Search Results

Search found 16801 results on 673 pages for 'task manager'.

Page 586/673 | < Previous Page | 582 583 584 585 586 587 588 589 590 591 592 593  | Next Page >

• What Test Environment Setup do Top Project Committers Use in the Ruby Community?

  - by viatropos

  Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

  Read the article

• PendingIntent in Widget + TaskKiller

  - by YaW

  Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

  Read the article

• SDK Platform Tools component missing - Similar to Android Eve below

  - by Hertfordkc

  Ubuntu Linux 10.04//Eclipse 3.5.2 I'm new to Eclipse and Android. Eclipse is up and running simple Jave apps OK. I moved on to downloading the Android SDK starter package, which seemed to go OK. Ran the SDK manager and downladed Platforms 7,8 & 9. Installed the ADT package in Eclipse. I've tried to load the SDK path into the Eclipse Preferences, but it won't retain the path. After restart, Elipse says it can't find SDK package. Also,one message said that the (revision?) number of the ADT couldn't be found. I've reinstalled Eclipse a couple of times, and then gone through the SDK & ADT download procedures a couple of times and am stuck. Any suggestions will be appreciated. Hertfordkc Stupid question caused by not thoroughly reading the Android Developers Guide and the tutorials before trying to start a project. Don't know why I didn't get a message about a missing XML file.

  Read the article

• Oracle 10.1 and 11.2 produce different XML using the same statement

  - by MindFyer

  I am migrating a database from Oracle 10.1 to 11.2 and I have the following problem. The statement SELECT '<?xml version="1.0" encoding="utf-8" ?>' || (Xml).getClobVal() AS XmlClob FROM ( SELECT XmlElement( "Element1", ( SELECT XmlAgg(tpx.Xml) FROM ( SELECT XmlElement("Element3",XmlForest('content' as Element4)) AS Xml FROM dual ) tpx ) AS "Element2" ) AS Xml FROM dual ) On the original 10.1 database produces XML like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element2> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element2> </Element1> On the new 11.2 system it looks like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element1> Is there some environmental variable I am missing that tells Oracle how to format its XML. There are hundreds of thousands of lines of PL/SQL in the database; it would be a mammoth task to rewrite if it turned out they had changed they way Oracle formats XML between versions. Hopefully someone has come accross this before. Thanks

  Read the article

• An Erroneous SQL Query makes browser hang until script timeout exceeded

  - by Jimbo

  I have an admin page in a Classic ASP web application that allows the admin user to run queries against the database (SQL Server 2000) Whats really strange is that if the query you send has an error in it (an invalid table join, a column you've forgotten to group by etc) the BROWSER hangs (CPU usage goes to maximum) until the SERVER script timeout is exceeded and then spits out a timeout exceeded error (server and browser are on different machines, so not sure how this happens!) I have tried this in IE 8 and FF 3 with the same result. If you run that same query (with errors) directly from SQL Enterprise Manager, it returns the real error immediately. Is this a security feature? Does anyone know how to turn it off? It even happens when the connection to the database is using 'sa' credentials so I dont think its a security setting :( Dim oRS Set oRS = Server.CreateObject("ADODB.Recordset") oRS.ActiveConnection = sConnectionString // run the query - this is for the admin only so doesnt check for sql safe commands etc. oRS.Open Request.Form("txtSQL") If Not oRS.EOF Then // list the field names from the recordset For i = 0 to oRS.Fields.Count - 1 Response.Write oRS.Fields(i).name & "&nbsp;" Next // show the data for each record in the recordset While Not oRS.EOF For i = 0 to oRS.Fields.Count - 1 Response.Write oRS.Fields(i).value & "&nbsp;" Next Response.Write "<br />" oRS.Movenext() Wend End If

  Read the article

• SQL problem - select accross multiple tables (user groups)

  - by morpheous

  I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

  Read the article

• C#: Need one of my classes to trigger an event in another class to update a text box

  - by Matt

  Total n00b to C# and events although I have been programming for a while. I have a class containing a text box. This class creates an instance of a communication manager class that is receiving frames from the Serial Port. I have this all working fine. Every time a frame is received and its data extracted, I want a method to run in my class with the text box in order to append this frame data to the text box. So, without posting all of my code I have my form class... public partial class Form1 : Form { CommManager comm; public Form1() { InitializeComponent(); comm = new CommManager(); } private void updateTextBox() { //get new values and update textbox } . . . and I have my CommManager class class CommManager { //here we manage the comms, recieve the data and parse the frame } SO... essentially, when I parse that frame, I need the updateTextBox method from the form class to run. I'm guessing this is possible with events but I can't seem to get it to work. I tried adding an event handler in the form class after creating the instance of CommManager as below... comm = new CommManager(); comm.framePopulated += new EventHandler(updateTextBox); ...but I must be doing this wrong as the compiler doesn't like it... Any ideas?!

  Read the article

• How can I call `update_attribute` for a list item in rails then actually update the html using jquery?

  - by Patrick Connor

  I want my users to be able to mark one or more items from an index view as "Active" or "Inactive" using a link. The text for the link should be state aware - so it might default to "Mark as Active" if the corresponding attribute was false or null, and "Mark as Inactive" if true. Once the user clicks the link and the attribute is updated in the controller, the link-text should update based on the new state. I am WAY off here, but this is a small sample of the code I have been trying... CONTROLLER ... respond_to :html, :js ... def update @item = Item.find(params[:id]) if @item.update_attributes(params[:item]) #Not sure of how to respond to .js here end end ... update.js.erb #how do I identify which element to update? $('#item[13456]').html("State aware text for link_to") VIEW - for item in @items = item.name = link_to "Mark as Active", item_path(item), :method => :put, :remote => true. :id => "item[#{item.id}]" I am happy to read any APIs, blogs, tutorials, etc. I just can't seem to get my hands/mind around this task. Any help or guidance is greatly appreciated!

  Read the article

• user interface pattern for associating single or many objects to an entity

  - by Samuel

  Need suggestions on implementing associating single or many objects to an entity. All soccer team players are registered individually (e.g. they are part of 'players' table) A soccer team has many players. The click sequence is like this:- a] Soccer team owner provides a name and brief description of the soccer team. b] Now it wants to add players to this team. c] You have the following button 'Add players to team' which lets you navigate to the 'View Players' page and lets you multi select users from there. Assuming this is a paginated list of players, how do you handle the following:- Do you provide a check box against each player and let the manager do a multi selection. If you need to add more players, it doesn't make sense to show the players who have been already added to the team. Do you mark those entries as not selectable or you would adding showing these entries. If you need to filter, do you provide search filters at the top of this page. Am looking for ideas on how to implement this or sites which have already done something similar.

  Read the article

• Any Alternate way for writing to a file other than ofstream

  - by Aditya

  Hi All, I am performing file operations (writeToFile) which fetches the data from a xml and writes into a output file(a1.txt). I am using MS Visual C++ 2008 and in windows XP. currently i am using this method of writing to output file.. 01.ofstreamhdr OutputFile; 02./* few other stmts / 03.hdrOutputFile.open(fileName, std::ios::out); 04. 05.hdrOutputFile << "#include \"commondata.h\""<< endl ; 06.hdrOutputFile << "#include \"Commonconfig.h\"" << endl ; 07.hdrOutputFile << "#include \"commontable.h\"" << endl << endl ; 08. hdrOutputFile << "#pragma pack(push,1)" << endl ; 09.hdrOutputFile << "typedef struct \n {" << endl ; 10./ simliar hdrOutputFiles statements... */.. I have around 250 lines to write.. Is any better way to perform this task. I want to reduce this hdrOutputFile and use a buffer to do this. Please guide me how to do that action. I mean, buff = "#include \"commontable.h\"" + "typedef struct \n {" + ....... hdrOutputFile << buff. is this way possible? Thanks Ramm

  Read the article

• do the Python libraries have a natural dependence on the global namespace?

  - by msw

  I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

  Read the article

• Replace without the replace function

  - by Molly Potter

  Assignment: Let X and Y be two words. Find/Replace is a common word processing operation that finds each occurrence of word X and replaces it with word Y in a given document. Your task is to write a program that performs the Find/Replace operation. Your program will prompt the user for the word to be replaced (X), then the substitute word (Y ). Assume that the input document is named input.txt. You must write the result of this Find/Replace operation to a file named output.txt. Lastly, you cannot use the replace() string function built into Python (it would make the assignment much too easy). To test your code, you should modify input.txt using a text editor such as Notepad or IDLE to contain different lines of text. Again, the output of your code must look exactly like the sample output. This is my code: input_data = open('input.txt','r') #this opens the file to read it. output_data = open('output.txt','w') #this opens a file to write to. userStr= (raw_input('Enter the word to be replaced:')) #this prompts the user for a word userReplace =(raw_input('What should I replace all occurences of ' + userStr + ' with?')) #this prompts the user for the replacement word for line in input_data: words = line.split() if userStr in words: output_data.write(line + userReplace) else: output_data.write(line) print 'All occurences of '+userStr+' in input.txt have been replaced by '+userReplace+' in output.txt' #this tells the user that we have replaced the words they gave us input_data.close() #this closes the documents we opened before output_data.close() It won't replace anything in the output file. Help!

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• OSGI, Servlets and JPA hello world / tutorial / example

  - by Kamil

  I want to build a web application which basically is a restful web-service serving json messages. I would like it to be as simple as possible. I was thinking about using servlets (with annotations). JPA as a database layer is a must - Toplink or Hibernate. Preferably working on Tomcat. I want to have app divided into modules serving different functionality (auth service, customer service, etc..). And I would like to be able to update those modules without reinstalling whole application on the server - like eclipse plugins, user is notified (when he enters webapp's home url) that update is available, clicks it, and app is downloading and installing updated module. I think this functionality can be made with OSGI, but I can't find any example code, or tutorial with simple hello world updatable servlet providing some data from database through jpa. I'm looking for an advice: - Is OSGI the right tool for this or it can be done with something simpler? - Where can I find some examples covering topic (or topics) which I need for this project. - Which OSGI implementation would be best-simplest for this task. *My knowledge of OSGI is basic. I know how bundles are described, I understand concept of OSGI container and what it does. I have never created any OSGI app yet.

  Read the article

• WinUSB failing on non-development computers

  - by Giawa

  Good afternoon, WinUSB is working well on the development computer that I am using (Win XP SP3). I am able to download new firmware to the Cypress FX2, and then connect to the new USB device once it 'renumerates'. However, if I've tried the same code with the WinUSB driver on a few other computers (Win XP SP3, Win7 x64) and they both returned the error "A device attached to the system is not functioning." when trying to use CreateFile to get a handle to the USB device. The devicePath was found successfully, so I'm not sure why it cannot connect to the device. Furthermore, the device manager states that my device is working properly. I'm curious if I'm missing something when compiling the code? I would guess that my development computer has something installed on it that the other computers do not? Or perhaps it's a power setting and the device is going to sleep (although I've fooled around with the Power Options on each computer to no avail). Does anyone have any ideas? I've compiled under Visual Studio 2008, and have installed the Microsoft C++ 2008 Redistributable Package on the computers that I've tested on. Thanks, Giawa

  Read the article

• Deployment a web-site on IIS from another program

  - by slo2ols

  Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

  Read the article

• What are salesforce.com and Apex like as an application development platform?

  - by mhollers

  I have recently discovered that salesforce.com is much more than an online CRM after coming across a Morrison's Case Study in which they develop a works management application. I've been trying it out with a view to recreating our own Works Management system on the platform. My background is in Microsoft and .Net, and the obvious 1st choice would be asp.net. However, there's only really myself with .net experience and my manager with a more legacy Synergy programming background, and I am self taught and am looking at evaluating other RAD options (eg Ironspeed). the nature of the business is in the main 2-5 concurrent construction type contracts that run for 3-5 yrs each, each requiring 15-50 system users. Traditionally we have used our character based Works Mangement system for everything and tweaked it for each contract. The Salesforce licensing model on the face of it suits this sort of flexibilty, but I'm worried about the development flexibilty/learning curve and all the issues that surround lock-in. There doesn't seem to be much neutral sober analysis of the platform on the web that isn't salesforce's own material/blogs Has anyone any experience of developing an application on salesforce as compared to the more 'traditional' .Net route?

  Read the article

• Uncommitted reads in SSIS

  - by OldBoy

  I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

  Read the article

• How to understand existing projects

  - by John

  Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

  Read the article

• Survey statistic diagram ideas

  - by Nort

  Hey everyone, I've got some homework tasks in topic surveys and diagrams. The first task is to normalize the input of a survey, because the structure of the data is changing from time-to-time. So there are three types of surveys: static fields, where text is stored dynamic ones, where the user can select one option and multiselect fields, where the user can select multiple options So I'm not really a statistics guy, so I have really no idea what I can do with that incomming data. So the data I have is stored in an orbital XML file from there I can easily get how man times a survey was filled, and how many times a field was filled, so I can (for eg on a pie chart show the relation of filled or not filled). The second idea is to show the relation between the content of a multi option element using a bar chart or so. In case of the multi option elements I've got the idea to show data in implication of one option. But the question is, what could be shown? The other problem are the static elements (text fields and so). What data could be represented from a single field? The data in the XML field is collected from 2001 to 2005 So maybe I can work with the dates of the surveys, but as I said, i don't really know how to process the data, to collect as much data as possible.

  Read the article

• What about parallelism across network using multiple PCs?

  - by MainMa

  Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

  Read the article

• Visual Studio 2012 won't start

  - by David Aleu

  I installed VS2012 Premium from our MSDN subscription and it was working fine the first couple of days but then I installed a few extensions I can't now start VS2012 and it gives the error: Faulting application name: devenv.exe, version: 11.0.50727.1, time stamp: 0x5011ecaa Faulting module name: ntdll.dll, version: 6.1.7601.17725, time stamp: 0x4ec49b8f Exception code: 0xc0000374 Fault offset: 0x000ce6c3 Faulting process id: 0xee8 Faulting application start time: 0x01cd89bb777fc1dd Faulting application path: C:\Program Files (x86)\Microsoft Visual Studio 11.0\Common7\IDE\devenv.exe Faulting module path: C:\Windows\SysWOW64\ntdll.dll I'm running it on Windows 7 64 bit. I've tried to repair, uninstall and install again and nothing. I tried to restore to a previous restore system point but nothing. The extensions I installed I can remember: VS10x Code Map VSCommands Visual SVN Nuget manager (all the above my colleagues have it too and it works fine for them) and: Web Essentials Visual Studio Color Theme Editor SlowCheetah Mobile Ready HTML5 Questions are: Anyone else has had this problem? Is there a way I can uninstall extensions from a command line or software? (I removed the extensions folder but that doesn't do anything) Can I repair the "C:\Windows\SysWOW64\ntdll.dll"? Is it really a problem with this dll? I haven't been able to find any similar issue in other versions and because VS2012 is new doesn't seem to be much information either.

  Read the article

• Database choices

  - by flobadob

  I have a prickly design issue regarding the choice of database technologies to use for a group of new applications. The final suite of applications would have the following database requirements... Central databases (more than one database) using mysql (myst be mysql due to justhost.com). An application to be written which accesses the multiple mysql databases on the web host. This application will also write to local serverless database (sqlite/firebird/vistadb/whatever). Different flavors of this application will be created for windows (.NET), windows mobile, android if possible, iphone if possible. So, the design task is to minimise the quantity of code to achieve this. This is going to be tricky since the languages used are already c# / java (android) and objc (iphone). Not too worried about that, but can the work required to implement the various database access layers be minimised? The serverless database will hold similar data to the mysql server, so some kind of inheritance in the DAL would be useful. Looking at hibernate/nhibernate and there is linq to whatever. So many choices!

  Read the article

• How to amend return value design in OO manner?

  - by FrontierPsycho

  Hello. I am no newb on OO programming, but I am faced with a puzzling situation. I have been given a program to work on and extend, but the previous developers didn't seem that comfortable with OO, it seems they either had a C background or an unclear understanding of OO. Now, I don't suggest I am a better developer, I just think that I can spot some common OO errors. The difficult task is how to amend them. In my case, I see a lot of this: if (ret == 1) { out.print("yadda yadda"); } else if (ret == 2) { out.print("yadda yadda"); } else if (ret == 3) { out.print("yadda yadda"); } else if (ret == 0) { out.print("yadda yadda"); } else if (ret == 5) { out.print("yadda yadda"); } else if (ret == 6) { out.print("yadda yadda"); } else if (ret == 7) { out.print("yadda yadda"); } ret is a value returned by a function, in which all Exceptions are swallowed, and in the catch blocks, the above values are returned explicitly. Oftentimes, the Exceptions are simply swallowed, with empty catch blocks. It's obvious that swalllowing exceptions is wrong OO design. My question concerns the use of return values. I believe that too is wrong, however I think that using Exceptions for control flow is equally wrong, and I can't think of anything to replace the above in a correct, OO manner. Your input, please?

  Read the article

• Proper API Design for Version Independence?

  - by Justavian

  I've inherited an enormous .NET solution of about 200 projects. There are now some developers who wish to start adding their own components into our application, which will require that we begin exposing functionality via an API. The major problem with that, of course, is that the solution we've got on our hands contains such a spider web of dependencies that we have to be careful to avoid sabotaging the API every time there's a minor change somewhere in the app. We'd also like to be able to incrementally expose new functionality without destroying any previous third party apps. I have a way to solve this problem, but i'm not sure it's the ideal way - i was looking for other ideas. My plan would be to essentially have three dlls. APIServer_1_0.dll - this would be the dll with all of the dependencies. APIClient_1_0.dll - this would be the dll our developers would actual refer to. No references to any of the mess in our solution. APISupport_1_0.dll - this would contain the interfaces which would allow the client piece to dynamically load the "server" component and perform whatever functions are required. Both of the above dlls would depend upon this. It would be the only dll that the "client" piece refers to. I initially arrived at this design, because the way in which we do inter process communication between windows services is sort of similar (except that the client talks to the server via named pipes, rather than dynamically loading dlls). While i'm fairly certain i can make this work, i'm curious to know if there are better ways to accomplish the same task.

  Read the article

< Previous Page | 582 583 584 585 586 587 588 589 590 591 592 593  | Next Page >