task manager - Page 587

Revalidate and repaint - Java Swing

- by bosra

I have a JPanel that I am adding JLabel's to. I then want to remove all the JLabels and add some new ones. So I do the following: panel.removeAll();panel.repaint(); panel.add(new JLabel("Add something new"); panel.revalidate(); This works fine. My problem arises when I start a new thread after this like: panel.removeAll();panel.repaint(); (1)panel.add(new JLabel("Add something new"); panel.revalidate(); //new thread to start - this thread creates new JLabels that should appear under (1) firstProducer.start(); try { firstProducer.join(); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } Then the output from the original JLabels is still visible. I have read that the revalidate process is a long running task and hence the firstProducer thread is getting started while the revalidation is going on and a conflict is arising. What is the best way to deal with this?

Read the article

How to detect a Socket disconnection?

- by AngryHacker

I've implemented a task using the async Sockets pattern in Silverlight 3. I started with Michael Schwarz's implementation and built on top of that. So basically, my Silverlight app establishes a persistent socket connection to a device and then data flows both ways as necessary between the device and the Silverlight app. One thing I am struggling with is how to detect disconnection. I could think of 2 approaches: Keep-Alive. I know this can be done at the Sockets level, but I am not sure how to do this in an async model. How would the Socket class let me know there has been a disconnection. Manual keep alive. Basically, I am having the Silverlight app send a dummy packet every 20 seconds or so. If it fails, I'd assume disconnection. However, incredibly, SocketAsyncEventArgs.SocketError always reports success, even if I simply unplug the device that the Silverlight app is connected to. I am not sure whether this is a bug or what or perhaps I need to upgrade to SL4. Any ideas, direction or implementation would be appreciated.

Read the article

Compromising design & code quality to integrate with existing modules

- by filip-fku

Greetings! I inherited a C#.NET application I have been extending and improving for a while now. Overall it was obviously a rush-job (or whoever wrote it was seemingly less competent than myself). The app pulls some data from an embedded device & displays and manipulates it. At the core is a communications thread in the main application form which executes a 600+ lines of code method which calls functions all over the place, implementing a state machine - lots of if-state-then-do type code. Interaction with the device is done by setting the state/mode globally and letting the thread do it's thing. (This is just one example of the badness of the code - overall it is not very OO-like, it reminds of the style of embedded C code the device firmware is written in). My problem is that this piece of code is central to the application. The software, communications protocol or device firmware are not documented at all. Obviously to carry on with my work I have to interact with this code. What I would like some guidance on, is whether it is worth scrapping this code & trying to piece together something more reasonable from the information I can reverse engineer? I can't decide! The reason I don't want to refactor is because the code already works, and changing it will surely be a long, laborious and unpleasant task. On the flip side, not refactoring means I have to sometimes compromise the design of other modules so that I may call my code from this state machine! I've heard of "If it ain't broke don't fix it!", so I am wondering if it should apply when "it" is influencing the design of future code! Any advice would be appreciated! Thanks!

Read the article

Hundreds of custom UserControls create thousands of USER Objects

- by Andy Blackman

I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

Read the article

Import CSV to class structure as the user defines

- by Assimilater

I have a contact manager program and I would like to offer the feature to import csv files. The problem is that different data sources order the fields in different ways. I thought of programming an interface for the user to tell it the field order and how to handle exceptions. Here is an example line in one of many possible field orders: "ID#","Name","Rank","Address1","Address2","City","State","Country","Zip","Phone#","Email","Join Date","Sponsor ID","Sponsor Name" "Z1234","Call, Anson","STU","1234 E. 6578 S.","","Somecity","TX","United States","012345","000-000-0000","[email protected]","5/24/2010","z12343","Quantum Independence" Notice that in one data field "Name" there is a comma to separate last name and first name and in another there is not. My plan is to have a line for each field (ie ID, Name, City etc.) and a statement "import to" and list box with options like: Don't Import, BusinessJoin Date, First Name, Zip and the program recognizes those as properties of an object... I'd also like the user to be able to record preset field orders so they can re-use them for csv files from the same download source. Then I also need it to check if a record all ready exists (is there a record for Anson Call all ready?) and allow the user to tell it what to do if there is a record (ie mailing address may have changes, so if that field is filled overwrite it, or this mailing address is invalid, leave the current data untouched for this person, overwrite the rest). While I'm capable of coding this...i'm not very excited about it and I'm wondering if there's a tool or set of tools out there to all ready perform most of this functionality... I hope this makes sense...

Read the article

Compressing a database to a single file?

- by Assimilater

Hi all. In my contact manager program I have been storing information by reading and writing comma delimited files for each individual contact, and storing notes in a file for each note, and I'm wondering how I could go about shrinking them all into one file effectively. I have attempted using data entry tools in the visual studio toolbox and template class, though I have never quite figured out how to use them. What would be especially convenient is if I could store data as data type IOwner (a class I created) as opposed to strings. I'd also need to figure out how to tell the program what to do when a file is opened (I've noticed in the properties how to associate a file type with the program though am not sure how to tell it what to do when it's opened). Edit: How about rephrasing the question: I have a class IContact with various properties some of them being lists of other class objects. I have a public list of IContact. Can I write Contacts as List(Of IContact) to a file as opposed to a bunch of strings? Second part of the question: I have associated .cms files with my program. But if a user opens the file, what code should the program run through in an attempt to deal with the file? This file is going to contain data that the program needs to read, how do I tell it to read a file when the program is opened vicariously because the file was opened? Does this make the question clearer?

Read the article

Issues regarding playing audio files in a JME midlet.

- by Northernen

I am making a midlet which is to be used to play out local audio files. It is obviously not working. I am getting a null reference on the "is" variable, in the code snippet shown below. 1. try{ 2. System.out.println("path: " + this.getClass()); 3. InputStream is = this.getClass().getResourceAsStream("res/01Track.wav"); 4. p1=Manager.createPlayer(is, "audio"); 5. p1.realize(); 6. p1.prefetch(); 7. p1.start(); 8. } 9. catch(Exception e){ 10. System.out.println(e.getMessage()); 11. } I assume there is something wrong with the "this.getClass().getResourceAsStream("res/01Track.wav")" bit, but I can not for the life of me figure out why, and I have tried referring to the file in 20 different ways. If I printline "this.getClass()" it gives me "path: class Mp3spiller". The absolute path to "01Track.wav" is "E:\Mine dokumenter\Dokumenter\workspace_mobiljava\Mp3spiller\res\01Track.wav". Am I completely wrong in thinking that I should refer relatively to "E:\Mine dokumenter\Dokumenter\workspace_mobiljava\Mp3spiller"? If anyone could point out what I am doing wrong, I would be grateful. I have basically stolen the code from a tutorial I found online, so I would have thought it would be working.

Read the article

Send Special Keys to Gtk.VteTerminal

- by Ubersoldat

Hi I have this OSS Project called Monocaffe connections manager which uses the Gtk.VteTerminal widget from PyGTK. A nice feature is that it allows the users to send commands to different servers' consoles (cluster mode) using a Gtk.TextView for the input. The way I send key strokes to each Gtk.VteTerminal is by using the feed_child method. For common keys there's no problem: I simply feed what the TextView receives to all the terminals, but when doing so with special keys I get into a little trouble. For "Return" I catch the event and feed the terminal a '\n'. For back-space is the same, catch the event and feed a '\b'. def cluster_backspace(self, widget): return self.cluster_send_key('\b') The problem comes with other keys like Tab, Arrows, Esc which I don't know how to feed as str to the terminal to recognize them. In the case of Esc is a real pain, because the users can edit the same file on different servers using vi, but cannot escape insert mode. Anyway, I'm not looking for a complete solution, just ideas since I've ran out of them. Thanks.

Read the article

How to exclude tags folder from triggering build in Teamcity?

- by Jaya mareedu

Hello, I recently installed Teamcity 5.0.3. I am trying to setup automated build for a .NET 2.0 VS2005 project. I use NAnt and MSBuild task to perform the build. The project structure is a typical SVN structure svn://localhost/ITools is my repository and the project structure is VisualTrack trunk branches tags I created a new project in Teamcity and then created a build configuration for that project. I asked it to kick off a build everytime there is a change detected in SVN VisualTrack VCS. I also configured it to create a label in VisualTrack/tags for every successful build. The problem I am running into is that the build is getting trigerred everytime teamcity is creating a new label under tags. I only want the build to be triggered if some developer commits his or her changes into trunk. Next step I took was to create a build trigger rule to exclude the tags path by specifying a trigger pattern as -:VisualTrack/tags/**, but looks like its not working. I believe the pattern I specified is not correct. Can someone please help me resolve this issue? Thanks, Jaya.

Read the article

Image Resizing and Compression

- by GSTAR

Hi guys, I'm implementing an image upload facility for my website. The uploading facility is complete but what I'm working on at the moment is manipulating the images. For this task I am using PHPThumb (http://phpthumb.gxdlabs.com). Anyway as I go along I'm coming across potential issues, to do with resizing and compression. Basically I want to acheive the following results: The ideal image dimensions are: 800px width, 600px height. If an uploaded image exceeds either of these dimensions, it will need be resized to meet the requirements. Otherwise, leave as it is. The ideal file size is 200kb. If an uploaded image exceeds this then it will need to be compressed to meet this requirement. Otherwise, leave as it is. So in a nutshell: 1) Check the dimensions, resize if required. 2) Check the filesize, compress if required. Has anybody done anything like this / could you give me some pointers? Is PHPThumb the correct tool to do this in?

Read the article

unexpected behaviour of object stored in web service Session

- by draconis

Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

Read the article

Complex sorting on MySQL database

- by ChrisR

Read the article

user interface pattern for associating single or many objects to an entity

- by Samuel

Need suggestions on implementing associating single or many objects to an entity. All soccer team players are registered individually (e.g. they are part of 'players' table) A soccer team has many players. The click sequence is like this:- a] Soccer team owner provides a name and brief description of the soccer team. b] Now it wants to add players to this team. c] You have the following button 'Add players to team' which lets you navigate to the 'View Players' page and lets you multi select users from there. Assuming this is a paginated list of players, how do you handle the following:- Do you provide a check box against each player and let the manager do a multi selection. If you need to add more players, it doesn't make sense to show the players who have been already added to the team. Do you mark those entries as not selectable or you would adding showing these entries. If you need to filter, do you provide search filters at the top of this page. Am looking for ideas on how to implement this or sites which have already done something similar.

Read the article

Vim: change formatting of variables in a script

- by sixtyfootersdude

I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

Read the article

PendingIntent in Widget + TaskKiller

- by YaW

Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

Read the article

string comparision and counting the key in target [closed]

- by mesun

Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

Read the article

Driver denied access to PCI card

- by Corin

We wrote a Windows device driver to access our custom PCI card. The driver uses CreateFile to get a handle to the card. We recently had trouble at one installation were the card appeared to stop working. We tried replacing the card (the replacement appeared not work either). The computer vendor replaced the motherboard and both cards still failed to work. We put the cards in a different computer and both worked fine. We now have the computer at our office for examination. The Windows Device Manager lists our card in Other Devices as usual and says it's working fine. However, our driver initialization fails when it attempts to connect to the card. We created a test version of our driver with some extra debugging and determined that CreateFile is failing. It returns INVALID_HANDLE_VALUE as it is supposed to on failure. GetLastError indicates the error is Access is Denied. Since we're logged into the system as a local administrator, what can deny access to the device?

Read the article

do the Python libraries have a natural dependence on the global namespace?

- by msw

I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

Read the article

is it possible to write a program which prints its own source code utilizing a "sequence-generating-

- by guest

is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

Read the article

How does PHP interface with Apache?

- by Sbm007

Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

Read the article

Advice: Python Framework Server/Worker Queue management (not Website)

- by Muppet Geoff

I am looking for some advice/opinions of which Python Framework to use in an implementation of multiple 'Worker' PCs co-ordinated from a central Queue Manager. For completeness, the 'Worker' PCs will be running Audio Conversion routines (which I do not need advice on, and have standalone code that works). The Audio conversion takes a long time, and I need to co-ordinate an arbitrary number of the 'Workers' from a central location, handing them conversion tasks (such as where to get the source files, or where to ask for the job configuration) with them reporting back some additional info, such as the runtime of the converted audio etc. At present, I have a script that makes a webservice call to get the 'configuration' for a conversion task, based on source files located on the worker already (we manually copy the source files to the worker, and that triggers a conversion routine). I want to change this, so that we can distribute conversion tasks ("Oy you, process this: xxx") based on availability, and in an ideal world, based on pending tasks too. There is a chance that Workers can go offline mid-conversion (but this is not likely). All the workers are Windows based, the co-ordinator can be WIndows or Linux. I have (in my initial searches) come across the following - and I know that some are cross-dependent: Celery (with RabbitMQ) Twisted Django Using a framework, rather than home-brewing, seems to make more sense to me right now. I have a limited timeframe in which to develop this functional extension. An additional consideration would be using a Framework that is compatible with PyQT/PySide so that I can write a simple UI to display Queue status etc. I appreciate that the specifics above are a little vague, and I hope that someone can offer me a pointer or two. Again: I am looking for general advice on which Python framework to investigate further, for developing a Server/Worker 'Queue management' solution, for non-web activities (this is why DJango didn't seem the right fit).

Read the article

eclipse stuck at running program

- by user1434388

This is the picture after I end task the eclipse. My Android Program has no errors, and before this problem it was all fine. It happened when I added some code into my program. It gets stuck after I click the run button. This also happens when I run my handphone for debugging the program. Other programs are all working fine, only one is stuck. When I try to remove and import it again seem there is a classes.dex file which I cannot delete, I have to restart my computer for it to allow to delete and I have to force the program to close. I have searched at this website and they said keep open the emulator but it doesn't work for me. below is the connecting coding that i added. //check internet connection private boolean chkConnectionStatus(){ ConnectivityManager connMgr = (ConnectivityManager) this.getSystemService(Context.CONNECTIVITY_SERVICE); final android.net.NetworkInfo wifi = connMgr.getNetworkInfo(ConnectivityManager.TYPE_WIFI); final android.net.NetworkInfo mobile = connMgr.getNetworkInfo(ConnectivityManager.TYPE_MOBILE); if( wifi.isAvailable() ){ return true; } else if( mobile.isAvailable() ){ return true; } else { Toast.makeText(this, "Check your internet" , Toast.LENGTH_LONG).show(); return false; } }

Read the article

Update table using SSIS

- by thursdaysgeek

I am trying to update a field in a table with data from another table, based on a common key. If it were in straight SQL, it would be something like: Update EHSIT set e.IDMSObjID = s.IDMSObjID from EHSIT e, EHSIDMS s where e.SITENUM = s.SITE_CODE However, the two tables are not in the same database, so I'm trying to use SSIS to do the update. Oh, and the sitenum/site_code are varchar in one and nvarchar in the other, so I'll have to do a data conversion so they'll match. How do I do it? I have a data flow object, with the source as EHSIDMS and the destination as EHSIT. I have a data conversion to convert the unicode to non-unicode. But how do I update based on the match? I've tried with the destination, using a SQL Command as the Data Access mode, but it doesn't appear to have the source table. If I just map the field to be updated, how does it limit it based on fields matching? I'm about to export my source table to Excel or something, and then try inputting from there, although it seems that all that would get me would be to remove the data conversion step. Shouldn't there be an update data task or something? Is it one of those Data Flow transformation tasks, and I'm just not figuring out which it is?

Read the article

SQL Server 2008 Stored Proc suddenly returns -1

- by aaginor

I use the following stored procedure from my SQL Server 2008 database to return a value to my C#-Program ALTER PROCEDURE [dbo].[getArticleBelongsToCatsCount] @id int AS BEGIN SET NOCOUNT ON; DECLARE @result int; set @result = (SELECT COUNT(*) FROM art_in_cat WHERE child_id = @id); return @result; END I use a SQLCommand-Object to call this Stored Procedure public int ExecuteNonQuery() { try { return _command.ExecuteNonQuery(); } catch (Exception e) { Logger.instance.ErrorRoutine(e, "Text: " + _command.CommandText); return -1; } } Till recently, everything works fine. All of a sudden, the stored procedure returned -1. At first, I suspected, that the ExecuteNonQuery-Command would have caused and Exception, but when stepping through the function, it shows that no Exception is thrown and the return value comes directly from return _command.ExecuteNonQuery(); I checked following parameters and they were as expected: - Connection object was set to the correct database with correct access values - the parameter for the SP was there and contained the right type, direction and value Then I checked the SP via SQLManager, I used the same value for the parameter like the one for which my C# brings -1 as result (btw. I checked some more parameter values in my C' program and they ALL returned -1) but in the manager, the SP returns the correct value. It looks like the call from my C# prog is somehow bugged, but as I don't get any error (it's just the -1 from the SP), I have no idea, where to look for a solution.

Read the article

What are salesforce.com and Apex like as an application development platform?

- by mhollers

I have recently discovered that salesforce.com is much more than an online CRM after coming across a Morrison's Case Study in which they develop a works management application. I've been trying it out with a view to recreating our own Works Management system on the platform. My background is in Microsoft and .Net, and the obvious 1st choice would be asp.net. However, there's only really myself with .net experience and my manager with a more legacy Synergy programming background, and I am self taught and am looking at evaluating other RAD options (eg Ironspeed). the nature of the business is in the main 2-5 concurrent construction type contracts that run for 3-5 yrs each, each requiring 15-50 system users. Traditionally we have used our character based Works Mangement system for everything and tweaked it for each contract. The Salesforce licensing model on the face of it suits this sort of flexibilty, but I'm worried about the development flexibilty/learning curve and all the issues that surround lock-in. There doesn't seem to be much neutral sober analysis of the platform on the web that isn't salesforce's own material/blogs Has anyone any experience of developing an application on salesforce as compared to the more 'traditional' .Net route?

Search Results

Search found 16801 results on 673 pages for 'task manager'.

Page 587/673 | < Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594 | Next Page >

- by bosra

- by AngryHacker

- by filip-fku

- by Andy Blackman

- by Assimilater

- by Assimilater

- by Northernen

- by Ubersoldat

- by Jaya mareedu

- by GSTAR

- by draconis

- by ChrisR

- by Samuel

- by sixtyfootersdude

- by YaW

- by mesun

- by Corin

- by msw

- by guest

- by Sbm007

- by Muppet Geoff

- by user1434388

- by thursdaysgeek

- by aaginor

- by mhollers

< Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594 | Next Page >