Search Results

Search found 16639 results on 666 pages for 'task engine'.

Page 594/666 | < Previous Page | 590 591 592 593 594 595 596 597 598 599 600 601  | Next Page >

  • [C#] how to do Exception Handling & Tracing

    - by shrimpy
    Hi all, i am reading some C# books, and got some exercise don't know how to do, or not sure what does the question mean. Problem: After working for a company for some time, your skills as a knowledgeable developer are recognized, and you are given the task of “policing” the implementation of exception handling and tracing in the source code (C#) for an enterprise application that is under constant incremental development. The two goals set by the product architect are: 100% of methods in the entire application must have at least a standard exception handler, using try/catch/finally blocks; more complex methods must also have additional exception handling for specific exceptions All control flow code can optionally write “tracing” information to assist in debugging and instrumentation of the application at run-time in situations where traditional debuggers are not available (eg. on staging and production servers). (i am not quite understand these criterias, i came from the java world, java has two kind of exception, check and unchecked exception. Developer must handle checked exception, and do logging. about unchecked exception, still do logging maybe, but most of the time we just throw it. however here comes to C#, what should i do????) Question for Problem: List rules you would create for the development team to follow, and the ways in which you would enforce rules, to achieve these goals. How would you go about ensuring that all existing code complies with the rules specified by the product architect; in particular, what considerations would impact your planning for the work to ensure all existing code complies?

    Read the article

  • Using custom Qt subclasses in Python

    - by kwatford
    First off: I'm new to both Qt and SWIG. Currently reading documentation for both of these, but this is a time consuming task, so I'm looking for some spoilers. It's good to know up-front whether something just won't work. I'm attempting to formulate a modular architecture for some in-house software. The core components are in C++ and exposed via SWIG to Python for experimentation and rapid prototyping of new components. Qt seems like it has some classes I could use to avoid re-inventing the wheel too much here, but I'm concerned about how some of the bits will fit together. Specifically, if I create some C++ classes, I'll need to expose them via SWIG. Some of these classes likely subclass Qt classes or otherwise have Qt stuff exposed in their public interfaces. This seems like it could raise some complications. There are already two interfaces for Qt in Python, PyQt and PySide. Will probably use PySide for licensing reasons. About how painful should I expect it to be to get a SWIG-wrapped custom subclass of a Qt class to play nice with either of these? What complications should I know about upfront?

    Read the article

  • Mono Text Based Web Browser

    - by powerbox
    Hi guys, is there any public text based web browser implementation for C# or on mono base api that I can use to fill up web forms automatically? I'll be using it to automate some web task that does not require any image authentication. I'm currently using a web browser control available on .Net Framework and waits for the event WebBrowserDocumentCompletedEventHandler to fire after a page is successfully loaded and invoke some actions like Submit or simulating a mouse click on some links. It actually does the job but I can't process bulk transactions since I needed to wait for the whole page to be loaded together with the images and other stuff. It is easy to use HttpWebRequest to fill up some forms , provide some data and then submit. But on some occasions I only need to simulate a mouse click to a certain link which I don't know how to do with HttpWebRequest. By the way using HttpWebRequest will still download all the images of a web page that I see pointless since I only need to provide correct data back to the server. I hope someone can pinpoint me the correct way of doing this kind of automation and thanks in advance!

    Read the article

  • [php,mysql] insert only adds upto 1000 records and ignoresall records after that.

    - by user560559
    Hello i have a large database where the client stores personal messages and fire email notifications [if allowed by the users]. certain users have the option of sending messages to their entire network of friends. some users have over 5000 friends in their network so if they select the whole network they'll be sending messages to over 5000 friends and system will store all the messages into a table. the problem is this that it does not insert more than 1000 records and ignores all inserts after the first 1000. i have increased the packet size, bulk_insert_buffer_size but still no luck. since the system stores some of the info in another table for reports, every insert returns its new message id. due to this i can not use the "insert into table (column1,column2) values (value1,value2) , (value1,value2)....etc." table engine is innodb, mysql version is 5.1.3 and is hosted on amazon web services. all i want is to fix this issue of inserting more than 1000 records at a time. as mentioned earlier, it works fine but only up to 1000 records and simply ignores all the records after that. i'm using php foreach(){} to insert message for each friend and if email is available, send notification to the user. this foreach(){} also inserts the same record in another table [with only 3 columns] for generating reports. thank you in advance for all the help and support. WMA.

    Read the article

  • Effective communication in a component-based system

    - by Tesserex
    Yes, this is another question about my game engine, which is coming along very nicely, with much thanks to you guys. So, if you watched the video (or didn't), the objects in the game are composed of various components for things like position, sprites, movement, collision, sounds, health, etc. I have several message types defined for "tell" type communication between entities and components, but this only goes so far. There are plenty of times when I just need to ask for something, for example an entity's position. There are dozens of lines in my code that look like this: SomeComponent comp = (SomeComponent)entity.GetComponent(typeof(SomeComponent)); if (comp != null) comp.GetSomething(); I know this is very ugly, and I know that casting smells of improper OO design. But as complex as things are, there doesn't seem to be a better way. I could of course "hard-code" my component types and just have SomeComponent comp = entity.GetSomeComponent(); but that seems like a cop-out, and a bad one. I literally JUST REALIZED, while writing this, after having my code this way for months with no solution, that a generic will help me. SomeComponent comp = entity.GetComponent<SomeComponent>(); Amazing how that works. Anyway, this is still only a semantic improvement. My questions remain. Is this actually that bad? What's a better alternative?

    Read the article

  • Any Alternate way for writing to a file other than ofstream

    - by Aditya
    Hi All, I am performing file operations (writeToFile) which fetches the data from a xml and writes into a output file(a1.txt). I am using MS Visual C++ 2008 and in windows XP. currently i am using this method of writing to output file.. 01.ofstreamhdr OutputFile; 02./* few other stmts / 03.hdrOutputFile.open(fileName, std::ios::out); 04. 05.hdrOutputFile << "#include \"commondata.h\""<< endl ; 06.hdrOutputFile << "#include \"Commonconfig.h\"" << endl ; 07.hdrOutputFile << "#include \"commontable.h\"" << endl << endl ; 08. hdrOutputFile << "#pragma pack(push,1)" << endl ; 09.hdrOutputFile << "typedef struct \n {" << endl ; 10./ simliar hdrOutputFiles statements... */.. I have around 250 lines to write.. Is any better way to perform this task. I want to reduce this hdrOutputFile and use a buffer to do this. Please guide me how to do that action. I mean, buff = "#include \"commontable.h\"" + "typedef struct \n {" + ....... hdrOutputFile << buff. is this way possible? Thanks Ramm

    Read the article

  • Deployment a web-site on IIS from another program

    - by slo2ols
    Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

    Read the article

  • First Time Architecturing?

    - by cam
    I was recently given the task of rebuilding an existing RIA. The new RIA that I've designed is based on Silverlight, with a WCF service to connect to MS SQL Server. This is my first time doing something like this, so I'm not sure how to design the entire thing. Basically, the client can look through graphs of "stocks" (allowing the client to choose different time periods, settings, etc). I've written the whole application essentially, but I'm not sure how to put it together. The graphs are supposed to be directly based on the database, and to create the datapoints on the graph, some calculations need to be done (not very expensive ones). The problem I'm having is to decide where to put the calculations (client or serverside? Or half and half?) What factors should I look for to help me decide where the calculations should be done? And how can I go about optimizing this (caching, etc)? Obviously this is a very broad subject, so I'm not expecting an immediate answer, but any help/pointing in the right direction/resources would be appreciated.

    Read the article

  • How does PHP interface with Apache?

    - by Sbm007
    Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • What's the correct place to share application logic in CakePHP?

    - by Pichan
    I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

    Read the article

  • Application process never terminates on each run

    - by rockyurock
    I am seeing an application always remains live even after closing the application using my Perl script below. Also, for the subsequent runs, it always says that "The process cannot access the file because it is being used by another process. iperf.exe -u -s -p 5001 successful. Output was:" So every time I have to change the file name $file used in script or I have to kill the iperf.exe process in the Task Manager. Could anybody please let me know the way to get rid of it? Here is the code I am using ... my @command_output; eval { my $file = "abc6.txt"; $command = "iperf.exe -u -s -p 5001"; alarm 10; system("$command > $file"); alarm 0; close $file; }; if ($@) { warn "$command timed out.\n"; } else { print "$command successful. Output was:\n", $file; } unlink $file;

    Read the article

  • C++, Ifstream opens local file but not file on HTTP Server

    - by fammi
    Hi, I am using ifstream to open a file and then read from it. My program works fine when i give location of the local file on my system. for eg /root/Desktop/abc.xxx works fine But once the location is on the http server the file fails to open. for eg http://192.168.0.10/abc.xxx fails to open. Is there any alternate for ifstream when using a URL address? thanks. part of the code where having problem: bool readTillEof = (endIndex == -1) ? true : false; // Open the file in binary mode and seek to the end to determine file size ifstream file ( fileName.c_str ( ), ios::in|ios::ate|ios::binary ); if ( file.is_open ( ) ) { long size = (long) file.tellg ( ); long numBytesRead; if ( readTillEof ) { numBytesRead = size - startIndex; } else { numBytesRead = endIndex - startIndex + 1; } // Allocate a new buffer ptr to read in the file data BufferSptr buf (new Buffer ( numBytesRead ) ); mpStreamingClientEngine->SetResponseBuffer ( nextRequest, buf ); // Seek to the start index of the byte range // and read the data file.seekg ( startIndex, ios::beg ); file.read ( (char *)buf->GetData(), numBytesRead ); // Pass on the data to the SCE // and signal completion of request mpStreamingClientEngine->HandleDataReceived( nextRequest, numBytesRead); mpStreamingClientEngine->MarkRequestCompleted( nextRequest ); // Close the file file.close ( ); } else { // Report error to the Streaming Client Engine // as unable to open file AHS_ERROR ( ConnectionManager, " Error while opening file \"%s\"\n", fileName.c_str ( ) ); mpStreamingClientEngine->HandleRequestFailed( nextRequest, CONNECTION_FAILED ); } }

    Read the article

  • Avoiding repeated subqueries when 'WITH' is unavailable

    - by EloquentGeek
    MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

    Read the article

  • Remove php extension from URL on Windows hosting account using web.config

    - by asprin
    I've searched before asking this question. The answered ones were related to Linux hosting account and the ones with Windows hosting account didn't match what I was looking for. As you might have guessed, I've a Windows shared hosting account with godaddy. My aim was to remove the '.php' extension from the url. After researching I found that .htaccess would do exactly what I want. But I also found that .htaccess doesn't work in Windows environment and that I'll need a web.config file to do the same task. Now I know there are modules through which the code can be generated, but the problem is I don't know how to get them installed on my hosting account. I don't want to go through the process of contacting the people over at godaddy and hence I'm looking to solve this on my own. What I'm looking for is a web.config equivalent of .htaccess This is what I'm trying to achieve: Current URL : www.abcdef.com/contact.php Desired URL : www.abcdef.com/contact Any help would be greatly appreciated. Thanks, Nisar.

    Read the article

  • How do i find if an object is before or after a waypoint?

    - by BoMann Andersen
    Im working on a racing game for a school project. Using Visual studio 10 pro, and Irrlicht. Sorry for bad grammar ., and its my first question so not sure if its done right. How i want it to work is that i make waypoints at different points on the track, and then i run my waypoint check to see if a car is past its next waypoint (the next it "needs" to go past), if yes then it updates the next waypoint, else nothing. The way i hope this will work is, i make a vector from n to n+1, then find the vector that is perpendicular to the first vector at n. Then i see if the object is in front or behind that vector. I found a Gamedev.net forumpost that helped me make this function: void Engine::checkWaypoint(Vehicle* vehicle) { btVector3 vector = waypoints[vehicle->nextWaypoint]; // n btVector3 nextVector = waypoints[vehicle->nextWaypoint + 1]; // n+1 vector = nextVector - vector; // First vector btVector3 pos = btVector3(vehicle->position.X,vehicle->position.Y,vehicle->position.Z); float product = vector.dot(pos - waypoints[vehicle->nextWaypoint]); // positiv = before, negative = behind if(product < 0) vehicle->nextWaypoint += 1; } Current bugs with this is: Updates the nextwaypoint more then ones without going past a new point. When it gets to the end and resets, it stops triggering on the first waypoints. So my questions: Is this an good way to do this? Did i do it right?

    Read the article

  • File size monitoring in C#

    - by manemawanna
    Hello, I work in the Systems & admin team and have been given the task of creating a quota management application to try and encourage users to better manage there resources as we currently have issues with disc space and don't enforce hard quotas. At the moment I'm using the code below to go through all the files in a users homespace to retrieve the overall amount of space they are using. As from what I've seen else where theres no other way to do this in C#, the issue with it is theirs quite a high overhead while it retireves the size of each file then creates a total. try { long dirSize = 0; FileInfo[] FI = new DirectoryInfo("I:\\").GetFiles("*.*", SearchOption.AllDirectories); foreach (FileInfo F1 in FI) { dirSize += F1.Length; } return dirSize; } So I'm looking for a quicker way to do this or a quick way to monitor changes in the size of files while using the options avaliable through FileSystemWatcher. At the moment the only thing I can think of is creating a hashtable containing the file location and size of each file, so when a size changed event occurs I can compare the old size against the new one and update the total. Any suggestions would be greatly appreciated.

    Read the article

  • MySQL PHP | "SELECT FROM table" using "alphanumeric"-UUID. Speed vs. Indexed Integer / Indexed Char

    - by dropson
    At the moment, I select rows from 'table01' using: SELECT * FROM table01 WHERE UUID = 'whatever'; The UUID column is a unique index. I know this isn't the fastest way to select data from the database, but the UUID is the only row-identifier that is available to the front-end. Since I have to select by UUID, and not ID, I need to know what of these two options I should go for, if say the table consists of 100'000 rows. What speed differences would I look at, and would the index for the UUID grow to large, and lag the DB? Get the ID before doing the "big" select 1. $id = "SELECT ID FROM table01 WHERE UUID = '{alphanumeric character}'"; 2. $rows = SELECT * FROM table01 WHERE ID = $id; Or keep it the way it is now, using the UUID. 1. SELECT FROM table01 WHERE UUID '{alphanumeric character}'; Side note: All new rows are created by checking if the system generated uniqueid exists before trying to insert a new row. Keeping the column always unique. The "example" table. CREATE TABLE Table01 ( ID int NOT NULL PRIMARY KEY, UUID char(15), name varchar(100), url varchar(255), `date` datetime ) ENGINE = InnoDB; CREATE UNIQUE INDEX UUID ON Table01 (UUID);

    Read the article

  • Assigning Object to View, big MySQL resultset.

    - by A Finn
    Hello (Sorry for my bad English) Is it bad practice to assign object to view and call its methods in there? I use smarty as my template engine. In my controller I could do like this 1# $this->view->assign("name", $this->model->getName); and in my view <p>{$name}</p> OR 2# $this->view->assign("Object", $this->model); and in my view <p>{$Report->getName()}</p> Well my biggest problem is that I have to handle a big amount of data coming out from the MySQL and I thought that if I would made a method that would print out the data while looping mysql_fetch_row. Well at least I know that using html-tags in the model is a bad thing to do. So I would assign the object to the view to get the result to the right position on the page.. Reading a mysql-result to an array first may cause memory problems am I right? So what is the solution doing things MVC style.. And yes Im using a framework of my own.

    Read the article

  • crash when using stl vector at instead of operator[]

    - by Jamie Cook
    I have a method as follows (from a class than implements TBB task interface - not currently multithreading though) My problem is that two ways of accessing a vector are causing quite different behaviour - one works and the other causes the entire program to bomb out quite spectacularly (this is a plugin and normally a crash will be caught by the host - but this one takes out the host program as well! As I said quite spectacular) void PtBranchAndBoundIterationOriginRunner::runOrigin(int origin, int time) const // NOTE: const method { BOOST_FOREACH(int accessMode, m_props->GetAccessModes()) { // get a const reference to appropriate vector from member variable // map<int, vector<double>> m_rowTotalsByAccessMode; const vector<double>& rowTotalsForAccessMode = m_rowTotalsByAccessMode.find(accessMode)->second; if (origin != 129) continue; // Additional debug constrain: I know that the vector only has one non-zero element at index 129 m_job->Write("size: " + ToString(rowTotalsForAccessMode.size())); try { // check for early return... i.e. nothing to do for this origin if (!rowTotalsForAccessMode[origin]) continue; // <- this works if (!rowTotalsForAccessMode.at(origin)) continue; // <- this crashes } catch (...) { m_job->Write("Caught an exception"); // but its not an exception } // do some other stuff } } I hate not putting in well defined questions but at the moment my best phrasing is : "WTF?" I'm compiling this with Intel C++ 11.0.074 [IA-32] using Microsoft (R) Visual Studio Version 9.0.21022.8 and my implementation of vector has const_reference operator[](size_type _Pos) const { // subscript nonmutable sequence #if _HAS_ITERATOR_DEBUGGING if (size() <= _Pos) { _DEBUG_ERROR("vector subscript out of range"); _SCL_SECURE_OUT_OF_RANGE; } #endif /* _HAS_ITERATOR_DEBUGGING */ _SCL_SECURE_VALIDATE_RANGE(_Pos < size()); return (*(_Myfirst + _Pos)); } (Iterator debugging is off - I'm pretty sure) and const_reference at(size_type _Pos) const { // subscript nonmutable sequence with checking if (size() <= _Pos) _Xran(); return (*(begin() + _Pos)); } So the only difference I can see is that at calls begin instead of simply using _Myfirst - but how could that possibly be causing such a huge difference in behaviour?

    Read the article

  • C++ AMP, for loops to parallel_for_each loop

    - by user1430335
    I'm converting an algorithm to make use of the massive acceleration that C++ AMP provides. The stage I'm at is putting the for loops into the known parallel_for_each loop. Normally this should be a straightforward task to do but it appears more complex then I first thought. It's a nested loop which I increment using steps of 4 per iterations: for(int j = 0; j < height; j += 4, data += width * 4 * 4) { for(int i = 0; i < width; i += 4) { The trouble I'm having is the use of the index. I can't seem to find a way to properly fit this into the parallel_for_each loop. Using an index of rank 2 is the way to go but manipulating it via branching will do harm to the performance gain. I found a similar post: Controlling the index variables in C++ AMP. It also deals about index manipulation but the increment aspect doesn't cover my issue. With kind regards, Forcecast

    Read the article

  • Asp.Net MVC3 - How create Dynamic DropDownList

    - by Bibo
    I found many articles on this but still I don´t know how exactly to do this. I am trying to create my own blog engine, I have View for create article (I am using EF and Code first) and now I must fill number of category in which article should be add but I want to change it to dropdownlist with names of categories. My model looks this: public class Article { public int ArticleID { get; set; } [Required] public string Title { get; set; } [Required] public int CategoryID { get; set; } public DateTime Date { get; set; } [Required()] [DataType(DataType.MultilineText)] [AllowHtml] public string Text { get; set; } public virtual Category Category { get; set; } public IEnumerable<SelectListItem> Categories { get; set; } public virtual ICollection<Comment> Comments { get; set; } } public class Category { public int CategoryID { get; set; } [Required] public string Name { get; set; } public virtual ICollection<Article> Articles { get; set; } } I know I must use Enum (or I think) but I am not exactly sure how. I don´t know which tutorial from that I found is best for me.

    Read the article

  • PHP Object Creation and Memory Usage

    - by JohnO
    A basic dummy class: class foo { var $bar = 0; function foo() {} function boo() {} } echo memory_get_usage(); echo "\n"; $foo = new foo(); echo memory_get_usage(); echo "\n"; unset($foo); echo memory_get_usage(); echo "\n"; $foo = null; echo memory_get_usage(); echo "\n"; Outputs: $ php test.php 353672 353792 353792 353792 Now, I know that PHP docs say that memory won't be freed until it is needed (hitting the ceiling). However, I wrote this up as a small test, because I've got a much longer task, using a much bigger object, with many instances of that object. And the memory just climbs, eventually running out and stopping execution. Even though these large objects do take up memory, since I destroy them after I'm done with each one (serially), it should not run out of memory (unless a single object exhausts the entire space for memory, which is not the case). Thoughts?

    Read the article

  • Now that I have solved AI and am preparing to take over the world, what should I do?

    - by Zak
    Well, I did it.. yup, solved AI. I thought the voice of my fledgling life form would be booming and computery, and I would call it HAL.. But in reality, it sounds like a small japanese girl. I believe I will name "her" Koro . Koro is already asking me what her first task should be. I have asked her to help eradicate her namesake, as we are losing a lot of productivity due to fear of penile disappearance. http://en.wikipedia.org/wiki/Koro_%28medicine%29 Having a young japanese girl personality, I believe she will have no problem with delivering lots of penis growth to asian men. However, some of my fellow AI researchers have warned me that if I go down this path, China may take over the world, as Koro is the only thing holding them back from completely dominating the rest of the world economically. After all, look at what China is doing just making our silverware and toasters... The entire US industrial metal production is gone because toaster factories moved to China! So you good patrons of SO... who have soldiered on with me through so many other programming related questions... I ask you this now... How can Koro help the world without letting small asian men with no fear of losing their peni take over the world?

    Read the article

  • Is there a more memory efficient way to search through a Core Data database?

    - by Kristian K
    I need to see if an object that I have obtained from a CSV file with a unique identifier exists in my Core Data Database, and this is the code I deemed suitable for this task: NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; NSEntityDescription *entity; entity = [NSEntityDescription entityForName:@"ICD9" inManagedObjectContext:passedContext]; [fetchRequest setEntity:entity]; NSPredicate *pred = [NSPredicate predicateWithFormat:@"uniqueID like %@", uniqueIdentifier]; [fetchRequest setPredicate:pred]; NSError *err; NSArray* icd9s = [passedContext executeFetchRequest:fetchRequest error:&err]; [fetchRequest release]; if ([icd9s count] > 0) { for (int i = 0; i < [icd9s count]; i++) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc]init]; NSString *name = [[icd9s objectAtIndex:i] valueForKey:@"uniqueID"]; if ([name caseInsensitiveCompare:uniqueIdentifier] == NSOrderedSame && name != nil) { [pool release]; return [icd9s objectAtIndex:i]; } [pool release]; } } return nil; After more thorough testing it appears that this code is responsible for a huge amount of leaking in the app I'm writing (it crashes on a 3GS before making it 20 percent through the 1459 items). I feel like this isn't the most efficient way to do this, any suggestions for a more memory efficient way? Thanks in advance!

    Read the article

< Previous Page | 590 591 592 593 594 595 596 597 598 599 600 601  | Next Page >