Search Results

Search found 16801 results on 673 pages for 'task manager'.

Page 587/673 | < Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >

  • Driver denied access to PCI card

    - by Corin
    We wrote a Windows device driver to access our custom PCI card. The driver uses CreateFile to get a handle to the card. We recently had trouble at one installation were the card appeared to stop working. We tried replacing the card (the replacement appeared not work either). The computer vendor replaced the motherboard and both cards still failed to work. We put the cards in a different computer and both worked fine. We now have the computer at our office for examination. The Windows Device Manager lists our card in Other Devices as usual and says it's working fine. However, our driver initialization fails when it attempts to connect to the card. We created a test version of our driver with some extra debugging and determined that CreateFile is failing. It returns INVALID_HANDLE_VALUE as it is supposed to on failure. GetLastError indicates the error is Access is Denied. Since we're logged into the system as a local administrator, what can deny access to the device?

    Read the article

  • user interface pattern for associating single or many objects to an entity

    - by Samuel
    Need suggestions on implementing associating single or many objects to an entity. All soccer team players are registered individually (e.g. they are part of 'players' table) A soccer team has many players. The click sequence is like this:- a] Soccer team owner provides a name and brief description of the soccer team. b] Now it wants to add players to this team. c] You have the following button 'Add players to team' which lets you navigate to the 'View Players' page and lets you multi select users from there. Assuming this is a paginated list of players, how do you handle the following:- Do you provide a check box against each player and let the manager do a multi selection. If you need to add more players, it doesn't make sense to show the players who have been already added to the team. Do you mark those entries as not selectable or you would adding showing these entries. If you need to filter, do you provide search filters at the top of this page. Am looking for ideas on how to implement this or sites which have already done something similar.

    Read the article

  • Import CSV to class structure as the user defines

    - by Assimilater
    I have a contact manager program and I would like to offer the feature to import csv files. The problem is that different data sources order the fields in different ways. I thought of programming an interface for the user to tell it the field order and how to handle exceptions. Here is an example line in one of many possible field orders: "ID#","Name","Rank","Address1","Address2","City","State","Country","Zip","Phone#","Email","Join Date","Sponsor ID","Sponsor Name" "Z1234","Call, Anson","STU","1234 E. 6578 S.","","Somecity","TX","United States","012345","000-000-0000","[email protected]","5/24/2010","z12343","Quantum Independence" Notice that in one data field "Name" there is a comma to separate last name and first name and in another there is not. My plan is to have a line for each field (ie ID, Name, City etc.) and a statement "import to" and list box with options like: Don't Import, BusinessJoin Date, First Name, Zip and the program recognizes those as properties of an object... I'd also like the user to be able to record preset field orders so they can re-use them for csv files from the same download source. Then I also need it to check if a record all ready exists (is there a record for Anson Call all ready?) and allow the user to tell it what to do if there is a record (ie mailing address may have changes, so if that field is filled overwrite it, or this mailing address is invalid, leave the current data untouched for this person, overwrite the rest). While I'm capable of coding this...i'm not very excited about it and I'm wondering if there's a tool or set of tools out there to all ready perform most of this functionality... I hope this makes sense...

    Read the article

  • unexpected behaviour of object stored in web service Session

    - by draconis
    Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

    Read the article

  • Update table using SSIS

    - by thursdaysgeek
    I am trying to update a field in a table with data from another table, based on a common key. If it were in straight SQL, it would be something like: Update EHSIT set e.IDMSObjID = s.IDMSObjID from EHSIT e, EHSIDMS s where e.SITENUM = s.SITE_CODE However, the two tables are not in the same database, so I'm trying to use SSIS to do the update. Oh, and the sitenum/site_code are varchar in one and nvarchar in the other, so I'll have to do a data conversion so they'll match. How do I do it? I have a data flow object, with the source as EHSIDMS and the destination as EHSIT. I have a data conversion to convert the unicode to non-unicode. But how do I update based on the match? I've tried with the destination, using a SQL Command as the Data Access mode, but it doesn't appear to have the source table. If I just map the field to be updated, how does it limit it based on fields matching? I'm about to export my source table to Excel or something, and then try inputting from there, although it seems that all that would get me would be to remove the data conversion step. Shouldn't there be an update data task or something? Is it one of those Data Flow transformation tasks, and I'm just not figuring out which it is?

    Read the article

  • Send Special Keys to Gtk.VteTerminal

    - by Ubersoldat
    Hi I have this OSS Project called Monocaffe connections manager which uses the Gtk.VteTerminal widget from PyGTK. A nice feature is that it allows the users to send commands to different servers' consoles (cluster mode) using a Gtk.TextView for the input. The way I send key strokes to each Gtk.VteTerminal is by using the feed_child method. For common keys there's no problem: I simply feed what the TextView receives to all the terminals, but when doing so with special keys I get into a little trouble. For "Return" I catch the event and feed the terminal a '\n'. For back-space is the same, catch the event and feed a '\b'. def cluster_backspace(self, widget): return self.cluster_send_key('\b') The problem comes with other keys like Tab, Arrows, Esc which I don't know how to feed as str to the terminal to recognize them. In the case of Esc is a real pain, because the users can edit the same file on different servers using vi, but cannot escape insert mode. Anyway, I'm not looking for a complete solution, just ideas since I've ran out of them. Thanks.

    Read the article

  • How to test a Grails Service that utilizes a criteria query (with spock)?

    - by user569825
    I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

    Read the article

  • Vim: change formatting of variables in a script

    - by sixtyfootersdude
    I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

    Read the article

  • PendingIntent in Widget + TaskKiller

    - by YaW
    Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • do the Python libraries have a natural dependence on the global namespace?

    - by msw
    I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • How can I get my business objects layer to use the management layer in their methods?

    - by Tom Pickles
    I have a solution in VS2010 with several projects, each making up a layer within my application. I have business entities which are currently objects with no methods, and I have a management layer which references the business entities layer in it's project. I now think I have designed my application poorly and would like to move methods from helper classes (which are in another layer) into methods I'll create within the business entities themselves. For example I have a VirtualMachine object, which uses a helper class to call a Reboot() method on it which passes the request to the management layer. The static manager class talks to an API that reboots the VM. I want to move the Reboot() method into the VirtualMachine object, but I will need to reference the management layer: public void Reboot() { VMManager.Reboot(this.Name); } So if I add a reference to my management project in my entities project, I get the circular dependency error, which is how it should be. How can I sort this situation out? Do I need to an yet another layer between the entity layer and the management layer? Or, should I just forget it and leave it as it is. The application works ok now, but I am concerned my design isn't particularly OOP centric and I would like to correct this.

    Read the article

  • [C#] how to do Exception Handling & Tracing

    - by shrimpy
    Hi all, i am reading some C# books, and got some exercise don't know how to do, or not sure what does the question mean. Problem: After working for a company for some time, your skills as a knowledgeable developer are recognized, and you are given the task of “policing” the implementation of exception handling and tracing in the source code (C#) for an enterprise application that is under constant incremental development. The two goals set by the product architect are: 100% of methods in the entire application must have at least a standard exception handler, using try/catch/finally blocks; more complex methods must also have additional exception handling for specific exceptions All control flow code can optionally write “tracing” information to assist in debugging and instrumentation of the application at run-time in situations where traditional debuggers are not available (eg. on staging and production servers). (i am not quite understand these criterias, i came from the java world, java has two kind of exception, check and unchecked exception. Developer must handle checked exception, and do logging. about unchecked exception, still do logging maybe, but most of the time we just throw it. however here comes to C#, what should i do????) Question for Problem: List rules you would create for the development team to follow, and the ways in which you would enforce rules, to achieve these goals. How would you go about ensuring that all existing code complies with the rules specified by the product architect; in particular, what considerations would impact your planning for the work to ensure all existing code complies?

    Read the article

  • Turning a series of raw images into movie frames in Android

    - by Nicholas Killewald
    I've got an Android project I'm working on that, ultimately, will require me to create a movie file out of a series of still images taken with a phone's camera. That is to say, I want to be able to take raw image frames and string them together, one by one, into a movie. Audio is not a concern at this stage. Looking over the Android API, it looks like there are calls in it to create movie files, but it seems those are entirely geared around making a live recording from the camera on an immediate basis. While nice, I can't use that for my purposes, as I need to put annotations and other post-production things on the images as they come in before they get fed into a movie (plus, the images come way too slowly to do a live recording). Worse, looking over the Android source, it looks like a non-trivial task to rewire that to do what I want it to do (at least without touching the NDK). Is there any way I can use the API to do something like this? Or alternatively, what would be the best way to go about this, if it's even feasible on cell phone hardware (which seems to keep getting more and more powerful, strangely...)?

    Read the article

  • Set service dependencies after install

    - by Dennis
    I have an application that runs as a Windows service. It stores various things settings in a database that are looked up when the service starts. I built the service to support various types of databases (SQL Server, Oracle, MySQL, etc). Often times end users choose to configure the software to use SQL Server (they can simply modify a config file with the connection string and restart the service). The problem is that when their machine boots up, often times SQL Server is started after my service so my service errors out on start up because it can't connect to the database. I know that I can specify dependencies for my service to help guide the Windows service manager to start the appropriate services before mine. However, I don't know what services to depend upon at install time (when my service is registered) since the user can change databases later on. So my question is: is there a way for the user to manually indicate the service dependencies based on the database that they are using? If not, what is the proper design approach that I should be taking? I've thought about trying to do something like wait 30 seconds after my service starts up before connecting to the database but this seems really flaky for various reasons. I've also considered trying to "lazily" connect to the database; the problem is that I need a connection immediately upon start up since the database contains various pieces of vital info that my service needs when it first starts. Any ideas?

    Read the article

  • Complex sorting on MySQL database

    - by ChrisR
    I'm facing the following situation. We've got an CMS with an entity with translations. These translations are stored in a different table with a one-to-many relationship. For example newsarticles and newsarticle_translations. The amount of available languages is dynamically determined by the same CMS. When entering a new newsarticle the editor is required to enter at least one translation, which one of the available languages he chooses is up to him. In the newsarticle overview in our CMS we would like to show a column with the (translated) article title, but since none of the languages are mandatory (one of them is mandatory but i don't know which one) i don't really know how to construct my mysql query to select a title for each newsarticle, regardless of the entered language. And to make it all a little harder, our manager asked for the possibilty to also be able to sort on title, so fetching the translations in a separate query is ruled out as far as i know. Anyone has an idea on how to solve this in the most efficient way? Here are my table schema's it it might help > desc news; +-----------------+----------------+------+-----+-------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +-----------------+----------------+------+-----+-------------------+----------------+ | id | int(10) | NO | PRI | NULL | auto_increment | | category_id | int(1) | YES | | NULL | | | created | timestamp | NO | | CURRENT_TIMESTAMP | | | user_id | int(10) | YES | | NULL | | +-----------------+----------------+------+-----+-------------------+----------------+ > desc news_translations; +-----------------+------------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +-----------------+------------------+------+-----+---------+----------------+ | id | int(10) unsigned | NO | PRI | NULL | auto_increment | | enabled | tinyint(1) | NO | | 0 | | | news_id | int(1) unsigned | NO | | NULL | | | title | varchar(255) | NO | | | | | summary | text | YES | | NULL | | | body | text | NO | | NULL | | | language | varchar(2) | NO | | NULL | | +-----------------+------------------+------+-----+---------+----------------+ PS: i've though about subqueries and coalesce() solutions but those seem rather dirty tricks, wondering if something better is know that i'm not thinking of?

    Read the article

  • What Test Environment Setup do Top Project Committers Use in the Ruby Community?

    - by viatropos
    Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

    Read the article

  • SDK Platform Tools component missing - Similar to Android Eve below

    - by Hertfordkc
    Ubuntu Linux 10.04//Eclipse 3.5.2 I'm new to Eclipse and Android. Eclipse is up and running simple Jave apps OK. I moved on to downloading the Android SDK starter package, which seemed to go OK. Ran the SDK manager and downladed Platforms 7,8 & 9. Installed the ADT package in Eclipse. I've tried to load the SDK path into the Eclipse Preferences, but it won't retain the path. After restart, Elipse says it can't find SDK package. Also,one message said that the (revision?) number of the ADT couldn't be found. I've reinstalled Eclipse a couple of times, and then gone through the SDK & ADT download procedures a couple of times and am stuck. Any suggestions will be appreciated. Hertfordkc Stupid question caused by not thoroughly reading the Android Developers Guide and the tutorials before trying to start a project. Don't know why I didn't get a message about a missing XML file.

    Read the article

  • SQL Server 2008 Stored Proc suddenly returns -1

    - by aaginor
    I use the following stored procedure from my SQL Server 2008 database to return a value to my C#-Program ALTER PROCEDURE [dbo].[getArticleBelongsToCatsCount] @id int AS BEGIN SET NOCOUNT ON; DECLARE @result int; set @result = (SELECT COUNT(*) FROM art_in_cat WHERE child_id = @id); return @result; END I use a SQLCommand-Object to call this Stored Procedure public int ExecuteNonQuery() { try { return _command.ExecuteNonQuery(); } catch (Exception e) { Logger.instance.ErrorRoutine(e, "Text: " + _command.CommandText); return -1; } } Till recently, everything works fine. All of a sudden, the stored procedure returned -1. At first, I suspected, that the ExecuteNonQuery-Command would have caused and Exception, but when stepping through the function, it shows that no Exception is thrown and the return value comes directly from return _command.ExecuteNonQuery(); I checked following parameters and they were as expected: - Connection object was set to the correct database with correct access values - the parameter for the SP was there and contained the right type, direction and value Then I checked the SP via SQLManager, I used the same value for the parameter like the one for which my C# brings -1 as result (btw. I checked some more parameter values in my C' program and they ALL returned -1) but in the manager, the SP returns the correct value. It looks like the call from my C# prog is somehow bugged, but as I don't get any error (it's just the -1 from the SP), I have no idea, where to look for a solution.

    Read the article

  • What are salesforce.com and Apex like as an application development platform?

    - by mhollers
    I have recently discovered that salesforce.com is much more than an online CRM after coming across a Morrison's Case Study in which they develop a works management application. I've been trying it out with a view to recreating our own Works Management system on the platform. My background is in Microsoft and .Net, and the obvious 1st choice would be asp.net. However, there's only really myself with .net experience and my manager with a more legacy Synergy programming background, and I am self taught and am looking at evaluating other RAD options (eg Ironspeed). the nature of the business is in the main 2-5 concurrent construction type contracts that run for 3-5 yrs each, each requiring 15-50 system users. Traditionally we have used our character based Works Mangement system for everything and tweaked it for each contract. The Salesforce licensing model on the face of it suits this sort of flexibilty, but I'm worried about the development flexibilty/learning curve and all the issues that surround lock-in. There doesn't seem to be much neutral sober analysis of the platform on the web that isn't salesforce's own material/blogs Has anyone any experience of developing an application on salesforce as compared to the more 'traditional' .Net route?

    Read the article

  • Using java to create a logistic model - arrays and properties

    - by Oliver Burdekin
    I'm currently trying to create a java model that will solve a problem we have. On a voluntary expedition each week we have some people leaving and some new people arriving. Accommodation is in tents. The tents sleep different numbers of people and certain rules apply. Males and females cannot be mixed and volunteers can be one of four types - school children/ research assistants/ scientific staff/ school teachers So types of volunteer and sexes cannot be mixed. Each week the manager spends hours trying to work this out so I've offered to make this model to keep my coding skills up. At present I'm working with arrays. Each tent is a 2D array [4][x] where x is the number of people it sleeps (each person sleeping there has 4 attributes). Each person is a 1D array with 4 attributes [4]. The idea is to check where people can go, cause the minimum movement for people staying on and solve this logistic problem. Does anyone have any better suggestions as to how to solve this? At present I'm finding it necessary to write a lot of code setting up and querying arrays. Any help is appreciated.

    Read the article

  • Compressing a database to a single file?

    - by Assimilater
    Hi all. In my contact manager program I have been storing information by reading and writing comma delimited files for each individual contact, and storing notes in a file for each note, and I'm wondering how I could go about shrinking them all into one file effectively. I have attempted using data entry tools in the visual studio toolbox and template class, though I have never quite figured out how to use them. What would be especially convenient is if I could store data as data type IOwner (a class I created) as opposed to strings. I'd also need to figure out how to tell the program what to do when a file is opened (I've noticed in the properties how to associate a file type with the program though am not sure how to tell it what to do when it's opened). Edit: How about rephrasing the question: I have a class IContact with various properties some of them being lists of other class objects. I have a public list of IContact. Can I write Contacts as List(Of IContact) to a file as opposed to a bunch of strings? Second part of the question: I have associated .cms files with my program. But if a user opens the file, what code should the program run through in an attempt to deal with the file? This file is going to contain data that the program needs to read, how do I tell it to read a file when the program is opened vicariously because the file was opened? Does this make the question clearer?

    Read the article

  • How to detect a Socket disconnection?

    - by AngryHacker
    I've implemented a task using the async Sockets pattern in Silverlight 3. I started with Michael Schwarz's implementation and built on top of that. So basically, my Silverlight app establishes a persistent socket connection to a device and then data flows both ways as necessary between the device and the Silverlight app. One thing I am struggling with is how to detect disconnection. I could think of 2 approaches: Keep-Alive. I know this can be done at the Sockets level, but I am not sure how to do this in an async model. How would the Socket class let me know there has been a disconnection. Manual keep alive. Basically, I am having the Silverlight app send a dummy packet every 20 seconds or so. If it fails, I'd assume disconnection. However, incredibly, SocketAsyncEventArgs.SocketError always reports success, even if I simply unplug the device that the Silverlight app is connected to. I am not sure whether this is a bug or what or perhaps I need to upgrade to SL4. Any ideas, direction or implementation would be appreciated.

    Read the article

  • How can I manage building library projects that produce both a static lib and a dll?

    - by Scott Langham
    I've got a large visual studio solution with ~50 projects. There are configurations for StaticDebug, StaticRelease, Debug and Release. Some libraries are needed in both dll and static lib form. To get them, we rebuild the solution with a different configuration. The Configuration Manager window is used to setup which projects need to build in which flavours, static lib, dynamic dll or both. This can by quite tricky to manage and it's a bit annoying to have to build the solution multiple times and select the configurations in the right order. Static versions need building before non-static versions. I'm wondering, instead of this current scheme, might it be simpler to manage if, for the projects I needed to produce both a static lib and dynamc dll, I created two projects. Eg: CoreLib CoreDll I could either make both of these projects reference all the same files and build them twice, or I'm wondering, would it be possible to build CoreLib and then get CoreDll to link it to generate the dll? I guess my question is, do you have any advice on how to structure your projects in this kind of situation? Thanks.

    Read the article

< Previous Page | 583 584 585 586 587 588 589 590 591 592 593 594  | Next Page >