Search Results

Search found 16435 results on 658 pages for 'portable applications'.

Page 583/658 | < Previous Page | 579 580 581 582 583 584 585 586 587 588 589 590  | Next Page >

  • Experience migrating legacy Cobol/PL1 to Java

    - by MadMurf
    ORIGINAL Q: I'm wondering if anyone has had experience of migrating a large Cobol/PL1 codebase to Java? How automated was the process and how maintainable was the output? How did the move from transactional to OO work out? Any lessons learned along the way or resources/white papers that may be of benefit would be appreciated. EDIT 7/7: Certainly the NACA approach is interesting, the ability to continue making your BAU changes to the COBOL code right up to the point of releasing the JAVA version has merit for any organization. The argument for procedural Java in the same layout as the COBOL to give the coders a sense of comfort while familiarizing with the Java language is a valid argument for a large organisation with a large code base. As @Didier points out the $3mil annual saving gives scope for generous padding on any BAU changes going forward to refactor the code on an ongoing basis. As he puts it if you care about your people you find a way to keep them happy while gradually challenging them. The problem as I see it with the suggestion from @duffymo to Best to try and really understand the problem at its roots and re-express it as an object-oriented system is that if you have any BAU changes ongoing then during the LONG project lifetime of coding your new OO system you end up coding & testing changes on the double. That is a major benefit of the NACA approach. I've had some experience of migrating Client-Server applications to a web implementation and this was one of the major issues we encountered, constantly shifting requirements due to BAU changes. It made PM & scheduling a real challenge. Thanks to @hhafez who's experience is nicely put as "similar but slightly different" and has had a reasonably satisfactory experience of an automatic code migration from Ada to Java. Thanks @Didier for contributing, I'm still studying your approach and if I have any Q's I'll drop you a line.

    Read the article

  • StackOverFlowException - but oviously NO recursion/endless loop

    - by user567706
    Hi there, I'm now blocked by this problem the entire day, read thousands of google results, but nothing seems to reflect my problem or even come near to it... i hope any of you has a push into the right direction for me. I wrote a client-server-application (so more like 2 applications) - the client collects data about his system, as well as a screenshot, serializes all this into a XML stream (the picture as a byte[]-array]) and sends this to the server in regular intervals. The server receives the stream (via tcp), deserializes the xml to an information-object and shows the information on a windows form. This process is running stable for about 20-25 minutes at a submission interval of 3 seconds. When observing the memory usage there's nothing significant to see, also kinda stable. But after these 20-25 mins the server throws a StackOverflowException at the point where it deserializes the tcp-stream, especially when setting the Image property from the byte[]-array. I thoroughly searched for recursive or endless loops, and regarding the fact that it occurs after thousands of sucessfull intervals, i could hardly imagine that. public byte[] ImageBase { get { MemoryStream ms = new MemoryStream(); _screen.Save(ms, System.Drawing.Imaging.ImageFormat.Jpeg); return ms.GetBuffer(); } set { if (_screen != null) _screen.Dispose(); //preventing well-known image memory leak MemoryStream ms = new MemoryStream(value); try { _screen = Image.FromStream(ms); //<< EXCEPTION THROWING HERE } catch (StackOverflowException ex) //thx to new CLR management this wont work anymore -.- { Console.WriteLine(ex.Message + Environment.NewLine + ex.StackTrace); } ms.Dispose(); ms = null; } } I hope that more code would be unnecessary, or it could get very complex... Please help, i have no clue at all anymore thx Chris

    Read the article

  • Better why of looping to detect change.

    - by Dremation
    As of now I'm using a while(true) method to detect changes in memory. The problem with this is it's kill the applications performance. I have a list of 30 pointers that need checked as rapidly as possible for changes, without sacrificing a huge performance loss. Anyone have ideas on this? memScan = new Thread(ScanMem); public static void ScanMem() { int i = addy.Length; while (true) { Thread.Sleep(30000); //I do this to cut down on cpu usage for (int j = 0; j < i; j++) { string[] values = addy[j].Split(new char[] { Convert.ToChar(",") }); //MessageBox.Show(values[2]); try { if (Memory.Scanner.getIntFromMem(hwnd, (IntPtr)Convert.ToInt32(values[0], 16), 32).ToString() != values[1].ToString()) { //Ok, it changed lets do our work //work if (Globals.Working) return; SomeFunction("Results: " + values[2].ToString(), "Memory"); Globals.Working = true; }//end if }//end try catch { } }//end for }//end while }//end void

    Read the article

  • TLS with SNI in Java clients

    - by ftrotter
    There is an ongoing discussion on the security and trust working group for NHIN Direct regarding the IP-to-domain mapping problem that is created with traditional SSL. If an HISP (as defined by NHIN Direct) wants to host thousands of NHIN Direct "Health Domains" for providers, then it will an "artificially inflated cost" to have to purchase an IP for each of those domains. Because Apache and OpenSSL have recently released TLS with support for the SNI extension, it is possible to use SNI as a solution to this problem on the server side. However, if we decide that we will allow server implementations of the NHINDirect transport layer to support TLS+SNI, then we must require that all clients support SNI too. OpenSSL based clients should do this by default and one could always us stunnel to implement an TLS+SNI aware client to proxy if your given programming language SSL implementation does not support SNI. It appears that native Java applications using OpenJDK do not yet support SNI, but I cannot get a straight answer out of that project. I know that there are OpenSSL Java libraries available but I have no idea if that would be considered viable. Can you give me a "state of the art" summary of where TLS+SNI support is for Java clients? I need a Java implementers perspective on this.

    Read the article

  • How to get a handle on all this middleware?

    - by jkohlhepp
    My organization has recently been wrestling the question of whether we should be incorporating different middleware products / concepts into our applications. Products we are looking at are things like Pegasystems, Oracle BPM / BPEL, BizTalk, Fair Isaac Blaze, etc., etc., etc. But I'm having a hard time getting a handle on all this. Before I go forward with evaluating the usefulness (positive or negative) of these different products I'm trying to get an understanding of all the different concepts in this space. I'm overwhelmed with an alphabet soup of BPM, ESB, SOA, CEP, WF, BRE, ERP, etc. Some products seem to cover one or more of those aspects, others focus on doing one. The terms all seem very ambiguous and conflated with each other. Is there a good resource out there to get a handle on all these different middleware concepts / patterns? A book? A website? An article that sums it up well? Bonus points if there is a resource that maps the various popular products into which pattern(s) they address. Thanks, ~ Justin

    Read the article

  • Is there any way to access files in your source tree in Android?

    - by Chris Thompson
    Hi all, This is a bit unorthodox but I'm trying to figure out if there's a way to access files stored in the src tree of my applications apk in Android. I'm trying to use i-Jetty (Jetty implementation for Android) and rather than use it as a separate application and manually download my war file, I'd rather just bake i-jetty in. However, in order to use (easily) standard html/jsp I need to be able to give it a document root, preferably within my application's apk file. I know Android specifically works to prevent you from accessing (freely) the stuff on the actual system so this may not be possible, but I'm thinking it might be possible to access something within the apk. One option to work around this would be to have all of the files stored in the res directory and then copy them to the sdcard on startup but this wouldn't allow me to automatically remove the files on uninstall. To give you an idea of what I've tried, currently, the html files are stored in org.webtext.android Context rootContext = new Context(server_, "/", Context.SESSIONS); rootContext.setResourceBase("org/webtext/webapp"); Returns a 404 error. final URL url = this.getClassLoader().getResource("org/webtext/webapp"); Context html = new WebAppContext(url.toExternalForm(), "/"); Blows up with a NullPointerException because no URL is returned from the getResource call. Any thoughts would be greatly appreciated! Thanks, Chris

    Read the article

  • Project with multiple binaries in Eclipse CDT

    - by Robert Schneider
    I think it is quite normal to have more than one binary in a project. However, with Eclipse CDT I don't know how to set up the IDE to get things done. I know I can create several projects - one per binary. And I know I can set the dependencies per project. However, I cannot regard them as one project in Eclipse. If I'd like to share the code with a version control system (like svn), each developer has to import the projects separately. What I miss is something like the Solution (sln file) in Visual Studio. Should I create a single project and create the make files by myself? I haven't tried it out yet, but there is this 'project set' which can be ex- and imported. Is this the solution? Can this be put into version control? My goal it to put everything under version control, not only subprojects. I cannot imagine that CDT makes only sense for single-binary applications. How can I work properly?

    Read the article

  • Link Maven OSGi to Maven NetBeans Platform Project

    - by mxro
    I am using NetBeans 6.9 Beta and I would like to accomplish the following: Set up a project representing the main application using Maven (for instance "Maven Project", "Maven NetBeans Application") Ideally, the project should only contain the necessary libraries to run in Apache Felix (I would like to be able to right-click the project and select "Run in Felix") I do not want that the project contains all the NetBean Platform APIs I would prefer to implement the modules using OSGi. For instance "Maven OSGi Bundle", "Maven NetBeans Module" + OSGi These are the problems, which I have at the moment: The standard Maven archetype ("Maven NetBeans Application") seems always to select all APIs and I have not found a way to deselect APIs - in normal NetBeans Platform Applications that can be accomplished by going to the project properties and deselected the platform modules) - I guess it has something to do with the NetBeans repository (http://bits.netbeans.org/maven2)? Do I have to create another repository? When creating normal "NetBeans Module" with OSGi support, the modules contain both NetBeans Module and OSGi meta data, which is nice. But the "Maven NetBeans Modules" have only NetBeans meta data and the Maven OSGi Bundles have only OSGi meta data). I figured out how to add modules to the project by using project / new and then placing the modules in the Maven project folder. However, I do not quite know yet how I could link to modules from other locations (NetBeans uses Maven modules, which have to be in the same directory as the project?). Below some useful links for Maven + OSGi in NetBeans wiki.netbeans.org/STS_69_Maven_OSGI NetBeans Maven OSGi Test Specification platform.netbeans.org/tutorials/nbm-maven-quickstart.html NetBeans Platform Quick Start Using Maven (6.9) wiki.netbeans.org/MavenBestPractices NetBeans Maven BestPractices maven.apache.org/pom.html#Aggregation Maven Documentation Multi-Module Projects (sorry about the missing protocol but couldn't post the message otherwise)

    Read the article

  • SUA + Visual Studio + pthreads

    - by vasek7
    Hi, I cannot compile this code under SUA: #include <unistd.h> #include <stdio.h> #include <stdlib.h> #include <pthread.h> void * thread_function(void *arg) { printf("thread_function started. Arg was %s\n", (char *)arg); // pause for 3 seconds sleep(3); // exit and return a message to another thread // that may be waiting for us to finish pthread_exit ("thread one all done"); } int main() { int res; pthread_t a_thread; void *thread_result; // create a thread that starts to run ‘thread_function’ pthread_create (&a_thread, NULL, thread_function, (void*)"thread one"); printf("Waiting for thread to finish...\n"); // now wait for new thread to finish // and get any returned message in ‘thread_result’ pthread_join(a_thread, &thread_result); printf("Thread joined, it returned %s\n", (char *)thread_result); exit(0); } I'm running on Windows 7 Ultimate x64 with Visual Studio 2008 and 2010 and I have installed: Windows Subsystem for UNIX Utilities and SDK for Subsystem for UNIX-based Applications in Microsoft Windows 7 and Windows Server 2008 R2 Include directories property of Visual Studio project is set to "C:\Windows\SUA\usr\include" What I have to configure in order to compile and run (and possibly debug) pthreads programs in Visual Studio 2010 (or 2008)?

    Read the article

  • How do I get the Silverlight Add-On for Visual Studio 2010 and some example code?

    - by xarzu
    How do I get the Silverlight Add-On for Visual Studio 2010? And where can I find lots of example code? When the interent and html was new, one could find examples of how to build a website on a few trusted web sites. The same web sites might not be the best choice for looking for examples for Silverlight, I guess. What are the best web sites where you can look at examples -- and most importantly -- look at the source code of some examples of Silverlight? Back when MFC existed as a option that programmers might use to develop windows applications, a coder could look at a huge list of sample code and step through that code to find something that somewhat did what he was looking for and use that example code to build his own app. Is there anything like that for Silverlight? I have found the http://gallery.expression.microsoft.com/ Expression Blend Gallery and I have found the http://www.silverlight.net/community/samples/silverlight-samples/ Silverlight dot net community samples. I guess that will keep me busy for a while. Are there other sites? There are video instructions on MSDN's Channel9: http://channel9.msdn.com/tags/curso-silverlight-4/ Are there any videos in English? The video instructions look very good. Where is the links to the English versions? I was suggested this site for learning silverlight: http://channel9.msdn.com/learn/courses/Silverlight4/ This online documentation mentions "The Silverlight 4 Tools for Visual Studio 2010" which "is an add-on for Visual Studio 2010 that provides tooling for Microsoft Silverlight 4 and WCF RIA Services. It can be installed on top of either Visual Studio 2010 or Visual Web Developer 2010 Express" where can I find this? Is it shipped with Visual Studio 2010?

    Read the article

  • How can I display the users profile pic using the facebook graph api?

    - by kielie
    Hi, I would like to display the users profile picture inside of my applications canvas page, is there a way to do that using the graph api? I know I can do it using FBML but I would also like to pass the profile pic to a flash game I am making, so I would have to get the profile pic from the api and send it as a variable, here is the code I have thus far, $facebook = new Facebook(array( 'appId' => FACEBOOK_APP_ID, 'secret' => FACEBOOK_SECRET_KEY, 'cookie' => true, 'domain' => 'myurl/facebook-test' )); $session = $facebook->getSession(); $uid = $facebook->getUser(); $me = $facebook->api('/me'); $updated = date("l, F j, Y", strtotime($me['updated_time'])); echo "Hello " . $me['name'] . $me['picture'] . "<br />"; echo "<div style=\"background:url(images/bg.jpg); width:760px; height:630px;\">" . "You last updated your profile on " . $updated . "</div>" . "<br /> your uid is" . $uid; Thanx in advance!

    Read the article

  • Monotouch or Titanium for rapid application development on IPhone?

    - by Ronnie
    As a .Net developer I always dreamed for the possibility to develop with my existing skills (c#) applications for the Iphone. Both programs require a Mac and the Iphone Sdk installed. Appcelerator Titanium was the first app I tried and it is based on exposing some Iphone native api to javascript so that they can be called using that language. Monotouch starts at $399 for beeing able to deploy on the Iphone and not on the Iphone simulator while Titanium is free. Monotouch (Monodevelop) has an Ide that is currently missing in Titanium (but you can use any editor like Textmate, Aptana...) I think both program generate at the end a native precompiled app (also if I am not sure about the size of the final app on the Iphone as I think the .Net framework calls are prelilnked at compilation time in Monotouch). I am also not sure about the full coverage of all the Iphone api and features. Titanium has also the advantage to enable Android app development but as a c# developer I still find Monotouch experience more like the Visual Studio one. Witch one would you choose and what are your experiences on Monotouch and Titanium?

    Read the article

  • PyGTK, Glade, Changing the window view and threads

    - by Gaunt Face
    Heya Everyone, Forgive me if this seems like a stupid question, just so far no where on the internet can I find someone offering a solution to this and I just wanted to get some feedback from someone with more experience than myself (I've only been using python, pyGTK and Glade for 2 days now). I have a UI window displaying and it updates with messages from a thread that is handling a bluetooth connection. This is fine and I have the application closing and running quite reliably, the problem is, after a bluetooth connection is made I wish to maintain the bluetooth thread (i.e. keep the connection going) but completely change the UI of the main window. Now the impression I am getting from pyGTK applications made from glade, is that the easiest thing to do is just open a new window. Is this really the best option? Can I cut the tree of widgets off at the root, maintaining the window widget but add on a new set of widgets from a separate glade file? If opening a new window is the best option, am I right in assuming that the bluetooth thread can be kept alive during this transition, providing I update any callbacks? Any help or pointers would be great. Cheers, Matt

    Read the article

  • Why Java language does not offer a way to declare getters and setters of a given "field" through ann

    - by zim2001
    I actually happily design and develop JEE Applications for quite 9 years, but I realized recently that as time goes by, I feel more and more fed up of dragging all these ugly bean classes with their bunch of getters and setters. Considering a basic bean like this : public class MyBean { // needs getter AND setter private int myField1; // needs only a getter, no setter private int myField2; // needs only a setter, no getter private int myField3; /** * Get the field1 * @return the field1 */ public int getField1() { return myField1; } /** * Set the field1 * @param value the value */ public void setField1(int value) { myField1 = value; } /** * Get the field2 * @return the field2 */ public int getField2() { return myField2; } /** * Set the field3 * @param value the value */ public void setField3(int value) { myField3 = value; } } I'm dreaming of something like this : public class MyBean { @inout(public,public) private int myField1; @out(public) private int myField2; @in(public) private int myField3; } No more stupid javadoc, just tell the important thing... It would still be possible to mix annotation and written down getters or setters, to cover cases when it should do non-trivial sets and gets. In other words, annotation would auto-generate the getter / setter code piece except when a literate one is provided. Moreover, I'm also dreaming of replacing things like that : MyBean b = new MyBean(); int v = b.getField1(); b.setField3(v+1); by such : MyBean b = new MyBean(); int v = b.field1; b.field3 = v+1; In fact, writing "b.field1" on the right side of an expression would be semantically identical to write "b.getField1()", I mean as if it has been replaced by some kind of a preprocessor. It's just an idea but I'm wondering if I'm alone on that topic, and also if it has major flaws. I'm aware that this question doesn't exactly meet the SO credo (we prefer questions that can be answered, not just discussed) so I flag it community wiki...

    Read the article

  • Automatically generating Regex from set of strings residing in DB C#

    - by Muhammad Adeel Zahid
    Hello Everyone i have about 100,000 strings in database and i want to if there is a way to automatically generate regex pattern from these strings. all of them are alphabetic strings and use set of alphabets from English letters. (X,W,V) is not used for example. is there any function or library that can help me achieve this target in C#. Example Strings are KHTK RAZ given these two strings my target is to generate a regex that allows patterns like (k, kh, kht,khtk, r, ra, raz ) case insensitive of course. i have downloaded and used some C# applications that help in generating regex but that is not useful in my scenario because i want a process in which i sequentially read strings from db and add rules to regex so this regex could be reused later in the application or saved on the disk. i m new to regex patterns and don't know if the thing i m asking is even possible or not. if it is not possible please suggest me some alternate approach. Any help and suggestions are highly appreciated. regards Adeel Zahid

    Read the article

  • Ability to draw and record a signature as part of a form - iphone

    - by mustic
    Apolgies in advance for any errors.. new to this and am not a developer/programmer.. just have some basic unix experience. I have searched the web and struggled to find a solution to my problem when I stumbled onto this website which maybe suggested that there is a solution to my question. For work i use a windows mobile device because we have to get customers to sign and form after a customer visit. the signature being very important. On the windows device i use the notes application and am able to record details and obtain/record (using draw) a customer signature. the form is then emailed back to HQ. The format being used is a *.pwi I have downloaded and paid for several applications for my iphone which is my preferred device and cant quite find anything that does both. the critical bit here is to be able to take a signature on the phone, save the doc in a format such as .txt, .doc or .pdf where i can control the file name then be able to email back to HQ. Am i asking too much? I hope that makes sense.. Any help would be much appreciated many thanks in advance

    Read the article

  • From VB6 to .net via COM and Remoting...What a mess!

    - by Robert
    I have some legacy vb6 applications that need to talk to my .Net engine application. The engine provides an interface that can be connected to via .net Remoting. Now I have a stub class library that wraps all of the types that the interface exposes. The purpose of this stub is to translate my .net types into COM-friendly types. When I run this class library as a console application, it is able to connect to the engine, call various methods, and successfully return the wrapped types. The next step in the chain is to allow my VB6 application to call this COM enabled stub. This works fine for my main engine-entry type (IModelFetcher which is wrapped as COM_ModelFetcher). However, when I try and get any of the model fetcher's model types (IClientModel, wrapped as COM_IClientModel, IUserModel, wrapped as COM_IUserModel, e.t.c.), I get the following exception: [Exception - type: System.InvalidCastException 'Return argument has an invalid type.'] in mscorlib at System.Runtime.Remoting.Proxies.RealProxy.ValidateReturnArg(Object arg, Type paramType) at System.Runtime.Remoting.Proxies.RealProxy.PropagateOutParameters(IMessage msg, Object[] outArgs, Object returnValue) at System.Runtime.Remoting.Proxies.RealProxy.HandleReturnMessage(IMessage reqMsg, IMessage retMsg) at System.Runtime.Remoting.Proxies.RealProxy.PrivateInvoke(MessageData& msgData, Int32 type) at AWT.Common.AWTEngineInterface.IModelFetcher.get_ClientModel() at AWT.Common.AWTEngineCOMInterface.COM_ModelFetcher.GetClientModel() The first thing I did when I saw this was to handle the 'AppDomain.CurrentDomain.AssemblyResolve' event, and this allowed me to load the required assemblies. However, I'm still getting this exception now. My AssemblyResolve event handler is loading three assemblies correctly, and I can confirm that it does not get called prior to this exception. Can someone help me untie myself from this mess of interprocess communication?!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Memory mapped files and "soft" page faults. Unavoidable?

    - by Robert Oschler
    I have two applications (processes) running under Windows XP that share data via a memory mapped file. Despite all my efforts to eliminate per iteration memory allocations, I still get about 10 soft page faults per data transfer. I've tried every flag there is in CreateFileMapping() and CreateFileView() and it still happens. I'm beginning to wonder if it's just the way memory mapped files work. If anyone there knows the O/S implementation details behind memory mapped files I would appreciate comments on the following theory: If two processes share a memory mapped file and one process writes to it while another reads it, then the O/S marks the pages written to as invalid. When the other process goes to read the memory areas that now belong to invalidated pages, this causes a soft page fault (by design) and the O/S knows to reload the invalidated page. Also, the number of soft page faults is therefore directly proportional to the size of the data write. My experiments seem to bear out the above theory. When I share data I write one contiguous block of data. In other words, the entire shared memory area is overwritten each time. If I make the block bigger the number of soft page faults goes up correspondingly. So, if my theory is true, there is nothing I can do to eliminate the soft page faults short of not using memory mapped files because that is how they work (using soft page faults to maintain page consistency). What is ironic is that I chose to use a memory mapped file instead of a TCP socket connection because I thought it would be more efficient. Note, if the soft page faults are harmless please note that. I've heard that at some point if the number is excessive, the system's performance can be marred. If soft page faults intrinsically are not significantly harmful then if anyone has any guidelines as to what number per second is "excessive" I'd like to hear that. Thanks.

    Read the article

  • How to build n-layered web architecture with PHP?

    - by Alex
    I have a description and design of a website and I need to redesign it to allow for new requirements. The website's purpose is the offering of government's contracts and bidding opportunities for different businesses.I'm dealing with the 3-tier architecture PHP website comprising of the user-interface tier(client's web browser),business logic layer(Apache web server with PHP engine in it and a couple of applications running within a web server as well) and a database layer(local mysql database). Now,i need to redesign it to su???rt distributed n-tier architecture and specify how I would go about it.After long hours of research i came to this solution: business logic should be separated into presentation and purely business logic tier to allow for n-layer architecture(user-interface,presentation tier,b.logic and data tier).I have decided to use ??? just for the presentation(since the original existing website is in PHP) and use it within apache web server.In the business logic i want to use J2?? implementation technology instead of implementing it in PHP(i.e using Zend app.server and smarty template) cz J2EE can provide much more essential container services which are essential for business logic,its robustness,maintainability and different critical business operations which will be carried out by the g?v?rnment's website.So,particularly,i want to use J??ss app.server with ?J? business objects in it which would provide all the b.logic in java and would interact with the database and so forth.In order to connect PHP on a web server with java on app.server i'm gonna use PHP/Java bridge API (or maybe Quercus or SOAP is better?).Finally,i have my data tier with mysql which will communicate with b.logic via JD??.Payment system application in ???.server is gonna use S??? to talk with credit card company. From your professional point of view,does it sound like a good way of redesigning the original website to allow for n-tier architecture considering the specifics of the website and the criticality of its operations?(payment system is included in it)or u would personally prefer to use PHP business objects for business logic as well instead of J2EE?If you have any wiser recommendation or some alternative,please let me know what is right or wrong in my current solution. H??? to hear your professional advice very s??n (I'm new to the area of web development) Thanks in advance

    Read the article

  • What exactly is the difference between the Dreamhost IDE and Netbeans?

    - by mikemick
    I just started using Netbeans about a week ago, and really like it thus far. Now I'm seeing something about Dreamhost IDE which I guess is a program that is built using the Netbeans platform. I use Dreamhost as the hosting company for many of my projects. What is the benefit of using Dreamhost IDE over Netbeans? Documentation on the software is non-existent from what I can tell (not even a mention in the Dreamhost wiki). All I was able to find was a short description of what it was on a Sourceforge download page, and I found a short silent video on YouTube demoing it. So I guess I'm asking, what features is it bringing to the table, and what is the difference between it and Netbeans? The description on the Sourceforge page is as follows (typos retained)... DreamHost IDE is php and ruby integrated development environment built on NetBeans IDE and provides easy deploy of your applications to the DreamHost services. Also provides you an easy eay hew to setup these services. Maybe the answer is in the description, and I just don't comprehend it?

    Read the article

  • check status application pool iis7 with csharp (access-denied)

    - by jack
    I need to monitor the status of an application in the applications pool of IIS 7 from an other machine on the same domain. My monitoring application must be in C# and running as a Windows service. On my server, I create a user with administration rights and I execute the command aspnet_regiis -ga machine\username wich worked succesfully. My problem is when I try to access the application pool i still get COMExcepttion "Access denied". What did i do wrong or wich step did i miss? I used code from http://patelshailesh.com/index.php/create-a-website-application-pool-programmatically-using-csharp as example. int status = 0; string ipAddress = "10.20.2.13"; string username = "username"; string password = "password"; try { DirectoryEntry de = new DirectoryEntry(string.Format("IIS://{0}/W3SVC/AppPools/MyAppPoolName", ipAddress), username, password); //the exception is thron here. status = (int)de.InvokeGet("AppPoolState"); switch (status) { case 2: //Runnig break; case 4: //Stopped break; default: break; } } catch (Exception ex) { }

    Read the article

  • Good resources for building web-app in Tapestry

    - by Rich
    Hi, I'm currently researching into Tapestry for my company and trying to decide if I think we can port our pre-existing proprietary web applications to something better. Currently we are running Tomcat and using JSP for our front end backed by our own framework that eventually uses JDBC to connect to an Oracle database. I've gone through the Tapestry tutorial, which was really neat and got me interested, but now I'm faced with what seems to be a common issue of documentation. There are a lot of things I'd need to be sure that I could accomplish with Tapestry before I'd be ready to commit fully to it. Does anyone have any good resources, be it a book or web article or anything else, that go into more detail beyond what the Tapestry tutorial explains? I am also considering integrating with Hibernate, and have read a little bit about Spring too. I'm still having a hard time understanding how Spring would be more useful than cumbersome in tandem with Tapestry,as they seem to have a lot of overlapping features. An example I read seemed to use Spring to interface with Hibernate, and then Tapestry to Spring, but I was under the impression Tapestry integrates to the same degree with Hibernate. The resource I'm speaking of is http://wiki.apache.org/tapestry/Tapstry5First_project_with_Tapestry5,_Spring_and_Hibernate . I was interested because I hadn't found information anywhere else on how to maintain user levels and sessions through a Tapestry application before, but wasn't exactly impressed by the need to use Spring in the example.

    Read the article

  • Django deployment - can't import app.urls

    - by hora
    I just moved a django project to a deployment server from my dev server, and I'm having some issues deploying it. My apache config is as follows: <Location "/"> Order allow,deny Allow from all SetHandler python-program PythonHandler django.core.handlers.modpython SetEnv DJANGO_SETTINGS_MODULE project.settings PythonDebug On PythonPath "['/home/django/'] + sys.path" </Location> Django does work, since it renders the Django debug views, but I get the following error: ImportError at / No module named app.urls And here is all the information Django gives me: Request Method: GET Request URL: http://myserver.com/ Django Version: 1.1.1 Python Version: 2.6.5 Installed Applications: ['django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.sites', 'django.contrib.admin', 'django.contrib.admindocs', 'project.app'] Installed Middleware: ('django.middleware.common.CommonMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware') Traceback: File "/usr/lib64/python2.6/site-packages/django/core/handlers/base.py" in get_response 83. request.path_info) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in resolve 218. sub_match = pattern.resolve(new_path) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in resolve 216. for pattern in self.url_patterns: File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in _get_url_patterns 245. patterns = getattr(self.urlconf_module, "urlpatterns", self.urlconf_module) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in _get_urlconf_module 240. self._urlconf_module = import_module(self.urlconf_name) File "/usr/lib64/python2.6/site-packages/django/utils/importlib.py" in import_module 35. __import__(name) Exception Type: ImportError at / Exception Value: No module named app.urls Any ideas as to why I get an import error?

    Read the article

  • decimal.TryParse() drops leading "1"

    - by Martin Harris
    Short and sweet version: On one machine out of around a hundred test machines decimal.TryParse() is converting "1.01" to 0.01 Okay, this is going to sound crazy but bare with me... We have a client applications that communicates with a webservice through JSON, and that service returns a decimal value as a string so we store it as a string in our model object: [DataMember(Name = "value")] public string Value { get; set; } When we display that value on screen it is formatted to a specific number of decimal places. So the process we use is string - decimal then decimal - string. The application is currently undergoing final testing and is running on more than 100 machines, where this all works fine. However on one machine if the decimal value has a leading '1' then it is replaced by a zero. I added simple logging to the code so it looks like this: Log("Original string value: {0}", value); decimal val; if (decimal.TryParse(value, out val)) { Log("Parsed decimal value: {0}", val); string output = val.ToString(format, CultureInfo.InvariantCulture.NumberFormat); Log("Formatted string value: {0}", output); return output; } On my machine - any every other client machine - the logfile output is: Original string value: 1.010000 Parsed decimal value: 1.010000 Formatted string value: 1.01 On the defective machine the output is: Original string value: 1.010000 Parsed decimal value: 0.010000 Formatted string value: 0.01 So it would appear that the decimal.TryParse method is at fault. Things we've tried: Uninstalling and reinstalling the client application Uninstalling and reinstalling .net 3.5 sp1 Comparing the defective machine's regional settings for numbers (using English (United Kingdom)) to those of a working machine - no differences. Has anyone seen anything like this or has any suggestions? I'm quickly running out of ideas... While I was typing this some more info came in: Passing a string value of "10000" to Convert.ToInt32() returns 0, so that also seems to drop the leading 1.

    Read the article

< Previous Page | 579 580 581 582 583 584 585 586 587 588 589 590  | Next Page >