after executing sql that adds FK

    - by John
    I am using Spring's JdbcDaoSupport class with a DriverManagerDataSource using the MySQL Connector/J 5.0 driver (driverClassName=com.mysql.jdbc.driver). allowMultiQueries is set to true in the url. My application is an in-house tool we recently developed that executes sql scripts in a directory one-by-one (allows us to re-create our schema and reference table data for a given date, etc, but I digress). The sql scripts sometime contain multiple statements (hence allowMultiQueries), so one script can create a table, add indexes for that table, etc. The problem happens when including a statement to add a foreign key constraint in one of these files. If I have a file that looks like... --(column/constraint names are examples) CREATE TABLE myTable ( fk1 BIGINT(19) NOT NULL, fk2 BIGINT(19) NOT NULL, PRIMARY KEY (fk1, fk2) ); ALTER TABLE myTable ADD CONSTRAINT myTable_fk1 FOREIGN KEY (fk1) REFERENCES myOtherTable (id) ; ALTER TABLE myTable ADD CONSTRAINT myTable_fk2 FOREIGN KEY (fk2) REFERENCES myOtherOtherTable (id) ; then JdbcTemplate.execute throws an UncategorizedSqlException with the following error message and stack trace: Exception in thread "main" org.springframework.jdbc.UncategorizedSQLException: StatementCallback; uncategorized SQLException for SQL [ THE SQL YOU SEE ABOVE LISTED HERE ]; SQL state [HY000]; error code [1005]; Can't create table 'myDatabase.myTable' (errno: 150); nested exception is java.sql.SQLException: Can't create table 'myDatabase.myTable' (errno: 150) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:83) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) and the table and foreign keys are not inserted. Also, especially weird: if I take the foreign key statements out of the script I showed above and then place them in their own script that executes after (so I now have 1 script with just the create table statement, and 1 script with the add foreign key statements that executes after that) then what happens is: tool executes create table script, works fine, table is created tool executes add fk script, throws the same exception as seen above (except errno=121 this time), but the FKs actually get added (!!!) In other words, when the create table/FK statements are in the same script then the exception is thrown and nothing is created, but when they are different scripts a nearly identical exception is thrown but both things get created. Any help on this would be greatly appreciated. Please let me know if you'd like me to clarify anything more.

    Read the article

  • Unset/Change Binding in WPF

    - by captcalamares
    How can I unset the binding applied to an object so that I can apply another binding to it from a different location? Suppose I have two data templates binded to the same object reference. Data Template #1 is the default template to be loaded. I try to bind a button command to a Function1 from my DataContext class: <Button Content="Button 1" CommandParameter="{Binding }" Command="{Binding DataContext.Function1, RelativeSource={RelativeSource AncestorType={x:Type Window}}}"/> This actually works and the function gets binded. However, when I try to load Data Template # 2 to the same object (while trying to bind another button command to a different function (Function2) from my DataContext class): <Button Content="Button 2" CommandParameter="{Binding }" Command="{Binding DataContext.Function2, RelativeSource={RelativeSource AncestorType={x:Type Window}}}" /> It doesn't work and the first binding is still the one executed. Is there a workaround to this? EDIT (for better problem context): I defined my templates in my Window.Resources: <Window.Resources> <DataTemplate DataType="{x:Type local:ViewModel1}"> <local:View1 /> </DataTemplate> <DataTemplate DataType="{x:Type local:ViewModel2}"> <local:View2 /> </DataTemplate> </Window.Resources> The View1.xaml and the View2.xaml contain the button definitions that I described above (I want them to command the control of my process flow). ViewModel1 and ViewModel2 are my ViewModels that implement the interface IPageViewModel which is the type of my variable CurrentPageViewModel. In my XAML, I binded ContentControl to the variable CurrentPageViewModel: <ContentControl Content="{Binding CurrentPageViewModel}" HorizontalAlignment="Center"/> In my .CS, I have a list defined as List<IPageViewModel> PageViewModels, which I use to contain the instances of my two View Models: PageViewModels.Add(new ViewModel1()); PageViewModels.Add(new ViewModel2()); // Set starting page CurrentPageViewModel = PageViewModels[0]; When I try to change my CurrentPageViewModel to the other view model, this is when I want the new binding to work. Unfortunately, it doesn't. Am I doing things the right way?

    Read the article

  • Windows phone app xaml error

    - by thewarri0r9
    i am developing an app for windows phone 8 and i stuck on this code which visual studio showing invalid xaml. But Code compiles and works well. Invalid xaml Code is : <DataTemplate x:Key="AddrBookItemTemplate"> <StackPanel Margin="0,0,0,2" Orientation="Horizontal"> <StackPanel Width="80" Orientation="Horizontal" Height="80"> <Ellipse Margin="0" Height="70" Width="70" HorizontalAlignment="Left" Stroke="{x:Null}"> <Ellipse.Fill> <ImageBrush Stretch="Fill" ImageSource="{Binding imageBytes, Converter={StaticResource BytesToImageConverter}}"/> </Ellipse.Fill> </Ellipse> </StackPanel> <StackPanel Height="80" Margin="0" Width="380" HorizontalAlignment="Left"> <TextBlock FontWeight="Bold" Text="{Binding FirstName}" FontFamily="Segoe WP Semibold" FontSize="30" VerticalAlignment="Top" Margin="5,0,0,0" HorizontalAlignment="Left" /> <TextBlock Text="{Binding Phone}" FontFamily="Segoe WP" FontSize="24" Foreground="{StaticResource PhoneTextBoxReadOnlyBrush}" Margin="5,0,0,-12" Width="320" HorizontalAlignment="Left" VerticalAlignment="Top"/> </StackPanel> </StackPanel> </DataTemplate> I am serializing image by converting it to byte, it works fine but if image is null it gives an error. code behind: if (e.Results != null) { List<AddressBook> source = new List<AddressBook>(); foreach (var result in e.Results) { if (result.PhoneNumbers.FirstOrDefault() != null && result.GetPicture()!=null) { BitmapImage bmp = new BitmapImage(); BitmapImage nullbmp = new BitmapImage(); if (result.GetPicture() == null) { bmp.UriSource = new Uri(@"/Images/ci2.png", UriKind.RelativeOrAbsolute); } else { bmp.SetSource(result.GetPicture()); } listobj.Add(new AddressBook() { FirstName = result.DisplayName != null ? result.DisplayName : "", imageBytes = AddressBook.imageConvert(bmp), EmailAddress = "", LastName = "", Phone = result.PhoneNumbers.FirstOrDefault() != null ? result.PhoneNumbers.FirstOrDefault().PhoneNumber : "", }); } } Above code show an error "object reference not set to instance of an object". I want to show the default image (or color) in ellipse when image is null.What should I do?

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Saving JQuery Draggable Sitemap Values Correctly

    - by mdolon
    I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

    Read the article

  • initializing a vector of custom class in c++

    - by Flamewires
    Hey basically Im trying to store a "solution" and create a vector of these. The problem I'm having is with initialization. Heres my class for reference class Solution { private: // boost::thread m_Thread; int itt_found; int dim; pfn_fitness f; double value; std::vector<double> x; public: Solution(size_t size, int funcNo) : itt_found(0), x(size, 0.0), value(0.0), dim(30), f(Eval_Functions[funcNo]) { for (int i = 1; i < (int) size; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[funcNo]; } } Solution() : itt_found(0), x(31, 0.0), value(0.0), dim(30), f(Eval_Functions[1]) { for (int i = 1; i < 31; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[1]; } } Solution operator= (Solution S) { x = S.GetX(); itt_found = S.GetIttFound(); dim = S.GetDim(); f = S.GetFunc(); value = S.GetValue(); return *this; } void start() { value = f (dim, x); } /* plus additional getter/setter methods*/ } Solution S(30, 1) or Solution(2, 5) work and initalizes everything, but I need X of these solution objects. std::vector<Solution> Parents(X) will create X solutions with the default constructor and i want to construct using the (int, int) constructor. Is there any easy(one liner?) way to do this? Or would i have to do something like: size_t numparents = 10; vector<Solution> Parents; Parents.reserve(numparents); for (int i = 0; i<(int)numparents; i++) { Solution S(31, 0); Parents.push_back(S); }

    Read the article

  • Pass param to a silverlight application

    - by Lucas_Santos
    In my javascript I create my <OBJECT> tag var htmlEmbedSilverlight = "<div id='silverlightControlHost'> " + "<object data='data:application/x-silverlight-2,' type='application/x-silverlight-2' width='550px' height='250px'> " + "<param name='source' value='../../ClientBin/FotoEmprestimoChave.xap'/> " + "<param name='onError' value='onSilverlightError' /> " + "<param name='background' value='white' /> " + "<param name='minRuntimeVersion' value='4.0.60310.0' /> " + "<param name='autoUpgrade' value='true' /> " + "<param name='initparams' values='chave_id=" + data + "' /> " + "<a href='http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0' style='text-decoration:none'> " + "<img src='http://go.microsoft.com/fwlink/?LinkId=161376' alt='Get Microsoft Silverlight' style='border-style:none'/> " + "</a> " + "</object><iframe id='_sl_historyFrame' style='visibility:hidden;height:0px;width:0px;border:0px'></iframe></div>"; $("#tiraFotoSilverlight").html(htmlEmbedSilverlight); This is a reference to my Silverlight application where I call in my Web Application. The problem is my <param name='initparams' values='chave_id=" + data + "' /> " because in my App.xaml in Silverlight, I have the code below private void Application_Startup(object sender, StartupEventArgs e) { if (e.InitParams != null) { foreach (var item in e.InitParams) { this.Resources.Add(item.Key, item.Value); } } this.RootVisual = new MainPage(); } Where InitParams always has Count = 0 and I don't know why. Can someone help me ? I'm just trying to pass a value to my Silverlight application, without a PostBack. Rendered <object width="550px" height="250px" type="application/x-silverlight-2" data="data:application/x-silverlight-2,"> <param value="../../ClientBin/FotoEmprestimoChave.xap" name="source"> <param value="onSilverlightError" name="onError"> <param value="white" name="background"> <param value="4.0.60310.0" name="minRuntimeVersion"> <param value="true" name="autoUpgrade"> <param values="chave_id=1" name="initparams"> <a style="text-decoration:none" href="http://go.microsoft.com/fwlink/?LinkID=149156&v=4.0.60310.0"> </object>

    Read the article

< Previous Page | 560 561 562 563 564 565 566 567 568 569 570 571  | Next Page >