Search Results

Search found 16801 results on 673 pages for 'task manager'.

Page 586/673 | < Previous Page | 582 583 584 585 586 587 588 589 590 591 592 593  | Next Page >

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Any Alternate way for writing to a file other than ofstream

    - by Aditya
    Hi All, I am performing file operations (writeToFile) which fetches the data from a xml and writes into a output file(a1.txt). I am using MS Visual C++ 2008 and in windows XP. currently i am using this method of writing to output file.. 01.ofstreamhdr OutputFile; 02./* few other stmts / 03.hdrOutputFile.open(fileName, std::ios::out); 04. 05.hdrOutputFile << "#include \"commondata.h\""<< endl ; 06.hdrOutputFile << "#include \"Commonconfig.h\"" << endl ; 07.hdrOutputFile << "#include \"commontable.h\"" << endl << endl ; 08. hdrOutputFile << "#pragma pack(push,1)" << endl ; 09.hdrOutputFile << "typedef struct \n {" << endl ; 10./ simliar hdrOutputFiles statements... */.. I have around 250 lines to write.. Is any better way to perform this task. I want to reduce this hdrOutputFile and use a buffer to do this. Please guide me how to do that action. I mean, buff = "#include \"commontable.h\"" + "typedef struct \n {" + ....... hdrOutputFile << buff. is this way possible? Thanks Ramm

    Read the article

  • I want tell the VC++ Compiler to compile all code. Can it be done?

    - by KGB
    I am using VS2005 VC++ for unmanaged C++. I have VSTS and am trying to use the code coverage tool to accomplish two things with regards to unit tests: See how much of my referenced code under test is getting executed See how many methods of my code under test (if any) are not unit tested at all Setting up the VSTS code coverage tool (see the link text) and accomplishing task #1 was straightforward. However #2 has been a surprising challenge for me. Here is my test code. class CodeCoverageTarget { public: std::string ThisMethodRuns() { return "Running"; } std::string ThisMethodDoesNotRun() { return "Not Running"; } }; #include <iostream> #include "CodeCoverageTarget.h" using namespace std; int main() { CodeCoverageTarget cct; cout<<cct.ThisMethodRuns()<<endl; } When both methods are defined within the class as above the compiler automatically eliminates the ThisMethodDoesNotRun() from the obj file. If I move it's definition outside the class then it is included in the obj file and the code coverage tool shows it has not been exercised at all. Under most circumstances I want the compiler to do this elimination for me but for the code coverage tool it defeats a significant portion of the value (e.g. finding untested methods). I have tried a number of things to tell the compiler to stop being smart for me and compile everything but I am stumped. It would be nice if the code coverage tool compensated for this (I suppose by scanning the source and matching it up with the linker output) but I didn't find anything to suggest it has a special mode to be turned on. Am I totally missing something simple here or is this not possible with the VC++ compiler + VSTS code coverage tool? Thanks in advance, KGB

    Read the article

  • MySQL query against pseudo-key-value pair data in WordPress custom query

    - by andrevr
    I'm writing a custom WordPress query to use some of the data which the Woothemes Diarise theme creates. Diarise is an event planner theme with calendar blah, blah... and uses custom fields to store the event start and end dates in WP custom fields in the *wp_postmeta* table, which implements a key-value store. So for each post in the "event" category, there are 2 records in *wp_postmeta*, named *event_start_date* and *event_end_date* that I'm interested in. The task is to compare a tourist's arrival and departure dates with the start and end dates of events, yielding a what's on list of events available. We thought we'd killed it with a grand flash of logic, that goes like this: Disregard any event that ends before the tourist arrives, and any that begin after the departure date. I wrote this query: SELECT wposts.* FROM wp_posts wposts LEFT JOIN wp_postmeta wpostmeta ON wposts.ID = wpostmeta.post_id LEFT JOIN wp_term_relationships ON (wposts.ID = wp_term_relationships.object_id) LEFT JOIN wp_term_taxonomy ON (wp_term_relationships.term_taxonomy_id = wp_term_taxonomy.term_taxonomy_id) WHERE wp_term_taxonomy.taxonomy = 'category' AND wp_term_taxonomy.term_id IN(3,4) AND ( wpostmeta.meta_key = 'event_start_date' AND NOT ( concat(subst(wpostmeta.meta_value,7,4),'-',subst(wpostmeta.meta_value,4,2),'-',subst(wpostmeta.meta_value,1,2) > '2010-07-31' ) ) AND ( wpostmeta.meta_key = 'event_end_date' AND NOT ( concat(subst(wpostmeta.meta_value,7,4),'-',subst(wpostmeta.meta_value,4,2),'-',subst(wpostmeta.meta_value,1,2) < '2010-05-01' ) ) ) ORDER BY wpostmeta.meta_value ASC And, of course it returns no records. The problem I believe is in the dual reference to wpostmeta.meta_key, but how to get around that?

    Read the article

  • How can I call `update_attribute` for a list item in rails then actually update the html using jquery?

    - by Patrick Connor
    I want my users to be able to mark one or more items from an index view as "Active" or "Inactive" using a link. The text for the link should be state aware - so it might default to "Mark as Active" if the corresponding attribute was false or null, and "Mark as Inactive" if true. Once the user clicks the link and the attribute is updated in the controller, the link-text should update based on the new state. I am WAY off here, but this is a small sample of the code I have been trying... CONTROLLER ... respond_to :html, :js ... def update @item = Item.find(params[:id]) if @item.update_attributes(params[:item]) #Not sure of how to respond to .js here end end ... update.js.erb #how do I identify which element to update? $('#item[13456]').html("State aware text for link_to") VIEW - for item in @items = item.name = link_to "Mark as Active", item_path(item), :method => :put, :remote => true. :id => "item[#{item.id}]" I am happy to read any APIs, blogs, tutorials, etc. I just can't seem to get my hands/mind around this task. Any help or guidance is greatly appreciated!

    Read the article

  • Replace without the replace function

    - by Molly Potter
    Assignment: Let X and Y be two words. Find/Replace is a common word processing operation that finds each occurrence of word X and replaces it with word Y in a given document. Your task is to write a program that performs the Find/Replace operation. Your program will prompt the user for the word to be replaced (X), then the substitute word (Y ). Assume that the input document is named input.txt. You must write the result of this Find/Replace operation to a file named output.txt. Lastly, you cannot use the replace() string function built into Python (it would make the assignment much too easy). To test your code, you should modify input.txt using a text editor such as Notepad or IDLE to contain different lines of text. Again, the output of your code must look exactly like the sample output. This is my code: input_data = open('input.txt','r') #this opens the file to read it. output_data = open('output.txt','w') #this opens a file to write to. userStr= (raw_input('Enter the word to be replaced:')) #this prompts the user for a word userReplace =(raw_input('What should I replace all occurences of ' + userStr + ' with?')) #this prompts the user for the replacement word for line in input_data: words = line.split() if userStr in words: output_data.write(line + userReplace) else: output_data.write(line) print 'All occurences of '+userStr+' in input.txt have been replaced by '+userReplace+' in output.txt' #this tells the user that we have replaced the words they gave us input_data.close() #this closes the documents we opened before output_data.close() It won't replace anything in the output file. Help!

    Read the article

  • Uncommitted reads in SSIS

    - by OldBoy
    I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

    Read the article

  • How to deploy to multiple redundant production servers with "cap deploy"?

    - by Chad Johnson
    Capistrano is working great to deploy to a single server. However, I have multiple production API servers for my web application. When I deploy, my code needs to get deployed to every API server at once. Specifying each server manually is NOT the solution I am looking for (e.g. I don't want to do "cap api1 deploy; cap api2 deploy"). Is there a way, using Capistrano, to deploy to all servers at once, with just a simple "cap deploy"? I'm wondering what changes I would need to make to a typical deploy.rb file, whether I'd need to create a separate file for each server, and whether and how the Capfile would need to be changed. Also, I need to be able to specify a different deploy_to path for each server. And ideally, I wouldn't have to repeat things in different config files for different servers (eg. wouldn't have to specify :repository, :application, etc. multiple times). I have spent hours searching Google on this and looking through tutorials, but I have found nothing helpful. Here is a snippet from my current deploy.rb file: set :application, "testapplication" set :repository, "ssh://domain.com//srv/hg/#{application}" set :scm, :mercurial set :deploy_to, "/srv/www/#{application}" role :web, "domain.com" role :app, "domain.com" role :db, "domain.com", :primary => true, :norelease => true Should I just use the multistage extension and do this? task :deploy_everything do system "cap api1 deploy" system "cap api2 deploy" system "cap api2 deploy" end That could work, but I feel like this isn't what this extension is meant for...

    Read the article

  • Deployment a web-site on IIS from another program

    - by slo2ols
    Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

    Read the article

  • Visual Studio 2012 won't start

    - by David Aleu
    I installed VS2012 Premium from our MSDN subscription and it was working fine the first couple of days but then I installed a few extensions I can't now start VS2012 and it gives the error: Faulting application name: devenv.exe, version: 11.0.50727.1, time stamp: 0x5011ecaa Faulting module name: ntdll.dll, version: 6.1.7601.17725, time stamp: 0x4ec49b8f Exception code: 0xc0000374 Fault offset: 0x000ce6c3 Faulting process id: 0xee8 Faulting application start time: 0x01cd89bb777fc1dd Faulting application path: C:\Program Files (x86)\Microsoft Visual Studio 11.0\Common7\IDE\devenv.exe Faulting module path: C:\Windows\SysWOW64\ntdll.dll I'm running it on Windows 7 64 bit. I've tried to repair, uninstall and install again and nothing. I tried to restore to a previous restore system point but nothing. The extensions I installed I can remember: VS10x Code Map VSCommands Visual SVN Nuget manager (all the above my colleagues have it too and it works fine for them) and: Web Essentials Visual Studio Color Theme Editor SlowCheetah Mobile Ready HTML5 Questions are: Anyone else has had this problem? Is there a way I can uninstall extensions from a command line or software? (I removed the extensions folder but that doesn't do anything) Can I repair the "C:\Windows\SysWOW64\ntdll.dll"? Is it really a problem with this dll? I haven't been able to find any similar issue in other versions and because VS2012 is new doesn't seem to be much information either.

    Read the article

  • How does PHP interface with Apache?

    - by Sbm007
    Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

    Read the article

  • do the Python libraries have a natural dependence on the global namespace?

    - by msw
    I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

    Read the article

  • How to understand existing projects

    - by John
    Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

    Read the article

  • An Erroneous SQL Query makes browser hang until script timeout exceeded

    - by Jimbo
    I have an admin page in a Classic ASP web application that allows the admin user to run queries against the database (SQL Server 2000) Whats really strange is that if the query you send has an error in it (an invalid table join, a column you've forgotten to group by etc) the BROWSER hangs (CPU usage goes to maximum) until the SERVER script timeout is exceeded and then spits out a timeout exceeded error (server and browser are on different machines, so not sure how this happens!) I have tried this in IE 8 and FF 3 with the same result. If you run that same query (with errors) directly from SQL Enterprise Manager, it returns the real error immediately. Is this a security feature? Does anyone know how to turn it off? It even happens when the connection to the database is using 'sa' credentials so I dont think its a security setting :( Dim oRS Set oRS = Server.CreateObject("ADODB.Recordset") oRS.ActiveConnection = sConnectionString // run the query - this is for the admin only so doesnt check for sql safe commands etc. oRS.Open Request.Form("txtSQL") If Not oRS.EOF Then // list the field names from the recordset For i = 0 to oRS.Fields.Count - 1 Response.Write oRS.Fields(i).name & "&nbsp;" Next // show the data for each record in the recordset While Not oRS.EOF For i = 0 to oRS.Fields.Count - 1 Response.Write oRS.Fields(i).value & "&nbsp;" Next Response.Write "<br />" oRS.Movenext() Wend End If

    Read the article

  • Should I learn to code?

    - by saltcod
    Hi All, This is more of a philosophical question than a technical one, but I’d like some opinions on it, and I think that there are many others in my position that would benefit. My issue is that I don’t really have time to learn how to code. I know, I know… no one has time anymore, but please hear me out. Since learning to use Drupal about 2 years ago I’ve been involved with several projects wherein I’ve become the default quasi-developer, front-end designer, site manager, and system administrator. What I’ve found is that I can produce fairly nice, feature rich Drupal sites with the wealth of contrib. modules out there (Views, CCK, image handling, etc….). BUT! I can’t code. I know enough PHP to insert something into a block, or re-word a string, but that’s about it. I still don’t really even know how arrays work. My question Succinctly, my question is: Given the time that I have available for all of this stuff – in addition to a full-time job and regular life – am I better off trying to become more expert at the front-end stuff, or should I just learn PHP already? Pros 1. If a project doesn’t use Drupal, I’ll know enough PHP to be able to participate. 2. Learning PHP would help my Drupal development too 3. Learning PHP would make front-end theming easier 4. Learning PHP should give me that missing background in programming – and should allow me to learn other languages in the future Cons 1. At 28, I know I’m not too old to learn anything. But am I too old to become ‘good’? 2. Am I better off getting better and better at front-end UX work? 3. Am I better off farming out the PHP work? Suggestions from coders welcome! Thanks Terry

    Read the article

  • How to use javascript to get information from the content of another page (same domain)?

    - by hlovdal
    Let's say I have a web page (/index.html) that contains the following <li> <div>item1</div> <a href="/details/item1.html">details</a> </li> and I would like to have some javascript on /index.html to load that /details/item1.html page and extract some information from that page. The page /details/item1.html might contain things like <div id="some_id"> <a href="/images/item1_picture.png">picture</a> <a href="/images/item1_map.png">map</a> </div> My task is to write a greasemonkey script, so changing anything serverside is not an option. To summarize, javascript is running on /index.html and I would like to have the javascript code to add some information on /index.html extracted from both /index.html and /details/item1.html. My question is how to fetch information from /details/item1.html. I currently have written code to extract the link (e.g. /details/item1.html) and pass this on to a method that should extract the wanted information (at first just .innerHTML from the some_id div is ok, I can process futher later). The following is my current attempt, but it does not work. Any suggestions? function get_information(link) { var obj = document.createElement('object'); obj.data = link; document.getElementsByTagName('body')[0].appendChild(obj) var some_id = document.getElementById('some_id'); if (! some_id) { alert("some_id == NULL"); return ""; } return some_id.innerHTML; }

    Read the article

  • unexpected behaviour of object stored in web service Session

    - by draconis
    Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

    Read the article

  • ant conditions problem

    - by senzacionale
    I have problem with ant. I woul dlike to use conditions in ant. But i get error of: BUILD FAILED C:\Projekti\Projekt ANT\build.xml:412: Problem: failed to create task or type Cause: The name is undefined. Action: Check the spelling. Action: Check that any custom tasks/types have been declared. Action: Check that any / declarations have taken place. and this is code: <target name="test"> <input message="Write some text: " addproperty="foo" /> <if> <equals arg1="${foo}" arg2="bar" /> <then> <echo message="The value of property foo is 'bar'" /> </then> <elseif> <equals arg1="${foo}" arg2="foo" /> <then> <echo message="The value of property foo is 'foo'" /> </then> </elseif> <else> <echo message="The value of property foo is not 'foo' or 'bar'" /> </else> </if> </target>

    Read the article

  • What are salesforce.com and Apex like as an application development platform?

    - by mhollers
    I have recently discovered that salesforce.com is much more than an online CRM after coming across a Morrison's Case Study in which they develop a works management application. I've been trying it out with a view to recreating our own Works Management system on the platform. My background is in Microsoft and .Net, and the obvious 1st choice would be asp.net. However, there's only really myself with .net experience and my manager with a more legacy Synergy programming background, and I am self taught and am looking at evaluating other RAD options (eg Ironspeed). the nature of the business is in the main 2-5 concurrent construction type contracts that run for 3-5 yrs each, each requiring 15-50 system users. Traditionally we have used our character based Works Mangement system for everything and tweaked it for each contract. The Salesforce licensing model on the face of it suits this sort of flexibilty, but I'm worried about the development flexibilty/learning curve and all the issues that surround lock-in. There doesn't seem to be much neutral sober analysis of the platform on the web that isn't salesforce's own material/blogs Has anyone any experience of developing an application on salesforce as compared to the more 'traditional' .Net route?

    Read the article

  • Vim: change formatting of variables in a script

    - by sixtyfootersdude
    I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

    Read the article

  • File size monitoring in C#

    - by manemawanna
    Hello, I work in the Systems & admin team and have been given the task of creating a quota management application to try and encourage users to better manage there resources as we currently have issues with disc space and don't enforce hard quotas. At the moment I'm using the code below to go through all the files in a users homespace to retrieve the overall amount of space they are using. As from what I've seen else where theres no other way to do this in C#, the issue with it is theirs quite a high overhead while it retireves the size of each file then creates a total. try { long dirSize = 0; FileInfo[] FI = new DirectoryInfo("I:\\").GetFiles("*.*", SearchOption.AllDirectories); foreach (FileInfo F1 in FI) { dirSize += F1.Length; } return dirSize; } So I'm looking for a quicker way to do this or a quick way to monitor changes in the size of files while using the options avaliable through FileSystemWatcher. At the moment the only thing I can think of is creating a hashtable containing the file location and size of each file, so when a size changed event occurs I can compare the old size against the new one and update the total. Any suggestions would be greatly appreciated.

    Read the article

  • What about parallelism across network using multiple PCs?

    - by MainMa
    Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

    Read the article

  • Import CSV to class structure as the user defines

    - by Assimilater
    I have a contact manager program and I would like to offer the feature to import csv files. The problem is that different data sources order the fields in different ways. I thought of programming an interface for the user to tell it the field order and how to handle exceptions. Here is an example line in one of many possible field orders: "ID#","Name","Rank","Address1","Address2","City","State","Country","Zip","Phone#","Email","Join Date","Sponsor ID","Sponsor Name" "Z1234","Call, Anson","STU","1234 E. 6578 S.","","Somecity","TX","United States","012345","000-000-0000","[email protected]","5/24/2010","z12343","Quantum Independence" Notice that in one data field "Name" there is a comma to separate last name and first name and in another there is not. My plan is to have a line for each field (ie ID, Name, City etc.) and a statement "import to" and list box with options like: Don't Import, BusinessJoin Date, First Name, Zip and the program recognizes those as properties of an object... I'd also like the user to be able to record preset field orders so they can re-use them for csv files from the same download source. Then I also need it to check if a record all ready exists (is there a record for Anson Call all ready?) and allow the user to tell it what to do if there is a record (ie mailing address may have changes, so if that field is filled overwrite it, or this mailing address is invalid, leave the current data untouched for this person, overwrite the rest). While I'm capable of coding this...i'm not very excited about it and I'm wondering if there's a tool or set of tools out there to all ready perform most of this functionality... I hope this makes sense...

    Read the article

  • What Test Environment Setup do Top Project Committers Use in the Ruby Community?

    - by viatropos
    Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

    Read the article

  • Ability to switch Persistence Unit dynamically within the application (JPA)

    - by MVK
    My application data access layer is built using Spring and EclipseLink and I am currently trying to implement the following feature - Ability to switch the current/active persistence unit dynamically for a user. I tried various options and finally ended up doing the following. In the persistence.xml, declare multiple PUs. Create a class with as many EntityManagerFactory attributes as there are PUs defined. This will act as a factory and return the appropriate EntityManager based on my logic public class MyEntityManagerFactory { @PersistenceUnit(unitName="PU_1") private EntityManagerFactory emf1; @PersistenceUnit(unitName="PU_2") private EntityManagerFactory emf2; public EntityManager getEntityManager(int releaseId) { // Logic goes here to return the appropriate entityManeger } } My spring-beans xml looks like this.. <!-- First persistence unit --> <bean class="org.springframework.orm.jpa.LocalContainerEntityManagerFactoryBean" id="emFactory1"> <property name="persistenceUnitName" value="PU_1" /> </bean> <bean class="org.springframework.orm.jpa.JpaTransactionManager" id="transactionManager1"> <property name="entityManagerFactory" ref="emFactory1"/> </bean> <tx:annotation-driven transaction-manager="transactionManager1"/> The above section is repeated for the second PU (with names like emFactory2, transactionManager2 etc). I am a JPA newbie and I know that this is not the best solution. I appreciate any assistance in implementing this requirement in a better/elegant way! Thanks!

    Read the article

< Previous Page | 582 583 584 585 586 587 588 589 590 591 592 593  | Next Page >