Search Results

Search found 38961 results on 1559 pages for 'boost function'.

Page 583/1559 | < Previous Page | 579 580 581 582 583 584 585 586 587 588 589 590  | Next Page >

  • Determining selected state of jQuery Buttons

    - by lloydphillips
    I've got two radio buttons in a .net page which are being transformed to jQuery buttons a la http://jqueryui.com/demos/button/#radio When the page is loaded I have button 2 as checked. When clicking the buttons I'm firing the postback event. Problem is you can click on that button that is selected by default on the initial load i.e. Button 2, the postback is fired but the event handler isn't called in the .net code behind because the radio button is already classed as selected (and in normal circumstances wouldn't allow the postback to fire). To get around this I've added the e.PreventDefault() method BUT this is causing issues when Button 1 is clicked because before the click handler is called the button is set to selected. Therefore, in every case in the following code e.PreventDefault() is called: $(document).ready(function(){ $("[id*='rbPayable']").click(function(e){ if ($("[id*='rbPayable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) $("[id*='rbReceivable']").click(function(e){ if ($("[id*='rbReceivable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) }); What is the best way for me to load the page and effectively be able to do the following: 'If rbReceivable is checked then don't do anything otherwise do a postback.'

    Read the article

  • This code is not working in IE8 Browser.. but works in Firefox

    - by rockers
    $('#PbtnSubmit').click(function(event) { $('#PricingEditExceptions input[name=PMchk]').each(function() { if ($("#PricingEditExceptions input:checkbox:checked").length > 0) { var checked = $('#PricingEditExceptions input[type=checkbox]:checked'); var PMstrIDs = checked.map(function() { return $(this).val(); }).get().join(','); $('#1_exceptiontypes').attr('value', exceptiontypes) $('#1_PMstrIDs').attr('value', PMstrIDs); } else { alert("Please select atleast one exception"); event.preventDefault(); } }); }); I am sending exceptiondis to the Controler to handle the update.. this is my Begin form.. <script type="text/javascript"> var exceptiontypes = $.cookie("exceptiontype"); </script> <% using (Html.BeginForm("MassUpdate", "Pricing", FormMethod.Post, new { @id = "exc-"})) { %> <input type="hidden" id="exceptiontypes" runat="server" /> <input type="hidden" id="PMstrIDs" value="" runat="server"/> <%= Html.ValidationSummary(true)%> I am retreving the ExceptionId;s controler side is like this.. var exceptionIds = Request.Form[1].Split(','); var exceptiontype = Request.Form[0]; how ever this is working in firefox not in IE8.. Ie8 I am getting only Frist ExcdptionId not all checkbox exceptions ids; thanks

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • Jquery Resize Line of text To Fit Div Width

    - by Douglas Cottrell
    I am using the following script to resize a one line string to fit properly in a div box. <script type="text/javascript"> $( '.test' ).css( 'font-size', 0 ).each(function ( i, box2 ) { var width = $( box2 ).width(), line = $( box2 ).wrapInner( '<span style="white-space:nowrap">' ).children()[ 0 ]; function changeFontSize( n ) { $( box2 ).css( 'font-size', function ( i, val ) { return parseInt( val, 10 ) + n; }); } while ( $( line ).width() < width ) { changeFontSize( 1 ); } changeFontSize( -1 ); $( box2 ).text( $( line ).text() ); }); </script> This script works perfect in FF, Chrome, and opera. However in IE if the user is in compatability mode it errors and locks up the browser. I do not know enough about the older browsers to know what I have added that is not compatible. Any help is greatly appreciated.

    Read the article

  • mysql_affected_rows() returns 0 for UPDATE statement even when an update actually happens

    - by Alex Moore
    I am trying to get the number of rows affected in a simple mysql update query. However, when I run this code below, PHP's mysql_affected_rows() always equals 0. No matter if foo=1 already (in which case the function should correctly return 0, since no rows were changed), or if foo currently equals some other integer (in which case the function should return 1). $updateQuery = "UPDATE myTable SET foo=1 WHERE bar=2"; mysql_query($updateQuery); if (mysql_affected_rows() > 0) { echo "affected!"; } else { echo "not affected"; // always prints not affected } The UPDATE statement itself works. The INT gets changed in my database. I have also double-checked that the database connection isn't being closed beforehand or anything funky. Keep in mind, mysql_affected_rows doesn't necessarily require you to pass a connection link identifier, though I've tried that too. Details on the function: mysql_affected_rows Any ideas? SOLUTION The part I didn't mention turned out to be the cause of my woes here. This PHP file was being called ten times consecutively in an AJAX call, though I was only looking at the value returned on the last call, ie. a big fat 0. My apologies!

    Read the article

  • Is there a more elegant solution than an if-statement with no else clause?

    - by Jay
    In the following code, if Control (the element that trigers Toggle's first OL) is not Visible it should be set Visible and all other Controls (Controls[i]) so be Hidden. .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ Reveal("hide",20,0.3,Controls[i]); }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Although the function [Toggle] works fine, it is actually setting Controls[i] to Hidden even if it is already. This is easily rectified by adding an If statement as in the code below, surely there is a more elegant solution, maybe a complex If condition? .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ if(Controls[i].style.visibility=="visible"){ Reveal("hide",20,0.3,Controls[i]); }; }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Your help is appreciated always.

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • How to use clearInterval() and then make changes to the DOM?

    - by George D.
    I have this code and the problem I have is that I want to stop the loop and then replace the text 'Done!' that comes from the sms-loader.php script with the "textnew" string. Problem is that the loop occurs one more time so the text in the div.checkstatus field is again replaced by the calling php script. The strange thing is that I see the log message and again I get a new (and final) request, although the ordering is the opposite (first stop then replace text()) in my script. I need to understand why this is happening. $(document).ready(function() { var interval = ""; $('.checkstatus').each(function(){ var msgid = $(this).data('msg') $this = $(this), hid = $this.data('history'), textnew = '<a href="sms-dstatus.php?id='+msgid+'&sid=' +hid+ '&amp;keepThis=true&amp;TB_iframe=true&amp;height=430&amp;width=770" title="Delivery Status" class="thickbox"><img src="../template/icons/supermini/chart_curve.png" alt="status" width="16" height="16" /></a>'; interval = setInterval(function() { $this.load('../pages/sms-loader.php?id='+msgid); // stop the loop if($this.text()=='Done!'){ // stop it clearInterval(interval); console.log(textnew); this.html(textnew); /// this line is the problem } }, 5000); // 5 secs }); });

    Read the article

  • Why does my JQuery Image swap not work in firefox or chrome, but fine in IE?

    - by Cognize
    Hi, Relatively new to JQuery. I've got some code that does a banner swap with a fade in fade out transition. The images swap as expected in IE8, chrome, and firefox. However, the actual fade, the smooth transition between images only works in IE. Can anyone point me in the right direction for a fix? Javascript: function swapImages() { var $active = $('#transitionImagePlaceHolder .active'); var $next = ($('#transitionImagePlaceHolder .active').next().length > 0) ? $('#transitionImagePlaceHolder .active').next() : $('#transitionImagePlaceHolder img:first'); $active.fadeOut( 'slow', function () { $next.fadeIn('slow').addClass('active'); $active.removeClass('active'); }); } $(document).ready(function () { setInterval('swapImages()', 5000); }); CSS: #transitionImagePlaceHolder { } #transitionImagePlaceHolder { position:relative; left: 26px; } #transitionImagePlaceHolder img { display:none; position:absolute; top:4; left:10; } HTML: <div id="transitionImagePlaceHolder"> <img class="active" src="Images/TransitionImages/Trans_Img_1.jpg" /> <img src="Images/TransitionImages/Trans_Img_2.jpg" /> <img src="Images/TransitionImages/Trans_Img_3.jpg" /> </div>

    Read the article

  • controlling css with javascript works with mozilla but not with webkit based browsers

    - by GlassGhost
    Im having problems with applying css text variable in this javascript with webkit based browsers(Chrome & Safari) but it works in firefox 3.6 the function: function addGlobalStyle(sCss) { var head = document.getElementsByTagName('head')[0]; if( !head || head == null ) { return false; } var oStyle = document.createElement('style'); oStyle.type = 'text/css'; oStyle.rel = 'stylesheet'; oStyle.media = 'screen'; if ( is_gecko ) { // firefox WORKING !!! oStyle.href = 'FireFox.css'; oStyle.innerHTML = sCss; head.appendChild(oStyle); return true; } else {//nothing but firefox works oStyle.href = 'FireFox.css'; oStyle.innerHTML = sCss; head.appendChild(oStyle); return true; } } the use of the function: var NewSyleText = //The page styling "h1, h2, h3, h4, h5 {font-family: 'Verdana','Helvetica',sans-serif; font-style: normal; font-weight:normal;}" + "body, b {background: #fbfbfb; font-style: normal; font-family: 'Cochin','GaramondNo8','Garamond','Big Caslon','Georgia','Times',serif;font-size: 11pt;}" + "p { margin: 0pt; text-indent:2.5em; margin-top: 0.3em; }" + "a { text-decoration: none; color: Navy; background: none;}" + "a:visited { color: #500050;}" + "a:active { color: #faa700;}" + "a:hover { text-decoration: underline;}"; addGlobalStyle(NewSyleText);//inserts the page styling

    Read the article

  • how to solve a weired swig python c++ interfacing type error

    - by user2981648
    I want to use swig to switch a simple cpp function to python and use "scipy.integrate.quadrature" function to calculate the integration. But python 2.7 reports a type error. Do you guys know what is going on here? Thanks a lot. Furthermore, "scipy.integrate.quad" runs smoothly. So is there something special for "scipy.integrate.quadrature" function? The code is in the following: File "testfunctions.h": #ifndef TESTFUNCTIONS_H #define TESTFUNCTIONS_H double test_square(double x); #endif File "testfunctions.cpp": #include "testfunctions.h" double test_square(double x) { return x * x; } File "swig_test.i" : /* File : swig_test.i */ %module swig_test %{ #include "testfunctions.h" %} /* Let's just grab the original header file here */ %include "testfunctions.h" File "test.py": import scipy.integrate import _swig_test print scipy.integrate.quadrature(_swig_test.test_square, 0., 1.) error info: UMD has deleted: _swig_test Traceback (most recent call last): File "<stdin>", line 1, in <module> File "C:\Python27\lib\site-packages\spyderlib\widgets\externalshell\sitecustomize.py", line 523, in runfile execfile(filename, namespace) File "D:\data\haitaliu\Desktop\Projects\swig_test\Release\test.py", line 4, in <module> print scipy.integrate.quadrature(_swig_test.test_square, 0., 1.) File "C:\Python27\lib\site-packages\scipy\integrate\quadrature.py", line 161, in quadrature newval = fixed_quad(vfunc, a, b, (), n)[0] File "C:\Python27\lib\site-packages\scipy\integrate\quadrature.py", line 61, in fixed_quad return (b-a)/2.0*sum(w*func(y,*args),0), None File "C:\Python27\lib\site-packages\scipy\integrate\quadrature.py", line 90, in vfunc return func(x, *args) TypeError: in method 'test_square', argument 1 of type 'double'

    Read the article

  • Iteration over a linq to sql query is very slow.

    - by devzero
    I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

    Read the article

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • optimize output value using a class and public member

    - by wiso
    Suppose you have a function, and you call it a lot of times, every time the function return a big object. I've optimized the problem using a functor that return void, and store the returning value in a public member: #include <vector> const int N = 100; std::vector<double> fun(const std::vector<double> & v, const int n) { std::vector<double> output = v; output[n] *= output[n]; return output; } class F { public: F() : output(N) {}; std::vector<double> output; void operator()(const std::vector<double> & v, const int n) { output = v; output[n] *= n; } }; int main() { std::vector<double> start(N,10.); std::vector<double> end(N); double a; // first solution for (unsigned long int i = 0; i != 10000000; ++i) a = fun(start, 2)[3]; // second solution F f; for (unsigned long int i = 0; i != 10000000; ++i) { f(start, 2); a = f.output[3]; } } Yes, I can use inline or optimize in an other way this problem, but here I want to stress on this problem: with the functor I declare and construct the output variable output only one time, using the function I do that every time it is called. The second solution is two time faster than the first with g++ -O1 or g++ -O2. What do you think about it, is it an ugly optimization?

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Dom Nodes manipulations, how remove tags which wrap my selection?

    - by sanceray3
    Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

    Read the article

  • how to get the values dynamically in js

    - by jeessy
    hi having problem with my id iam making my website for health product. already we have a 10 products with corresponding amounts in this section customer choose the product through drop down box. in next we are getting service charges from customer by clicking radio buttons. we have a three radio buttons with name=add and three amount value like 5$ 7$ 9$. It is working fine. for example: customer selected 3 produts in the sense that total amount around 20$ after customer clicks this radio button(any) and submit button that amount will add with totally in next page ie 25$ what i want is that radio button amount should add with get payment then display the page dynamically. function checkRadio (frmName, rbGroupName) { var radios = document[frmName].elements[rbGroupName]; for (var i=0; i < radios.length; i++) { if(radios[i].checked) { return true; } } return false; } $(document).ready(function(){ $("input[name='rmr']").click(function() { updatePayment($(this).val()); if (!!$(this).attr("checked") == true) { $("#finalamount").html( parseInt($("#totalamount").val(), 10) * parseInt($(this).val(), 10)); } }); } this code is right or wrong. thanks in adv

    Read the article

  • Division of text follow the cursor via Javascript/Jquery

    - by webzide
    Dear experts, I wanted have a dynamic division of content follow you with the cursor in the web browser space. I am not a pro at JS so I spent 2 hours to finally debugged a very stupid way to accomplish this. $(document).ready(function () { function func(evt) { var evt = (evt) ? evt : event; var div = document.createElement('div'); div.style.position = "absolute"; div.style.left = evt.clientX + "px"; div.style.top = evt.clientY + "px"; $(div).attr("id", "current") div.innerHTML = "CURSOR FOLLOW TEXT"; $(this).append($(div)); $(this).unbind() $(this).bind('mousemove', function () { $('div').remove("#current"); }); $(this).bind('mousemove', func); } $("body").bind('mousemove', func) }); As you can see this is pretty much Brute force and it slows down the browser quite a bit. I often experience a lag on the browser as a drag my mouse from one place to another. Is there a way to accomplish this easier and faster and more intuitive. I know you can use the cursor image technique but thats something I'm looking to avoid. Thanks in advance.

    Read the article

  • mysql stored funtion usage

    - by shikhar
    I just wrote a stored function to calculate the working days between two dates. This works select CountWeekDays('2010-03-07','2010-04-07') This doesn't work select CountWeekDays(o.order_date,o.created_date) from orders o; Any idea how to make this one work ?? function definition delimiter $$; CREATE FUNCTION CountWeekDays (sdate VARCHAR(50), edate VARCHAR(50)) RETURNS INT BEGIN DECLARE wdays, tdiff, counter, thisday smallint; DECLARE newdate DATE; SET newdate := sdate; SET wdays = 0; if DATEDIFF(edate, sdate) = 0 THEN RETURN 1; END IF; if DATEDIFF(edate, sdate) < 0 THEN RETURN 0; END IF; label1: LOOP SET thisday = DAYOFWEEK(newdate); IF thisday BETWEEN 2 AND 6 THEN SET wdays := wdays + 1; END IF; SET newdate = DATE_ADD(newdate, INTERVAL 1 DAY); IF DATEDIFF(edate, newdate) < 0 THEN LEAVE label1; END IF; END LOOP label1; RETURN wdays; END

    Read the article

  • Javascript inheritance: call super-constructor or use prototype chain?

    - by Jeremy S.
    Hi folks, quite recently I read about javascript call usage in MDC https://developer.mozilla.org/en/JavaScript/Reference/Global_Objects/Function/call one linke of the example shown below, I still don't understand. Why are they using inheritance here like this Prod_dept.prototype = new Product(); is this necessary? Because there is a call to the super-constructor in Prod_dept() anyway, like this Product.call is this just out of common behaviour? When is it better to use call for the super-constructor or use the prototype chain? function Product(name, value){ this.name = name; if(value >= 1000) this.value = 999; else this.value = value; } function Prod_dept(name, value, dept){ this.dept = dept; Product.call(this, name, value); } Prod_dept.prototype = new Product(); // since 5 is less than 1000, value is set cheese = new Prod_dept("feta", 5, "food"); // since 5000 is above 1000, value will be 999 car = new Prod_dept("honda", 5000, "auto"); Thanks for making things clearer

    Read the article

  • Firefox handles xxx.submit(), Safari doesn't ... what can be done?

    - by Prairiedogg
    I'm trying to make a pull down menu post a form when the user selects (releases the mouse) on one of the options from the menu. This code works fine in FF but Safari, for some reason, doesn't submit the form. I re-wrote the code using jquery to see if jquery's .submit() implementation handled the browser quirks better. Same result, works in FF doesn't work in safari. The following snippets are from the same page, which has some django template language mixed in. Here's the vanilla js attempt: function formSubmit(lang) { if (lang != '{{ LANGUAGE_CODE }}') { document.getElementById("setlang_form").submit(); } } Here's the jquery attempt: $(document).ready(function() { $('#lang_submit').hide() $('#setlang_form option').mouseup(function () { if ($(this).attr('value') != '{{ LANGUAGE_CODE }}') { $('#setlang_form').submit() } }); }); and here's the form: <form id="setlang_form" method="post" action="{% url django.views.i18n.set_language %}"> <fieldset> <select name="language"> {% for lang in interface_languages %} <option value="{{ lang.code }}" onmouseup="formSubmit('{{ lang.name }}')" {% ifequal lang.code LANGUAGE_CODE %}selected="selected"{% endifequal %}>{{ lang.name }}</option> {% endfor %} </select> </fieldset> </form> My question is, how can I get this working in Safari?

    Read the article

  • Drupal - Search box not working - custom theme template

    - by vr3690
    Hello, I am using a customised version of search-theme-from.tpl When I use the search box, I do get transferred to the search page. But the search does not actually take place. The search box on the search results page does work though. This is my search-them-form.tpl.php file (demo : <input type="text" name="search_theme_form_keys" id="edit-search-theme-form-keys" value="Search" title="Enter the terms you wish to search for" class="logininput" height="24px" onblur="restoreSearch(this)" onfocus="clearInput(this)" /> <input type="submit" name="op" id="edit-submit" value="" class="form-submit" style="display: none;" /> <input type="hidden" name="form_token" id="edit-search-theme-form-form-token" value="<?php print drupal_get_token('search_theme_form'); ?>" /> <input type="hidden" name="form_id" id="edit-search-theme-form" value="search_theme_form" /> There is also a javascript file involved. I guess it's use is pretty clear from the code: function trim(str) { return str.replace(/^\s+|\s+$/g, ''); } function clearInput(e) { e.value=""; // clear default text when clicked e.className="longininput_onfocus"; //change class } function restoreSearch(e) { if (trim(e.value) == '') { { e.value="Search"; // reset default text onBlur e.className="logininput"; //reset class } } } What can be the problem and how can I fix it?

    Read the article

  • Xml Conversion "Type mismatch" Error

    - by prema
    I am selecting a query in sql server 2005 SELECT 'Region' AS ELEMENT,(SELECT GeographyName,GeoID from @tmpTable FOR XML RAW, TYPE) FOR XML RAW('Root') This will give the output in xml as <Root ELEMENT="Region"> <row GeographyName="East" GeoID="2" /> <row GeographyName="West" GeoID="3" /> <row GeographyName="North" GeoID="4" /> <row GeographyName="South" GeoID="5" /> </Root> In aspx page, i want to get this function Populatedata(obj, val) { var xmlDom = new JXmlDom(obj, false); --> at this point i am getting error var nodeHeader = xmlDom.selectNodes("//row"); // my code goes here } function JXmlDom (xml,isFile) { this.load=load; this.loadXML=loadXML; this.selectNodes=selectNodes; this.text=text; this.selectSingleNode=selectSingleNode; this.documentElement=documentElement; this.transformNode=transformNode; if (isFile) { this.dom=this.load (xml); }else { this.dom=this.loadXML (xml); } function loadXML (xml) { if (window.ActiveXObject) { var dom=new ActiveXObject("Microsoft.XMLDOm"); dom.async=false; dom.loadXML (xml); } if (document.implementation && document.implementation.createDocument) { var domParser=new DOMParser(); var dom=domParser.parseFromString (xml,"text/xml"); } return dom; } But when i am calling this i am getting an error as Type mismatch.Can anyone help me

    Read the article

  • Pipelining String in Powershell

    - by ChvyVele
    I'm trying to make a simple PowerShell function to have a Linux-style ssh command. Such as: ssh username@url I'm using plink to do this, and this is the function I have written: function ssh { param($usernameAndServer) $myArray = $usernameAndServer.Split("@") $myArray[0] | C:\plink.exe -ssh $myArray[1] } If entered correctly by the user, $myArray[0] is the username and $myArray[1] is the URL. Thus, it connects to the URL and when you're prompted for a username, the username is streamed in using the pipeline. Everything works perfectly, except the pipeline keeps feeding the username ($myArray[0]) and it is entered as the password over and over. Example: PS C:\Users\Mike> ssh xxxxx@yyyyy login as: xxxxx@yyyyy's password: Access denied xxxxx@yyyyy's password: Access denied xxxxx@yyyyy's password: Access denied xxxxx@yyyyy's password: Access denied xxxxx@yyyy's password: Access denied xxxxx@yyyyy's password: FATAL ERROR: Server sent disconnect message type 2 (protocol error): "Too many authentication failures for xxxxx" Where the username has been substituted with xxxxx and the URL has been substituted with yyyyy. Basically, I need to find out how to stop the script from piping in the username ($myArray[0]) after it has been entered once. Any ideas? I've looked all over the internet for a solution and haven't found anything.

    Read the article

< Previous Page | 579 580 581 582 583 584 585 586 587 588 589 590  | Next Page >