Search Results

Search found 16639 results on 666 pages for 'task engine'.

Page 592/666 | < Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >

  • CRM 2011 - Set/Retrieve work hours programmatically

    - by Philip Rich
    I am attempting to retrieve a resources work hours to perform some logic I require. I understand that the CRM scheduling engine is a little clunky around such things, but I assumed that I would be able to find out how the working hours were stored in the DB eventually... So a resource has associated calendars and those calendars have associated calendar rules and inner calendars etc. It is possible to look at the start/end and frequency of aforementioned calendar rules and query their codes to work out whether a resource is 'working' during a given period. However, I have not been able to find the actual working hours, the 9-5 shall we say in any field in the DB. I even tried some SQL profiling while I was creating a new schedule for a resource via the UI, but the results don't show any work hours passing to SQL. For those with the patience the intercepted SQL statement is below:- EXEC Sp_executesql N'update [CalendarRuleBase] set [ModifiedBy]=@ModifiedBy0, [EffectiveIntervalEnd]=@EffectiveIntervalEnd0, [Description]=@Description0, [ModifiedOn]=@ModifiedOn0, [GroupDesignator]=@GroupDesignator0, [IsSelected]=@IsSelected0, [InnerCalendarId]=@InnerCalendarId0, [TimeZoneCode]=@TimeZoneCode0, [CalendarId]=@CalendarId0, [IsVaried]=@IsVaried0, [Rank]=@Rank0, [ModifiedOnBehalfBy]=NULL, [Duration]=@Duration0, [StartTime]=@StartTime0, [Pattern]=@Pattern0 where ([CalendarRuleId] = @CalendarRuleId0)', N'@ModifiedBy0 uniqueidentifier,@EffectiveIntervalEnd0 datetime,@Description0 ntext,@ModifiedOn0 datetime,@GroupDesignator0 ntext,@IsSelected0 bit,@InnerCalendarId0 uniqueidentifier,@TimeZoneCode0 int,@CalendarId0 uniqueidentifier,@IsVaried0 bit,@Rank0 int,@Duration0 int,@StartTime0 datetime,@Pattern0 ntext,@CalendarRuleId0 uniqueidentifier', @ModifiedBy0='EB04662A-5B38-E111-9889-00155D79A113', @EffectiveIntervalEnd0='2012-01-13 00:00:00', @Description0=N'Weekly Single Rule', @ModifiedOn0='2012-03-12 16:02:08', @GroupDesignator0=N'FC5769FC-4DE9-445d-8F4E-6E9869E60857', @IsSelected0=1, @InnerCalendarId0='3C806E79-7A49-4E8D-B97E-5ED26700EB14', @TimeZoneCode0=85, @CalendarId0='E48B1ABF-329F-425F-85DA-3FFCBB77F885', @IsVaried0=0, @Rank0=2, @Duration0=1440, @StartTime0='2000-01-01 00:00:00', @Pattern0=N'FREQ=WEEKLY;INTERVAL=1;BYDAY=SU,MO,TU,WE,TH,FR,SA', @CalendarRuleId0='0A00DFCF-7D0A-4EE3-91B3-DADFCC33781D' The key parts in the statement are the setting of the pattern:- @Pattern0=N'FREQ=WEEKLY;INTERVAL=1;BYDAY=SU,MO,TU,WE,TH,FR,SA' However, as mentioned, no indication of the work hours set. Am I thinking about this incorrectly or is CRM doing something interesting around these work hours? Any thoughts greatly appreciated, thanks.

    Read the article

  • [C#] how to do Exception Handling & Tracing

    - by shrimpy
    Hi all, i am reading some C# books, and got some exercise don't know how to do, or not sure what does the question mean. Problem: After working for a company for some time, your skills as a knowledgeable developer are recognized, and you are given the task of “policing” the implementation of exception handling and tracing in the source code (C#) for an enterprise application that is under constant incremental development. The two goals set by the product architect are: 100% of methods in the entire application must have at least a standard exception handler, using try/catch/finally blocks; more complex methods must also have additional exception handling for specific exceptions All control flow code can optionally write “tracing” information to assist in debugging and instrumentation of the application at run-time in situations where traditional debuggers are not available (eg. on staging and production servers). (i am not quite understand these criterias, i came from the java world, java has two kind of exception, check and unchecked exception. Developer must handle checked exception, and do logging. about unchecked exception, still do logging maybe, but most of the time we just throw it. however here comes to C#, what should i do????) Question for Problem: List rules you would create for the development team to follow, and the ways in which you would enforce rules, to achieve these goals. How would you go about ensuring that all existing code complies with the rules specified by the product architect; in particular, what considerations would impact your planning for the work to ensure all existing code complies?

    Read the article

  • Casting Type array to Generic array?

    - by George R
    The short version of the question - why can't I do this? I'm restricted to .NET 3.5. T[] genericArray; // Obviously T should be float! genericArray = new T[3]{ 1.0f, 2.0f, 0.0f }; // Can't do this either, why the hell not genericArray = new float[3]{ 1.0f, 2.0f, 0.0f }; Longer version - I'm working with the Unity engine here, although that's not important. What is - I'm trying to throw conversion between its fixed Vector2 (2 floats) and Vector3 (3 floats) and my generic Vector< class. I can't cast types directly to a generic array. using UnityEngine; public struct Vector { private readonly T[] _axes; #region Constructors public Vector(int axisCount) { this._axes = new T[axisCount]; } public Vector(T x, T y) { this._axes = new T[2] { x, y }; } public Vector(T x, T y, T z) { this._axes = new T[3]{x, y, z}; } public Vector(Vector2 vector2) { // This doesn't work this._axes = new T[2] { vector2.x, vector2.y }; } public Vector(Vector3 vector3) { // Nor does this this._axes = new T[3] { vector3.x, vector3.y, vector3.z }; } #endregion #region Properties public T this[int i] { get { return _axes[i]; } set { _axes[i] = value; } } public T X { get { return _axes[0];} set { _axes[0] = value; } } public T Y { get { return _axes[1]; } set { _axes[1] = value; } } public T Z { get { return this._axes.Length (Vector2 vector2) { Vector vector = new Vector(vector2); return vector; } public static explicit operator Vector(Vector3 vector3) { Vector vector = new Vector(vector3); return vector; } #endregion }

    Read the article

  • Oracle 10.1 and 11.2 produce different XML using the same statement

    - by MindFyer
    I am migrating a database from Oracle 10.1 to 11.2 and I have the following problem. The statement SELECT '<?xml version="1.0" encoding="utf-8" ?>' || (Xml).getClobVal() AS XmlClob FROM ( SELECT XmlElement( "Element1", ( SELECT XmlAgg(tpx.Xml) FROM ( SELECT XmlElement("Element3",XmlForest('content' as Element4)) AS Xml FROM dual ) tpx ) AS "Element2" ) AS Xml FROM dual ) On the original 10.1 database produces XML like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element2> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element2> </Element1> On the new 11.2 system it looks like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element1> Is there some environmental variable I am missing that tells Oracle how to format its XML. There are hundreds of thousands of lines of PL/SQL in the database; it would be a mammoth task to rewrite if it turned out they had changed they way Oracle formats XML between versions. Hopefully someone has come accross this before. Thanks

    Read the article

  • Get active window title in X

    - by dutt
    I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

    Read the article

  • Extending / changing how Zend_Search_Lucene searches

    - by Grant Collins
    Hi, I am currently using Zend_Search_Lucene to index and search a number of documents currently at around a 1000 or so. What I would like to do is change how the engine scores hits on a document, from the current default. Zend_Search_Lucene scores on the frequency of number of hits within a document, so a document that has 10 matches of the word PHP will score higher than a document with only 3 matches of PHP. What I am trying to do is pass a number of key words and score depending on the hits of those keywords. e.g. I pass 5 key words say,PHP, MySQL, Javascript, HTML and CSS that I search against the index. One document has 3 matches to those key words and one document has all 4 matches, the 4 matches scores the highest. The number of instances of those words in the document do not concern me. Now I've had a quick look at Zend_Search_Lucene_Search_Similarity however I have to confess that I am not sure (or that bright) to know how to use this to achieve what I am after. Is what I want to do possible using Lucene or is there a better solution out there?

    Read the article

  • What Test Environment Setup do Top Project Committers Use in the Ruby Community?

    - by viatropos
    Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

    Read the article

  • Durandal Google Maps not showing properly

    - by user1891037
    Trying to show Google Maps using the Durandal. I'm now simply working with Durandal HTML Starter Kit so the other modules and all engine works properly. The thing is when I added the Google Map it doesn't fit the div size (the big part of div is just grey). As I understand, the problem is causing because Google Maps added before page is completely loaded. But I can't figure out how can I hook on page load event. Here is the module code: define(['knockout', 'gmaps'], function (ko, gmaps) { return { displayName: 'Google Maps', myMap: ko.observable({ lat: ko.observable(32), lng: ko.observable(10)}), activate: function () { console.log('activate'); ko.bindingHandlers.map = { init: function (element, valueAccessor, allBindingsAccessor, viewModel) { console.log('init'); var mapObj = ko.utils.unwrapObservable(valueAccessor()); var latLng = new gmaps.LatLng( ko.utils.unwrapObservable(mapObj.lat), ko.utils.unwrapObservable(mapObj.lng)); var mapOptions = { center: latLng, zoom: 5, mapTypeId: gmaps.MapTypeId.ROADMAP}; mapObj.googleMap = new gmaps.Map(element, mapOptions); } } }, attached: function() { console.log('attached'); }, compositionComplete: function() { console.log('compositionComplete'); } }; }); And a very simple HTML code: <section> <div id="gmap-canvas" data-bind="map:myMap"></div> </section> I'm loading Google Maps with async plug-in in my shell.js. It works fine. Screenshot with trouble here - http://clip2net.com/s/ibswAa P.S. div size is defined in .CSS file. P.S. I tried to use getElementById approach provided here and it's work great if placed in compositionComplete block. But when I tried to move my bindings to this block nothing happens at all. Thanks!

    Read the article

  • do the Python libraries have a natural dependence on the global namespace?

    - by msw
    I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

    Read the article

  • Is there a more efficient way to do this?

    - by garethdn
    I'm hoping there is a better way to the following. I'm creating a jigsaw-type application and this is the current code i'm using: -(void) touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; //location of current touch CGPoint location = [touch locationInView:self.view]; if ([touch view] == img1) { [self animateFirstTouch:img1 withLocation:location]; } else if ([touch view] == img2) { [self animateFirstTouch:img2 withLocation:location]; } else if ([touch view] == img3) { [self animateFirstTouch:img3 withLocation:location]; } else if ([touch view] == img4) { [self animateFirstTouch:img4 withLocation:location]; } else if { ...... ...... } else if ([touch view] == img40) { [self animateFirstTouch:img40 withLocation:location]; return; } } I'm hoping that there is a better, more efficieny way to do this, rather than naming every image. I'm thinking something like, if touch view is equal to a UIImageView, then perform some task. The same for touchesEnded: -(void) touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; //location of current touch CGPoint location = [touch locationInView:self.view]; if ([touch view] == image1) { [self animateReleaseTouch:image1 withLocation:location]; } else if ([touch view] == image2) { [self animateReleaseTouch:image2 withLocation:location]; } else if ([touch view] == image3) { [self animateReleaseTouch:image3 withLocation:location]; } else if ([touch view] == image4) { [self animateReleaseTouch:image4 withLocation:location]; } else if{ ...... ...... } else if ([touch view] == image40) { [self animateReleaseTouch:image40 withLocation:location]; } return; } Any help please?

    Read the article

  • MACRO compilation PROBLEM

    - by wildfly
    i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

    Read the article

  • The application has stopped unexpectedly: How to Debug?

    - by Android Eve
    Please note, unlike many other questions having the subject title "application has stopped unexpectedly", I am not asking for troubleshooting a particular problem. Rather, I am asking for an outline of the best strategy for an Android/Eclipse/Java rookie to tackle this formidable task of digesting huge amounts of information in order to develop (and debug!) a simple Android application. In my case, I took the sample skeleton app from the SDK, modified it slightly and what did I get the moment I try to run it? The application (process.com.example.android.skeletonapp) has stopped unexpectedly. Please try again. OK, so I know that I have to look LogCat. It's full of timestamped lines staring at me... What do I do now? What do I need to look for? Is there a way to single-step the program, to find the statement that makes the app crash? (I thought Java programs never crash, but apparently I was mistaken) How do I place a breakpoint? Can you recommend an Android debug tutorial online, other than this one?

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • Now that I have solved AI and am preparing to take over the world, what should I do?

    - by Zak
    Well, I did it.. yup, solved AI. I thought the voice of my fledgling life form would be booming and computery, and I would call it HAL.. But in reality, it sounds like a small japanese girl. I believe I will name "her" Koro . Koro is already asking me what her first task should be. I have asked her to help eradicate her namesake, as we are losing a lot of productivity due to fear of penile disappearance. http://en.wikipedia.org/wiki/Koro_%28medicine%29 Having a young japanese girl personality, I believe she will have no problem with delivering lots of penis growth to asian men. However, some of my fellow AI researchers have warned me that if I go down this path, China may take over the world, as Koro is the only thing holding them back from completely dominating the rest of the world economically. After all, look at what China is doing just making our silverware and toasters... The entire US industrial metal production is gone because toaster factories moved to China! So you good patrons of SO... who have soldiered on with me through so many other programming related questions... I ask you this now... How can Koro help the world without letting small asian men with no fear of losing their peni take over the world?

    Read the article

  • Uncommitted reads in SSIS

    - by OldBoy
    I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

    Read the article

  • What's the correct place to share application logic in CakePHP?

    - by Pichan
    I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

    Read the article

  • Avoiding repeated subqueries when 'WITH' is unavailable

    - by EloquentGeek
    MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

    Read the article

  • Vim: change formatting of variables in a script

    - by sixtyfootersdude
    I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

    Read the article

  • How to understand existing projects

    - by John
    Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

    Read the article

  • Why does this log output show the same answer in each iteration?

    - by Will Hancock
    OK, I was reading an article on optimising JS for Googles V8 engine, when i saw this code example... I nearly skimmed over it, but then I saw this; |=; a[0] |= b; a = new Array(); a[0] = 0; for (var b = 0; b < 10; b++) { console.log(a, b) a[0] |= b; // Much better! 2x faster. } a[0] |= b; So I ran it, in my console, with a console.log in the loop and resulted in 15; [15] 0 [15] 1 [15] 2 [15] 3 [15] 4 [15] 5 [15] 6 [15] 7 [15] 8 [15] 9 WHAT?!?! Where the hell does it get 15 from, on every iteration?!?!?! I've been a web dev for 7 years, and this has stumped me and a fellow colleague. Can somebody talk me through this code? Cheers.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • PHP Object Creation and Memory Usage

    - by JohnO
    A basic dummy class: class foo { var $bar = 0; function foo() {} function boo() {} } echo memory_get_usage(); echo "\n"; $foo = new foo(); echo memory_get_usage(); echo "\n"; unset($foo); echo memory_get_usage(); echo "\n"; $foo = null; echo memory_get_usage(); echo "\n"; Outputs: $ php test.php 353672 353792 353792 353792 Now, I know that PHP docs say that memory won't be freed until it is needed (hitting the ceiling). However, I wrote this up as a small test, because I've got a much longer task, using a much bigger object, with many instances of that object. And the memory just climbs, eventually running out and stopping execution. Even though these large objects do take up memory, since I destroy them after I'm done with each one (serially), it should not run out of memory (unless a single object exhausts the entire space for memory, which is not the case). Thoughts?

    Read the article

  • Re-usable Obj-C classes with custom values: The right way

    - by Prairiedogg
    I'm trying to reuse a group of Obj-C clases between iPhone applications. The values that differ from app to app have been isolated and I'm trying to figure out the best way to apply these custom values to the classes on an app-to-app basis. Should I hold them in code? // I might have 10 customizable values for each class, that's a long signature! CarController *controller = [[CarController alloc] initWithFontName:@"Vroom" engine:@"Diesel" color:@"Red" number:11]; Should I store them in a big settings.plist? // Wasteful! I sometimes only use 2-3 of 50 settings! AllMyAppSettings *settings = [[AllMyAppSettings alloc] initFromDisk:@"settings.plist"]; MyCustomController *controller = [[MyCustomController alloc] initWithSettings:settings]; [settings release]; Should I have little, optional n_settings.plists for each class? // Sometimes I customize CarControllerSettings *carSettings = [[CarControllerSettings alloc] initFromDisk:@"car_settings.plist"]; CarController *controller = [[CarController alloc] initWithSettings:carSettings]; [carSettings release]; // Sometimes I don't, and CarController falls back to internally stored, reasonable defaults. CarController *controller = [[CarController alloc] initWithSettings:nil]; Or is there an OO solution that I'm not thinking of at all that would be better?

    Read the article

  • How does PHP interface with Apache?

    - by Sbm007
    Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

    Read the article

  • Effective communication in a component-based system

    - by Tesserex
    Yes, this is another question about my game engine, which is coming along very nicely, with much thanks to you guys. So, if you watched the video (or didn't), the objects in the game are composed of various components for things like position, sprites, movement, collision, sounds, health, etc. I have several message types defined for "tell" type communication between entities and components, but this only goes so far. There are plenty of times when I just need to ask for something, for example an entity's position. There are dozens of lines in my code that look like this: SomeComponent comp = (SomeComponent)entity.GetComponent(typeof(SomeComponent)); if (comp != null) comp.GetSomething(); I know this is very ugly, and I know that casting smells of improper OO design. But as complex as things are, there doesn't seem to be a better way. I could of course "hard-code" my component types and just have SomeComponent comp = entity.GetSomeComponent(); but that seems like a cop-out, and a bad one. I literally JUST REALIZED, while writing this, after having my code this way for months with no solution, that a generic will help me. SomeComponent comp = entity.GetComponent<SomeComponent>(); Amazing how that works. Anyway, this is still only a semantic improvement. My questions remain. Is this actually that bad? What's a better alternative?

    Read the article

< Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >