Search Results

Search found 15210 results on 609 pages for 'technical writing'.

Page 569/609 | < Previous Page | 565 566 567 568 569 570 571 572 573 574 575 576  | Next Page >

  • Find a base case for a recursive void method

    - by Evan S
    I am doing homework. I would like to build a base case for a recursion where ordering given numbers (list2) in ascending order. Purpose of writing this codes is that when all numbers are in ascending order then should stop calling a method called ascending(list2, list1); and all values in list2 should be shipped to list1. For instance, list2 = 6,5,4,3,2,1 then list2 becomes empty and list1 should be 1,2,3,4,5,6. I am trying to compare result with previous one and if matches then stop. But I can't find the base case to stop it. In addition, Both ascending() and fixedPoint() are void method. Anybody has idea? lol Took me 3 days... When I run my code then 6,5,4,3,2,1 5,6,4,3,2,1 4,5,6,3,2,1 3,4,5,6,2,1 2,3,4,5,6,1 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 infinite............. public class Flipper { public static void main(String[] args) { Flipper aFlipper = new Flipper(); List<Integer> content = Arrays.asList(6,5,4,3,2,1); ArrayList<Integer> l1 = new ArrayList<Integer>(content); ArrayList<Integer> l2 = new ArrayList<Integer>(); // empty list aFlipper.fixedPoint(l2,l1); System.out.println("fix l1 is "+l1); System.out.println("fix l2 is "+l2); } public void fixedPoint(ArrayList<Integer> list1, ArrayList<Integer> list2) { // data is in list2 ArrayList<Integer> temp1 = new ArrayList<Integer>(); // empty list if (temp1.equals(list2)) { System.out.println("found!!!"); } else { ascending(list2, list1); // data, null temp1 = list1; // store processed value System.out.println("st list1 is "+list1); System.out.println("st list2 is "+list2); } fixedPoint(list2, list1); // null, processed data }

    Read the article

  • How to discover classes with [Authorize] attributes using Reflection in C#? (or How to build Dynamic

    - by Pretzel
    Maybe I should back-up and widen the scope before diving into the title question... I'm currently writing a web app in ASP.NET MVC 1.0 (although I do have MVC 2.0 installed on my PC, so I'm not exactly restricted to 1.0) -- I've started with the standard MVC project which has your basic "Welcome to ASP.NET MVC" and shows both the [Home] tab and [About] tab in the upper-right corner. Pretty standard, right? I've added 4 new Controller classes, let's call them "Astronomer", "Biologist", "Chemist", and "Physicist". Attached to each new controller class is the [Authorize] attribute. For example, for the BiologistController.cs [Authorize(Roles = "Biologist,Admin")] public class BiologistController : Controller { public ActionResult Index() { return View(); } } These [Authorize] tags naturally limit which user can access different controllers depending on Roles, but I want to dynamically build a Menu at the top of my website in the Site.Master Page based on the Roles the user is a part of. So for example, if JoeUser was a member of Roles "Astronomer" and "Physicist", the navigation menu would say: [Home] [Astronomer] [Physicist] [About] And naturally, it would not list links to "Biologist" or "Chemist" controller Index page. Or if "JohnAdmin" was a member of Role "Admin", links to all 4 controllers would show up in the navigation bar. Ok, you prolly get the idea... Starting with the answer from this StackOverflow topic about Dynamic Menu building in ASP.NET, I'm trying to understand how I would fully implement this. (I'm a newbie and need a little more guidance, so please bare with me.) The answer proposes Extending the Controller class (call it "ExtController") and then have each new WhateverController inherit from ExtController. My conclusion is that I would need to use Reflection in this ExtController Constructor to determine which Classes and Methods have [Authorize] attributes attached to them to determine the Roles. Then using a Static Dictionary, store the Roles and Controllers/Methods in key-value pairs. I imagine it something like this: public class ExtController : Controller { protected static Dictionary<Type,List<string>> ControllerRolesDictionary; protected override void OnActionExecuted(ActionExecutedContext filterContext) { // build list of menu items based on user's permissions, and add it to ViewData IEnumerable<MenuItem> menu = BuildMenu(); ViewData["Menu"] = menu; } private IEnumerable<MenuItem> BuildMenu() { // Code to build a menu SomeRoleProvider rp = new SomeRoleProvider(); foreach (var role in rp.GetRolesForUser(HttpContext.User.Identity.Name)) { } } public ExtController() { // Use this.GetType() to determine if this Controller is already in the Dictionary if (!ControllerRolesDictionary.ContainsKey(this.GetType())) { // If not, use Reflection to add List of Roles to Dictionary // associating with Controller } } } Is this doable? If so, how do I perform Reflection in the ExtController constructor to discover the [Authorize] attribute and related Roles (if any) ALSO! Feel free to go out-of-scope on this question and suggest an alternate way of solving this "Dynamic Site.Master Menu based on Roles" problem. I'm the first to admit that this may not be the best approach.

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • How can I connect to MSMQ over a workgroup?

    - by cyclotis04
    I'm writing a simple console client-server app using MSMQ. I'm attempting to run it over the workgroup we have set up. They run just fine when run on the same computer, but I can't get them to connect over the network. I've tried adding Direct=, OS:, and a bunch of combinations of other prefaces, but I'm running out of ideas, and obviously don't know the right way to do it. My queue's don't have GUIDs, which is also slightly confusing. Whenever I attempt to connect to a remote machine, I get an invalid queue name message. What do I have to do to make this work? Server: class Program { static string _queue = @"\Private$\qim"; static MessageQueue _mq; static readonly object _mqLock = new object(); static void Main(string[] args) { _queue = Dns.GetHostName() + _queue; lock (_mqLock) { if (!MessageQueue.Exists(_queue)) _mq = MessageQueue.Create(_queue); else _mq = new MessageQueue(_queue); } Console.Write("Starting server at {0}:\n\n", _mq.Path); _mq.Formatter = new BinaryMessageFormatter(); _mq.BeginReceive(new TimeSpan(0, 1, 0), new object(), OnReceive); while (Console.ReadKey().Key != ConsoleKey.Escape) { } _mq.Close(); } static void OnReceive(IAsyncResult result) { Message msg; lock (_mqLock) { try { msg = _mq.EndReceive(result); Console.Write(msg.Body); } catch (Exception ex) { Console.Write("\n" + ex.Message + "\n"); } } _mq.BeginReceive(new TimeSpan(0, 1, 0), new object(), OnReceive); } } Client: class Program { static MessageQueue _mq; static void Main(string[] args) { string queue; while (_mq == null) { Console.Write("Enter the queue name:\n"); queue = Console.ReadLine(); //queue += @"\Private$\qim"; try { if (MessageQueue.Exists(queue)) _mq = new MessageQueue(queue); } catch (Exception ex) { Console.Write("\n" + ex.Message + "\n"); _mq = null; } } Console.Write("Connected. Begin typing.\n\n"); _mq.Formatter = new BinaryMessageFormatter(); ConsoleKeyInfo key = new ConsoleKeyInfo(); while (key.Key != ConsoleKey.Escape) { key = Console.ReadKey(); _mq.Send(key.KeyChar.ToString()); } } }

    Read the article

  • C++ snippet support in visual studio?

    - by Jeremy Bell
    I'm writing code in native C++ (not C++/CLR). I know that there is no built-in support for C++ with regards to the snippet manager and snipper picker interfaces, however I found a utility called "snippy" which supposedly can generate C++ snippets. Here is a c++ snippet that the program generated: <?xml version="1.0" encoding="utf-8"?> <CodeSnippets xmlns="http://schemas.microsoft.com/VisualStudio/2005/CodeSnippet"> <CodeSnippet Format="1.0.0"> <Header> <Title>MySnippet</Title> <Shortcut>MySnippet</Shortcut> <Description>Just a test snippet</Description> <Author>Me</Author> <SnippetTypes> <SnippetType>Expansion</SnippetType> </SnippetTypes> </Header> <Snippet> <Declarations> <Literal Editable="true"> <ID>literal1</ID> <ToolTip>just a placeholder</ToolTip> <Default> </Default> <Function> </Function> </Literal> </Declarations> <Code Language="cpp"><![CDATA[cout << "$literal1$" << std::endl;]]></Code> </Snippet> </CodeSnippet> </CodeSnippets> If there is support in visual C++, even in a limited capacity, for C++ snippets, how do I add them to my environment, and what are the limitations? All I need is support for basic expansion snippets that I can invoke by typing a shortcut and hitting tab, and which supports basic literals that I can tab through (basically, if it supports the above snippet, I'm good). If this can't be done, are there any free add-ons or extensions to visual studio that support snippets for C++? I'm using both visual studio 2010 and 2008, but I mostly write code in 2010 right now.

    Read the article

  • PHP running as a FastCGI application (php-cgi) - how to issue concurrent requests?

    - by Sbm007
    Some background information: I'm writing my own webserver in Java and a couple of days ago I asked on SO how exactly Apache interfaces with PHP, so I can implement PHP support. I learnt that FastCGI is the best approach (since mod_php is not an option). So I have looked at the FastCGI protocol specification and have managed to write a working FastCGI wrapper for my server. I have tested phpinfo() and it works, in fact all PHP functions seem to work just fine (posting data, sessions, date/time, etc etc). My webserver is able to serve requests concurrently (ie user1 can retrieve file1.html at the same time as user2 requesting some_large_binary_file.zip), it does this by spawning a new Java thread for each user request (terminating when completed or user connection with client is cancelled). However, it cannot deal with 2 (or more) FastCGI requests at the same time. What it does is, it queues them up, so when request 1 is completed immediately thereafter it starts processing request 2. I tested this with 2 PHP pages, one contains sleep(10) and the other phpinfo(). How would I go about dealing with multiple requests as I know it can be done (PHP under IIS runs as FastCGI and it can deal with multiple requests just fine). Some more info: I am coding under windows and my batch file used to execute php-cgi.exe contains: set PHP_FCGI_CHILDREN=8 set PHP_FCGI_MAX_REQUESTS=500 php-cgi.exe -b 9000 But it does not spawn 8 children, the service simply terminates after 500 requests. I have done research and from Wikipedia: Processing of multiple requests simultaneously is achieved either by using a single connection with internal multiplexing (ie. multiple requests over a single connection) and/or by using multiple connections Now clearly the multiple connections isn't working for me, as everytime a client requests something that involves FastCGI it creates a new socket to the FastCGI application, but it does not work concurrently (it queues them up instead). I know that internal multiplexing of FastCGI requests under the same connection is accomplished by issuing each unique FastCGI request with a different request ID. (also see the last 3 paragraphs of 'The Communication Protocol' heading in this article). I have not tested this, but how would I go about implementing that? I take it I need some kind of FastCGI Java thread which contains a Map of some sort and a static function which I can use to add requests to. Then in the Thread's run() function it would have a while loop and for every cycle it would check whether the Map contains new requests, if so it would assign them a request ID and write them to the FastCGI stream. And then wait for input etc etc, As you can see this becomes too complicated. Does anyone know the correct way of doing this? Or any thoughts at all? Thanks very much. Note, if required I can supply the code for my FastCGI wrapper.

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • Java DriverManager Always Assigns My Driver

    - by JGB146
    I am writing a driver to act as a wrapper around two separate MySQL connections (to distributed databases). Basically, the goal is to enable interaction with my driver for all applications instead of requiring the application to sort out which database holds the desired data. Most of the code for this is in place, but I'm having a problem in that when I attempt to create connections via the MySQL Driver, the DriverManager is returning an instance of my driver instead of the MySQL Driver. I'd appreciate any tips on what could be causing this and what could be done to fix it! Below is a few relevant snippets of code. I can provide more, but there's a lot, so I'd need to know what else you want to see. First, from MyDriver.java: public MyDriver() throws SQLException { DriverManager.registerDriver(this); } public Connection connect(String url, Properties info) throws SQLException { try { return new MyConnection(info); } catch (Exception e) { return null; } } public boolean acceptsURL(String url) throws SQLException { if (url.contains("jdbc:jgb://")) { return true; } return false; } It is my understanding that this acceptsURL function will dictate whether or not the DriverManager deems my driver a suitable fit for a given URL. Hence it should only be passing connections from my driver if the URL contains "jdbc:jgb://" right? Here's code from MyConnection.java: Connection c1 = null; Connection c2 = null; /** *Constructors */ public DDBSConnection (Properties info) throws SQLException, Exception { info.list(System.out); //included for testing Class.forName("com.mysql.jdbc.Driver").newInstance(); String url1 = "jdbc:mysql://server1.com/jgb"; String url2 = "jdbc:mysql://server2.com/jgb"; this.c1 = DriverManager.getConnection( url1, info.getProperty("username"), info.getProperty("password")); this.c2 = DriverManager.getConnection( url2, info.getProperty("username"), info.getProperty("password")); } And this tells me two things. First, the info.list() call confirms that the correct user and password are being sent. Second, because we enter an infinite loop, we see that the DriverManager is providing new instances of my connection as matches for the mysql URLs instead of the desired mysql driver/connection. FWIW, I have separately tested implementations that go straight to the mysql driver using this exact syntax (al beit only one at a time), and was able to successfully interact with each database individually from a test application outside of my driver.

    Read the article

  • Strategies for "Always-Connected" Windows Client Data Architecture

    - by magz2010
    Hi. Let me start by saying: this is my 1st post here, this is a bit lenghty, and I havent done Windows Forms development in years....with that in mind please excuse me if this isn't directly a programming question and please bear with me as I really need the help!! I have been asked to develop a Windows Forms app for our company that talks to a central (local area network) Linux Server hosting a PostgreSQL database. The app is to allow users to authenticate themselves into the system and thereafter conduct the usual transactions with the PG database. Ordinarily, I would propose writing a webforms app against Mono, but the clients need to utilise local resources such as USB peripheral devices, so that is out of the question. While it might not seem clear, my questions are italised below: Dilemma #1: The application is meant to be always connected. How should I structure my DAL/BLL - Should this reside on the server or with the client? Dilemma #2: I have been reading up on Client Application Services (CAS), and it seems like a great fit for authentication, as everything is exposed via URIs. I know that a .NET Data Provider exists for PostgreSQL, but not too sure if CAS will all work on a Linux (Debian) server? Believe me, I would get my hands dirty and try myself, but I need to come up with a logical design first before resources are allocated to me for "trial purposes"! Dilemma #3: If the DAL/BLL is to reside on the server, is there any way I can create data services, and expose only these services to authenticated clients. There is a (security) requirement whereby a connection string with username and password to the database cannot be present on any client machines...even if security on the database side is quite rigid. I'm guessing that the only way for this to work would be to create the various CRUD data service methods that are exposed by an ASP.NET app, and have the WindowsForms make a request for data or persist data to the ASP.NET app (thru a URI) and have that return a resultset or value. Would I be correct in assuming this? Should I be looking into WCF Data Services? and will WCF work with a non-SQL Server database? Thank you for taking the time out to read this, but know that I am desperately seeking any advice on this! THANKS A MILLION!!!!

    Read the article

  • Chrome extension - Localstorage not working

    - by Bjarki Jonasson
    I'm writing a Chrome extension that uses a content script to modify certain parts of a website. The content script worked fine until I tried to add an options page to my extension. Right now I'm using an options.html file to save user preferences to localstorage, as you can see here: <html> <head><title>Options</title></head> <script type="text/javascript"> function save_options() { var select = document.getElementById("width"); var width = select.children[select.selectedIndex].value; localStorage["site_width"] = width; } function restore_options() { var fwidth = localStorage["site_width"]; if (!fwidth) { return; } var select = document.getElementById("width"); for (var i = 0; i < select.children.length; i++) { var child = select.children[i]; if (child.value == fwidth) { child.selected = "true"; break; } } } </script> <body onload="restore_options()"> Width: <select id="width"> <option value="100%">100%</option> <option value="90%">90%</option> <option value="80%">80%</option> <option value="70%">70%</option> </select> <br> <button onclick="save_options()">Save</button> </body> </html> I also have a background.html file to handle the communication between the content script and the localstorage: <html> <script type="text/javascript"> chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "siteWidth") sendResponse({status: localStorage["site_width"]}); else sendResponse({}); }); </script> </html> Then there's the actual content script that looks like this: var Width; chrome.extension.sendRequest({method: "siteWidth"}, function(response) { width = response.status; }); None of that code actually works. It looks solid enough to me but I'm not a very experienced programmer so I might be wrong. Could someone explain localstorage to me in layman's terms?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • MySQL LEFT OUTER JOIN virtual table

    - by user1707323
    I am working on a pretty complicated query let me try to explain it to you. Here is the tables that I have in my MySQL database: students Table --- `students` --- student_id first_name last_name current_status status_change_date ------------ ------------ ----------- ---------------- -------------------- 1 John Doe Active NULL 2 Jane Doe Retread 2012-02-01 students_have_courses Table --- `students_have_courses` --- students_student_id courses_course_id s_date e_date int_date --------------------- ------------------- ---------- ---------- ----------- 1 1 2012-01-01 2012-01-04 2012-01-05 1 2 2012-01-05 NULL NULL 2 1 2012-01-10 2012-01-11 NULL students_have_optional_courses Table --- `students_have_optional_courses` --- students_student_id optional_courses_opcourse_id s_date e_date --------------------- ------------------------------ ---------- ---------- 1 1 2012-01-02 2012-01-03 1 1 2012-01-06 NULL 1 5 2012-01-07 NULL Here is my query so far SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_have_optional_courses`.optional_courses_opcourse_id, `students_have_optional_courses`.s_date, `students_have_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN `students_have_optional_courses` ON ( `students_have_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_have_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_have_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id; What I want to be returned is the student_id, first_name, and last_name for all Active or Retread students and then LEFT JOIN the highest course_id, s_date, e_date, and int_date for the those students where the s_date is since the status_change_date if status is 'Retread'. Then LEFT JOIN the highest optional_courses_opcourse_id, s_date, and e_date from the students_have_optional_courses TABLE where the students_have_optional_courses.s_date is greater or equal to the students_have_courses.s_date and the students_have_optional_courses.e_date IS NULL Here is what is being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 1 2012-01-06 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Here is what I want being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 5 2012-01-07 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Everything is working except one thing, I cannot seem to get the highest students_have_optional_courses.optional_courses_opcourse_id no matter how I form the query Sorry, I just solved this myself after writing this all out I think it helped me think of the solution. Here is the solution query: SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_optional_courses`.optional_courses_opcourse_id, `students_optional_courses`.s_date, `students_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN ( SELECT * FROM `students_have_optional_courses` ORDER BY `students_have_optional_courses`.optional_courses_opcourse_id DESC ) `students_optional_courses` ON ( `students_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id;

    Read the article

  • What are some things you'd like fresh college grads to know?

    - by bradhe
    So I proposed this to the Reddit community and I'd like to get SO's perspective on this. This is pretty much the copypasta of what I put there. I was thinking about this last night and thought it would be neat to compile a list. I'm still a pretty fresh college grad -- been in industry for 2 years -- but I think that I might have a few interesting things to lend. You don't know as much as you think you do. Somehow, college students think they know a lot more than they do (or maybe that was just me). Likewise, they think they can do more than they actually can. You should fairly assess your skills. QA people are not out to get you. Humans introduce bugs to code. It's not (nescessarily) a personal reflection on you and your skills if your code has a bug and it's caught by the QA/testing team. Listen to your senior (developers). They are not actually fuddy duddies who don't know about the new L337 hax in Ruby (okay, sometimes they are, but still...). They have a wealth of knowledge that you can learn from and it's in your best interest to do so. You will most likely not be doing what you want to for a while. This is mostly true in the corporate world -- startups are a different matter. Also, this is due to more than just the economy, man! Junior devs need to earn their keep, so to speak. Everyone wants to be lead dev on the next project and there are a lot of people in line ahead of you! For every elite developer there are 100 average developers. Joel Spolsky, I'm looking at you. Somehow this concept of ninja coders has really ingrained itself in our culture. While I encourage you to be the best you can be don't be disappointed if people aren't writing blog posts about you in the near future. Anyone else have anything they would see added to this list?

    Read the article

  • Need some help synch'ing outer loop counter with dialog.onconfirm()

    - by Chris Barnhill
    I am writing a game for Facebook. IN the following code, I have a problem. I have a for loop executing, and in that loop, I call a dialog and implement 'onconfirm' for the dialog. The problem is that I need to access th e loop counter inside of the onconfirm function. But because the onconfirm is called outside of the scope of the for loop, the counter value is no longer valid because it's been incremented. I need some way to pass the counter value to the dialog onconfirm as it was at the time the dialog was displayed, not after the loop has finished. Or maybe someone has a better solution. Any help would be appreciated. Thanks. function unloadCargo() { //debugger; var actionPrompt = document.getElementById('action-prompt'); actionPrompt.setTextValue('Unloading cargo...'); var ajax = new Ajax(); ajax.responseType = Ajax.JSON; ajax.ondone = function(data) { debugger; if(data.unloadableCargo.length == 0) { loadCargo(); } else { //console.log('unloadable cargo='+dump(data.unloadableCargo)); var i = 0; var j = 0; var ucCount = data.unloadableCargo.length; for(i = 0; i < ucCount; i++) { cargoDialog = new Dialog(); cargoDialog.showChoice('Unload Cargo', 'Unload ' + data.unloadableCargo[i].goods_name + ' at ' + data.unloadableCargo[i].city_name + ' for ' + data.unloadableCargo[i].payoff + 'M euros?'); cargoDialog.onconfirm = function() { //console.log('unloadable cargo onconfirm='+dump(data.unloadableCargo)); var ajax = new Ajax(); var param = {"city_id": data.unloadableCargo[i].city_id, "goods_id": data.unloadableCargo[i].goods_id, "payoff": data.unloadableCargo[i].payoff}; ajax.ondone = function(demandData) { var demands = document.getElementById('demands'); var innerXhtml = '<span>'; for(var j = 0; j < demandData.demands.length; j++) { innerXhtml = innerXhtml + ' <div class="demand-item"><div class="demand-city">' + demandData.demands[j].city + '</div><div class="demand-pay">' + demandData.demands[j].cost + '</div><div class="demand-goods">' + demandData.demands[j].goods + '</div></div>'; } innerXtml = innerXhtml + ' </span>'; demands.setInnerXHTML(innerXhtml); // update balance loadCargo(); } ajax.post(baseURL + "/turn/do-unload-cargo", param); } cargoDialog.oncancel = function() { loadCargo(); } } //loadCargo(); } } ajax.post(baseURL + '/turn/unload-cargo'); }

    Read the article

  • Is it correct or incorrect for a Java JAR to contain its own dependencies?

    - by 4herpsand7derpsago
    I guess this is a two-part question. I am trying to write my own Ant task (MyFirstTask) that can be used in other project's build.xml buildfiles. To do this, I need to compile and package my Ant task inside its own JAR. Because this Ant task that I have written is fairly complicated, it has about 20 dependencies (other JAR files), such as using XStream for OX-mapping, Guice for DI, etc. I am currently writing the package task in the build.xml file inside the MyFirstTask project (the buildfile that will package myfirsttask.jar, which is the reusable Ant task). I am suddenly realizing that I don't fully understand the intention of a Java JAR. Is it that a JAR should not contain dependencies, and leave it to the runtime configuration (the app container, the runtime environment, etc.) to supply it with the dependencies it needs? I would assume if this is the case, an executable JAR is an exception to the rule, yes? Or, is it the intention for Java JARs to also include their dependencies? Either way, I don't want to be forcing my users to be copying-n-pasting 25+ JARs into their Ant libs; that's just cruel. I like the way WAR files are set up, where the classpath for dependencies is defined under the classes/ directory. I guess, ultimately, I'd like my JAR structure to look like: myfirsttask.jar/ com/ --> the root package of my compiled binaries config/ --> config files, XML, XSD, etc. classes/ --> all dependencies, guice-3.0.jar, xstream-1.4.3.jar, etc. META-INF/ MANIFEST.MF I assume that in order to accomplish this (and get the runtime classpath to also look into the classes/ directory), I'll need to modify the MANIFEST.MF somehow (I know there's a manifest attribute called ClassPath, I believe?). I'm just having a tough time putting everything together, and have a looming/lingering question about the very intent of JARs to begin with. Can someone please confirm whether Oracle intends for JARs to contain their dependencies or not? And, either way, what I would have to do in the manifest (or anywhere else) to make sure that, at runtime, the classpath can find the dependencies stored under the classes/ directory? Thanks in advance!

    Read the article

  • async_write/async_read problems while trying to implement question-answer logic

    - by Max
    Good day. I'm trying to implement a question - answer logic using boost::asio. On the Client I have: void Send_Message() { .... boost::asio::async_write(server_socket, boost::asio::buffer(&Message, sizeof(Message)), boost::bind(&Client::Handle_Write_Message, this, boost::asio::placeholders::error)); .... } void Handle_Write_Message(const boost::system::error_code& error) { .... std::cout << "Message was sent.\n"; .... boost::asio::async_read(server_socket_,boost::asio::buffer(&Message, sizeof(Message)), boost::bind(&Client::Handle_Read_Message, this, boost::asio::placeholders::error)); .... } void Handle_Read_Message(const boost::system::error_code& error) { .... std::cout << "I have a new message.\n"; .... } And on the Server i have the "same - logic" code: void Read_Message() { .... boost::asio::async_read(client_socket, boost::asio::buffer(&Message, sizeof(Message)), boost::bind(&Server::Handle_Read_Message, this, boost::asio::placeholders::error)); .... } void Handle_Read_Message(const boost::system::error_code& error) { .... std::cout << "I have a new message.\n"; .... boost::asio::async_write(client_socket_,boost::asio::buffer(&Message, sizeof(Message)), boost::bind(&Server::Handle_Write_Message, this, boost::asio::placeholders::error)); .... } void Handle_Write_Message(const boost::system::error_code& error) { .... std::cout << "Message was sent back.\n"; .... } Message it's just a structure. And the output on the Client is: Message was sent. Output on the Server is: I have a new message. And that's all. After this both programs are still working but nothing happens. I tried to implement code like: if (!error) { .... } else { // close sockets and etc. } But there are no errors in reading or writing. Both programs are just running normally, but doesn't interact with each other. This code is quite obvious but i can't understand why it's not working. Thanks in advance for any advice.

    Read the article

  • how to use window.onload?

    - by Patrick
    I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

    Read the article

  • How do I query delegation properties of an active directory user account?

    - by Mark J Miller
    I am writing a utility to audit the configuration of a WCF service. In order to properly pass credentials from the client, thru the WCF service back to the SQL back end the domain account used to run the service must be configured in Active Directory with the setting "Trust this user for delegation" (Properties - "Delegation" tab). Using C#, how do I access the settings on this tab in Active Directory. I've spent the last 5 hours trying to track this down on the web and can't seem to find it. Here's what I've done so far: using (Domain domain = Domain.GetCurrentDomain()) { Console.WriteLine(domain.Name); // get domain "dev" from MSSQLSERVER service account DirectoryEntry ouDn = new DirectoryEntry("LDAP://CN=Users,dc=dev,dc=mydomain,dc=lcl"); DirectorySearcher search = new DirectorySearcher(ouDn); // get sAMAccountName "dev.services" from MSSQLSERVER service account search.Filter = "(sAMAccountName=dev.services)"; search.PropertiesToLoad.Add("displayName"); search.PropertiesToLoad.Add("userAccountControl"); SearchResult result = search.FindOne(); if (result != null) { Console.WriteLine(result.Properties["displayName"][0]); DirectoryEntry entry = result.GetDirectoryEntry(); int userAccountControlFlags = (int)entry.Properties["userAccountControl"].Value; if ((userAccountControlFlags & (int)UserAccountControl.TRUSTED_FOR_DELEGATION) == (int)UserAccountControl.TRUSTED_FOR_DELEGATION) Console.WriteLine("TRUSTED_FOR_DELEGATION"); else if ((userAccountControlFlags & (int)UserAccountControl.TRUSTED_TO_AUTH_FOR_DELEGATION) == (int)UserAccountControl.TRUSTED_TO_AUTH_FOR_DELEGATION) Console.WriteLine("TRUSTED_TO_AUTH_FOR_DELEGATION"); else if ((userAccountControlFlags & (int)UserAccountControl.NOT_DELEGATED) == (int)UserAccountControl.NOT_DELEGATED) Console.WriteLine("NOT_DELEGATED"); foreach (PropertyValueCollection pvc in entry.Properties) { Console.WriteLine(pvc.PropertyName); for (int i = 0; i < pvc.Count; i++) { Console.WriteLine("\t{0}", pvc[i]); } } } } The "userAccountControl" does not seem to be the correct property. I think it is tied to the "Account Options" section on the "Account" tab, which is not what we're looking for but this is the closest I've gotten so far. The justification for all this is: We do not have permission to setup the service in QA or in Production, so along with our written instructions (which are notoriously only followed in partial) I am creating a tool that will audit the setup (WCF and SQL) to determine if the setup is correct. This will allow the person deploying the service to run this utility and verify everything is setup correctly - saving us hours of headaches and reducing downtime during deployment.

    Read the article

  • C++ string sort like a human being?

    - by Walter Nissen
    I would like to sort alphanumeric strings the way a human being would sort them. I.e., "A2" comes before "A10", and "a" certainly comes before "Z"! Is there any way to do with without writing a mini-parser? Ideally it would also put "A1B1" before "A1B10". I see the question "Natural (human alpha-numeric) sort in Microsoft SQL 2005" with a possible answer, but it uses various library functions, as does "Sorting Strings for Humans with IComparer". Below is a test case that currently fails: #include <set> #include <iterator> #include <iostream> #include <vector> #include <cassert> template <typename T> struct LexicographicSort { inline bool operator() (const T& lhs, const T& rhs) const{ std::ostringstream s1,s2; s1 << toLower(lhs); s2 << toLower(rhs); bool less = s1.str() < s2.str(); std::cout<<s1.str()<<" "<<s2.str()<<" "<<less<<"\n"; return less; } inline std::string toLower(const std::string& str) const { std::string newString(""); for (std::string::const_iterator charIt = str.begin(); charIt!=str.end();++charIt) { newString.push_back(std::tolower(*charIt)); } return newString; } }; int main(void) { const std::string reference[5] = {"ab","B","c1","c2","c10"}; std::vector<std::string> referenceStrings(&(reference[0]), &(reference[5])); //Insert in reverse order so we know they get sorted std::set<std::string,LexicographicSort<std::string> > strings(referenceStrings.rbegin(), referenceStrings.rend()); std::cout<<"Items:\n"; std::copy(strings.begin(), strings.end(), std::ostream_iterator<std::string>(std::cout, "\n")); std::vector<std::string> sortedStrings(strings.begin(), strings.end()); assert(sortedStrings == referenceStrings); }

    Read the article

  • All possible combinations of length 8 in a 2d array

    - by CodeJunki
    Hi, I've been trying to solve a problem in combinations. I have a matrix 6X6 i'm trying to find all combinations of length 8 in the matrix. I have to move from neighbor to neighbor form each row,column position and i wrote a recursive program which generates the combination but the problem is it generates a lot of duplicates as well and hence is inefficient. I would like to know how could i eliminate calculating duplicates and save time. int a={{1,2,3,4,5,6}, {8,9,1,2,3,4}, {5,6,7,8,9,1}, {2,3,4,5,6,7}, {8,9,1,2,3,4}, {5,6,7,8,9,1}, } void genSeq(int row,int col,int length,int combi) { if(length==8) { printf("%d\n",combi); return; } combi = (combi * 10) + a[row][col]; if((row-1)>=0) genSeq(row-1,col,length+1,combi); if((col-1)>=0) genSeq(row,col-1,length+1,combi); if((row+1)<6) genSeq(row+1,col,length+1,combi); if((col+1)<6) genSeq(row,col+1,length+1,combi); if((row+1)<6&&(col+1)<6) genSeq(row+1,col+1,length+1,combi); if((row-1)>=0&&(col+1)<6) genSeq(row-1,col+1,length+1,combi); if((row+1)<6&&(row-1)>=0) genSeq(row+1,col-1,length+1,combi); if((row-1)>=0&&(col-1)>=0) genSeq(row-1,col-1,length+1,combi); } I was also thinking of writing a dynamic program basically recursion with memorization. Is it a better choice?? if yes than I'm not clear how to implement it in recursion. Have i really hit a dead end with approach??? Thankyou Edit Eg result 12121212,12121218,12121219,12121211,12121213. the restrictions are that you have to move to your neighbor from any point, you have to start for each position in the matrix i.e each row,col. you can move one step at a time, i.e right, left, up, down and the both diagonal positions. Check the if conditions. i.e if your in (0,0) you can move to either (1,0) or (1,1) or (0,1) i.e three neighbors. if your in (2,2) you can move to eight neighbors. so on...

    Read the article

  • infix operation to postfix using stacks

    - by Chris De La O
    We are writing a program that needs to convert an infix operation (4 5/3) to postfix (4 5 3 / ) using stacks. however my convert to postfix does not work as it doesnt not output the postFix array that is supposed to store the conversion from infix notation to postfix notation. here is the code for the convertToPostix fuction. //converts infix expression to postfix expression void ArithmeticExpression::convertToPostfix(char *const inFix, char *const postFix) { //create a stack2 object named cow Stack2<char> cow; cout<<postFix; char thing = '('; //push a left parenthesis onto the stack cow.push(thing); //append a right parenthesis to the end of inFix array strcat(inFix, ")"); int i = 0;//declare an int that will control posFix position //if the stack is not empty if (!cow.isEmpty()) { //loop to run until the last character in inFix array for (int x = 0; inFix[x]!= '\0'; x++ ) { //if the inFix element is a digit if (isdigit(inFix[x])) { postFix[i]=inFix[x];//it is assigned to the next element in postFix array i++;//move on to next element in postFix } //if the inFix element is a left parenthesis else if (inFix[x]=='(') { cow.push(inFix[x]);//push it unto the stack } //if the inFix element is an operator else if (isOperator(inFix[x])) { char oper2 = inFix[x];//char variable holds inFix operator if (isOperator(cow.stackTop()))//if the top node in the stack is an operator { while (isOperator(cow.stackTop()))//and while the top node in the stack is an operator { char oper1 = cow.stackTop();//char variable holds node operator if(precedence( oper1, oper2))//if the node operator has higher presedence than node operator { postFix[i] = cow.pop();//we pop such operator and insert it in postFix array's next element cow.push(inFix[x]);//and push inFix operator unto the stack i++;//move to the next element in posFix } } } //if the top node is not an operator //we push the current inFix operator unto the top of the stack else cow.push(inFix[x]); } //if the inFix element is a right parenthesis else if (inFix[x]==')') { //we pop everything in the stack and insert it in postFix //until we arrive at a left paranthesis while (cow.stackTop()!='(') { postFix[i] = cow.pop(); i++; } //we then pop and discard left parenthesis cow.pop(); } } postFix[i]='\0'; //print !!postFix array!! (not stack) print();//code for this is just cout<<postFix; }

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • Displaying an Image in an activity using URI

    - by evkwan
    Hi, I'm writing an application that uses Intent(MediaStore.ACTION_IMAGE_CAPTURE) to capture and image. On the process of capturing the image, I noted the output of the image's URI. Right after finishing the camera activity, I wish to display the image using this specific URI. The method I used to capture images is: private void saveFullImage() { Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); File file = new File(Environment.getExternalStorageDirectory(), "test.jpg"); outputFileUri = Uri.fromFile(file); intent.putExtra(MediaStore.EXTRA_OUTPUT, outputFileUri); startActivityForResult(intent, TAKE_PICTURE); } Which is a method taken from Reto Meier's book Professional Android 2 Application Development. The method works fine, and I assume that the URI of the picture I just took is stored in the outputFileUri variable. Then at this point of the code is where I want to display the picture: @Override protected void onActivityResult(int requestCode, int resultCode, Intent data) { if (requestCode == TAKE_PICTURE) { //I want to display the picture I just took here //using the URI } } I'm not sure how to do it. I tried creating a new layout object and a new ImageView object using the method setImageURI(outputFileUri). My main layout (xml) did not have a ImageView object. But even when I set the contentView to the new layout with the ImageView attached to it, it doesn't display anything. I tried creating a Bitmap object from the URI and set it to the ImageView, but I get an unexpected error and forced exit. I have seen examples from here here which creates a Bitmap from URI, but it's not displaying it? My question is just how to display an image in the middle of a running activity? Do I need to get the File Path (like this) in order to display it? If I make a Bitmap out of the URI, how do I display the Bitmap? I'm just probably missing something simple...so any help would be a greatly appreciated! Also additional question for thought: If I were to take multiple pictures, would you recommend me to use the SimpleCursorAdapter instead? Thanks!

    Read the article

< Previous Page | 565 566 567 568 569 570 571 572 573 574 575 576  | Next Page >