Search Results

Search found 16639 results on 666 pages for 'task engine'.

Page 592/666 | < Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >

  • How to handle Win+Shift+LEft/Right on Win7 with custom WM_GETMINMAXINFO logic?

    - by Steven Robbins
    I have a custom windows implementation in a WPF app that hooks WM_GETMINMAXINFO as follows: private void MaximiseWithTaskbar(System.IntPtr hwnd, System.IntPtr lParam) { MINMAXINFO mmi = (MINMAXINFO)Marshal.PtrToStructure(lParam, typeof(MINMAXINFO)); System.IntPtr monitor = MonitorFromWindow(hwnd, MONITOR_DEFAULTTONEAREST); if (monitor != System.IntPtr.Zero) { MONITORINFO monitorInfo = new MONITORINFO(); GetMonitorInfo(monitor, monitorInfo); RECT rcWorkArea = monitorInfo.rcWork; RECT rcMonitorArea = monitorInfo.rcMonitor; mmi.ptMaxPosition.x = Math.Abs(rcWorkArea.left - rcMonitorArea.left); mmi.ptMaxPosition.y = Math.Abs(rcWorkArea.top - rcMonitorArea.top); mmi.ptMaxSize.x = Math.Abs(rcWorkArea.right - rcWorkArea.left); mmi.ptMaxSize.y = Math.Abs(rcWorkArea.bottom - rcWorkArea.top); mmi.ptMinTrackSize.x = Convert.ToInt16(this.MinWidth * (desktopDpiX / 96)); mmi.ptMinTrackSize.y = Convert.ToInt16(this.MinHeight * (desktopDpiY / 96)); } Marshal.StructureToPtr(mmi, lParam, true); } It all works a treat and it allows me to have a borderless window maximized without having it sit on to of the task bar, which is great, but it really doesn't like being moved between monitors with the new Win7 keyboard shortcuts. Whenever the app is moved with Win+Shift+Left/Right the WM_GETMINMAXINFO message is received, as I'd expect, but MonitorFromWindow(hwnd, MONITOR_DEFAULTTONEAREST) returns the monitor the application has just been moved FROM, rather than the monitor it is moving TO, so if the monitors are of differing resolutions the window end up the wrong size. I'm not sure if there's something else I can call, other then MonitorFromWindow, or whether there's a "moving monitors" message I can hook prior to WM_GETMINMAXINFO. I'm assuming there is a way to do it because "normal" windows work just fine.

    Read the article

  • Can't store UTF-8 in RDS despite setting up new Parameter Group using Rails on Heroku

    - by Lail
    I'm setting up a new instance of a Rails(2.3.5) app on Heroku using Amazon RDS as the database. I'd like to use UTF-8 for everything. Since RDS isn't UTF-8 by default, I set up a new Parameter Group and switched the database to use that one, basically per this. Seems to have worked: SHOW VARIABLES LIKE '%character%'; character_set_client utf8 character_set_connection utf8 character_set_database utf8 character_set_filesystem binary character_set_results utf8 character_set_server utf8 character_set_system utf8 character_sets_dir /rdsdbbin/mysql-5.1.50.R3/share/mysql/charsets/ Furthermore, I've successfully setup Heroku to use the RDS database. After rake db:migrate, everything looks good: CREATE TABLE `comments` ( `id` int(11) NOT NULL AUTO_INCREMENT, `commentable_id` int(11) DEFAULT NULL, `parent_id` int(11) DEFAULT NULL, `content` text COLLATE utf8_unicode_ci, `child_count` int(11) DEFAULT '0', `created_at` datetime DEFAULT NULL, `updated_at` datetime DEFAULT NULL, PRIMARY KEY (`id`), KEY `commentable_id` (`commentable_id`), KEY `index_comments_on_community_id` (`community_id`), KEY `parent_id` (`parent_id`) ) ENGINE=InnoDB AUTO_INCREMENT=4 DEFAULT CHARSET=utf8 COLLATE=utf8_unicode_ci; In the markup, I've included: <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> Also, I've set: production: encoding: utf8 collation: utf8_general_ci ...in the database.yml, though I'm not very confident that anything is being done to honor any of those settings in this case, as Heroku seems to be doing its own config when connecting to RDS. Now, I enter a comment through the form in the app: "Úbe® ƒåiL", but in the database I've got "Úbe® Æ’Ã¥iL" It looks fine when Rails loads it back out of the database and it is rendered to the page, so whatever it is doing one way, it's undoing the other way. If I look at the RDS database in Sequel Pro, it looks fine if I set the encoding to "UTF-8 Unicode via Latin 1". So it seems Latin-1 is sneaking in there somewhere. Somebody must have done this before, right? What am I missing?

    Read the article

  • Can one connection get details of another? Or, how can I get the most detailed pending transaction

    - by bob-the-destroyer
    Is there a Mysql statement which provides full details of any other open connection or user? For this particular case, on myisam tables specifically. Looking at Mysql's SHOW TABLE STATUS documentation, it's missing some very important information for my purpose. For example: remote odbc connection one is inserting several thousand records, which due to a slow connection speed can take up to an hour. Tcp connection two, using PHP on the server's localhost, is running select queries with aggregate functions on that data. Before allowing connection two to run those queries, I'd like connection two to first check to make sure there's no pending inserts on any other connection on those specific tables so it can instead wait until all data is available. If the table is currently being written to, I'd like to spit back to the user of connection two an approximation of how much longer to wait based on the number of pending inserts. Ideally by table, I'd like to get back using a query the timestamp when connection one began the write, total inserts left to be done, and total inserts already completed. Instead of insert counts, even knowing number of bytes written and left to write would work just fine here. Obviously since connection two is a tcp connection via a PHP script, all I can really use in that script is some sort of query. I suppose if I have to, since it is on localhost, I can exec() it if the only way is by a mysql command line option that outputs this info, but I'd rather not. I suppose I could simply update a custom-made transaction log before and after this massive insert task which the PHP script can check, but hopefully there's already a built-in Mysql feature I can take advantage of.

    Read the article

  • Dynamic table memory usage

    - by Dan
    I use a dynamic table: <html> <body> <button id="button">Build table</button> <div id="container"> <script type="text/javascript"> window.onload=function(){ var table = null; var row = "<tr><td>111111111111111111111111111111111111111111111111111111</td>" + "<td>222222222222222222222222222222222222222222222222222222</td>" + "<td>333333333333333333333333333333333333333333333333333333</td></tr>"; var data = null; for (var i = 0; i < 2000; i++){ data += row; } var obj = document.getElementById("button"); obj.onclick=function buildTable(){ document.getElementById("container").innerHTML = "<div><table><tbody>" + data + "</tbody></table></div>"; }; }; </script> </body> </html> Using chromes task manager, each time new data is loaded the memory usage increases considerably and doesn't go down, so after some time the app consumes a lot of memory and requires the browser to be closed. Is there any change in the code I can use to solve this or is it a browser side problem?

    Read the article

  • Is there a recommended way to communicate scientific/engineering programming to C developers?

    - by ggkmath
    Hi, I have a lot of MATLAB code that needs to get ported to C (execution speed is critical for this work) as part of a back-end process for a web application. When I attempt to outsource this code to a C developer, I assume (correct me if I'm wrong) few C developers also understand MATLAB code (things like indexing and memory management are different, etc.). I wonder if there are any C developers out there that can recommend a procedure for me to follow to best communicate what the code does? For example, should I provide the MATLAB code and explain what it's doing line by line? Or, should I just provide the math/algorithm, explain it in plain English, and let the C developer implement it with this understanding in his/her own way (e.g. can I assume the developer understands how to work with complex math (i.e. imaginary numbers), how to generate histograms, perform an FFT, etc.)? Or, is there a better method? I expect I'm not the first to need to do this, so I wonder if any C developers out there ran into this situation and can share any conventional wisdom how they'd like this task to be transferred? Thanks in advance for any comments.

    Read the article

  • What about parallelism across network using multiple PCs?

    - by MainMa
    Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

    Read the article

  • Oracle 10.1 and 11.2 produce different XML using the same statement

    - by MindFyer
    I am migrating a database from Oracle 10.1 to 11.2 and I have the following problem. The statement SELECT '<?xml version="1.0" encoding="utf-8" ?>' || (Xml).getClobVal() AS XmlClob FROM ( SELECT XmlElement( "Element1", ( SELECT XmlAgg(tpx.Xml) FROM ( SELECT XmlElement("Element3",XmlForest('content' as Element4)) AS Xml FROM dual ) tpx ) AS "Element2" ) AS Xml FROM dual ) On the original 10.1 database produces XML like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element2> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element2> </Element1> On the new 11.2 system it looks like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element1> Is there some environmental variable I am missing that tells Oracle how to format its XML. There are hundreds of thousands of lines of PL/SQL in the database; it would be a mammoth task to rewrite if it turned out they had changed they way Oracle formats XML between versions. Hopefully someone has come accross this before. Thanks

    Read the article

  • Database choices

    - by flobadob
    I have a prickly design issue regarding the choice of database technologies to use for a group of new applications. The final suite of applications would have the following database requirements... Central databases (more than one database) using mysql (myst be mysql due to justhost.com). An application to be written which accesses the multiple mysql databases on the web host. This application will also write to local serverless database (sqlite/firebird/vistadb/whatever). Different flavors of this application will be created for windows (.NET), windows mobile, android if possible, iphone if possible. So, the design task is to minimise the quantity of code to achieve this. This is going to be tricky since the languages used are already c# / java (android) and objc (iphone). Not too worried about that, but can the work required to implement the various database access layers be minimised? The serverless database will hold similar data to the mysql server, so some kind of inheritance in the DAL would be useful. Looking at hibernate/nhibernate and there is linq to whatever. So many choices!

    Read the article

  • Hundreds of custom UserControls create thousands of USER Objects

    - by Andy Blackman
    I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

    Read the article

  • How to fix this simple SQL query?

    - by morpheous
    I have a database with three tables: user_table country_table city_table I want to write ANSI SQL which will allow me to fetch all the user data (i.e. user details including the name of the country of the last school and the name of the city they live in now). The problem I am having is that I have to use a self join, and I am getting slightly confused. The schema is shown below: CREATE TABLE user_table (id int, first_name varchar(16), last_school_country_id int, city_id int); CREATE TABLE country_table (id int, name varchar(32)); CREATE TABLE city_table (id int, country_id int, name varchar(32)); This is the query I have come up with so far, but the results are wrong, and sometimes, the db engine (mySQL), asks me if I want to show all [HUGE NUMBER HERE] results - which makes me suspect that I am unintentionally creating a cartesian product somewhere. Can someone explain what is wrong with this SQL statement, and what I need to do to fix it? SELECT usr.id AS id, usr.first_name, ctry1.name as loc_country_name, ctry2.name as school_country_name, city.name as loc_city_name FROM user_table usr, country_table ctry1, country_table ctry2, city_table city WHERE usr.last_school_country_id=ctry2.id AND usr.city_id=city.id AND city.country_id=ctry1.id AND ctry1.id=ctry2.id;

    Read the article

  • UML diagrams that are actually pretty?

    - by Borek
    I'm looking for a diagramming software that would produce good looking output. It doesn't need to support everything (or even much) from UML, is doesn't need to have code engineering functions or anything, it just needs to produce visually interesting output. Here is a couple of samples of products that I consider ugly / not good enough: Visio with default UML stencils (didn't find better looking ones), Enterprise Architect, Dia, ArgoUML and many other "professional" UML tools. A couple of visually compelling tools that I considered (but found issues with): Visual Studio class diagrams - just for .NET classes but the output is miles better than what UML tools typically produce NClass - similar to VS's class diagrams but I could not find the "pretty", blue skin anywhere yuml.me - very nice but lacking some advanced layout options. I have to say that I find their style almost ideal for high-level diagrams - they look sketchy which is good. Balsamiq - I think Joel used this for hginit.com and I liked it. However, it's not suited for creating software diagrams so I can imagine it would be quite a lot of work MS Word has actually quite a good graphics engine but I'd rather leave this as a choice of the last resort I'd be grateful for any good tips.

    Read the article

  • Compromising design & code quality to integrate with existing modules

    - by filip-fku
    Greetings! I inherited a C#.NET application I have been extending and improving for a while now. Overall it was obviously a rush-job (or whoever wrote it was seemingly less competent than myself). The app pulls some data from an embedded device & displays and manipulates it. At the core is a communications thread in the main application form which executes a 600+ lines of code method which calls functions all over the place, implementing a state machine - lots of if-state-then-do type code. Interaction with the device is done by setting the state/mode globally and letting the thread do it's thing. (This is just one example of the badness of the code - overall it is not very OO-like, it reminds of the style of embedded C code the device firmware is written in). My problem is that this piece of code is central to the application. The software, communications protocol or device firmware are not documented at all. Obviously to carry on with my work I have to interact with this code. What I would like some guidance on, is whether it is worth scrapping this code & trying to piece together something more reasonable from the information I can reverse engineer? I can't decide! The reason I don't want to refactor is because the code already works, and changing it will surely be a long, laborious and unpleasant task. On the flip side, not refactoring means I have to sometimes compromise the design of other modules so that I may call my code from this state machine! I've heard of "If it ain't broke don't fix it!", so I am wondering if it should apply when "it" is influencing the design of future code! Any advice would be appreciated! Thanks!

    Read the article

  • How to exclude tags folder from triggering build in Teamcity?

    - by Jaya mareedu
    Hello, I recently installed Teamcity 5.0.3. I am trying to setup automated build for a .NET 2.0 VS2005 project. I use NAnt and MSBuild task to perform the build. The project structure is a typical SVN structure svn://localhost/ITools is my repository and the project structure is VisualTrack trunk branches tags I created a new project in Teamcity and then created a build configuration for that project. I asked it to kick off a build everytime there is a change detected in SVN VisualTrack VCS. I also configured it to create a label in VisualTrack/tags for every successful build. The problem I am running into is that the build is getting trigerred everytime teamcity is creating a new label under tags. I only want the build to be triggered if some developer commits his or her changes into trunk. Next step I took was to create a build trigger rule to exclude the tags path by specifying a trigger pattern as -:VisualTrack/tags/**, but looks like its not working. I believe the pattern I specified is not correct. Can someone please help me resolve this issue? Thanks, Jaya.

    Read the article

  • Casting Type array to Generic array?

    - by George R
    The short version of the question - why can't I do this? I'm restricted to .NET 3.5. T[] genericArray; // Obviously T should be float! genericArray = new T[3]{ 1.0f, 2.0f, 0.0f }; // Can't do this either, why the hell not genericArray = new float[3]{ 1.0f, 2.0f, 0.0f }; Longer version - I'm working with the Unity engine here, although that's not important. What is - I'm trying to throw conversion between its fixed Vector2 (2 floats) and Vector3 (3 floats) and my generic Vector< class. I can't cast types directly to a generic array. using UnityEngine; public struct Vector { private readonly T[] _axes; #region Constructors public Vector(int axisCount) { this._axes = new T[axisCount]; } public Vector(T x, T y) { this._axes = new T[2] { x, y }; } public Vector(T x, T y, T z) { this._axes = new T[3]{x, y, z}; } public Vector(Vector2 vector2) { // This doesn't work this._axes = new T[2] { vector2.x, vector2.y }; } public Vector(Vector3 vector3) { // Nor does this this._axes = new T[3] { vector3.x, vector3.y, vector3.z }; } #endregion #region Properties public T this[int i] { get { return _axes[i]; } set { _axes[i] = value; } } public T X { get { return _axes[0];} set { _axes[0] = value; } } public T Y { get { return _axes[1]; } set { _axes[1] = value; } } public T Z { get { return this._axes.Length (Vector2 vector2) { Vector vector = new Vector(vector2); return vector; } public static explicit operator Vector(Vector3 vector3) { Vector vector = new Vector(vector3); return vector; } #endregion }

    Read the article

  • I need an IDE for typo3 core development in php

    - by Flugan
    Php in itself is difficult for IDEs because of the dynamic nature of the language. My current development environment is mostly netbeans against a local svn copy of the codebase setup in a local development webserver. The code is full text indexed by vistas search engine for almost instant searches. I do a lot of development directly against the main development server using a combination of tools. Putty to interact with the server and deploy by updating an svn checkout on the development server. Tortoise SVN locally to have a fairly rich SVN experience. Netbeans obviously have SVN integration. Most of the changes on the remote server is commited using the putty session. WinSCP to interact with the development server with norton commander like interface as well as the good putty integration. Finally my text editor for remote editing is notepad++ out of habit and because of some nice features and good price. What I'm really missing is good php editing. Because of the way typo3 works almost all objects are instanciated through make instance abstraction that either returns the base class or the customized class if the framework has been extended. I'm not looking for a magic editing package and would like to find an editor which can use annotations to specify the type of commonly used variables.

    Read the article

  • lapply slower than for-loop when used for a BiomaRt query. Is that expected?

    - by ptocquin
    I would like to query a database using BiomaRt package. I have loci and want to retrieve some related information, let say description. I first try to use lapply but was surprise by the time needed for the task to be performed. I thus tried a more basic for-loop and get a faster result. Is that expected or is something wrong with my code or with my understanding of apply ? I read other posts dealing with *apply vs for-loop performance (Here, for example) and I was aware that improved performance should not be expected but I don't understand why performance here is actually lower. Here is a reproducible example. 1) Loading the library and selecting the database : library("biomaRt") athaliana <- useMart("plants_mart_14") athaliana <- useDataset("athaliana_eg_gene",mart=athaliana) 2) Querying the database : loci <- c("at1g01300", "at1g01800", "at1g01900", "at1g02335", "at1g02790", "at1g03220", "at1g03230", "at1g04040", "at1g04110", "at1g05240" ) I create a function for the use in lapply : foo <- function(loci) { getBM("description","tair_locus",loci,athaliana) } When I use this function on the first element : > system.time(foo(cwp_loci[1])) utilisateur système écoulé 0.020 0.004 1.599 When I use lapply to retrieve the data for all values : > system.time(lapply(loci, foo)) utilisateur système écoulé 0.220 0.000 16.376 I then created a new function, adding a for-loop : foo2 <- function(loci) { for (i in loci) { getBM("description","tair_locus",loci[i],athaliana) } } Here is the result : > system.time(foo2(loci)) utilisateur système écoulé 0.204 0.004 10.919 Of course, this will be applied to a big list of loci, so the best performing option is needed. I thank you for assistance. EDIT Following recommendation of @MartinMorgan Simply passing the vector loci to getBM greatly improves the query efficiency. Simpler is better. > system.time(lapply(loci, foo)) utilisateur système écoulé 0.236 0.024 110.512 > system.time(foo2(loci)) utilisateur système écoulé 0.208 0.040 116.099 > system.time(foo(loci)) utilisateur système écoulé 0.028 0.000 6.193

    Read the article

  • Vim: change formatting of variables in a script

    - by sixtyfootersdude
    I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

    Read the article

  • How can I abstract out the core functionality of several Rails applications?

    - by hornairs
    I'd like to develop a number of non-trivial Rails applications which all implement a core set of functionality but each have certain particular customizations, extensions, and aesthetic differences. How can I pull the core functionality (models, controllers, helpers, support classes, tests) common to all these systems out in such a way that updating the core will benefit every application based upon it? I've seen Rails Engines but they seem to be too detached, almost too abstracted to be built upon. I can seem them being useful for adding one component to an existing app, for example bolting on a blog engine to your existing e-commerce site. Since engines seem to be mostly self contained, it seems difficult and inconvenient to override their functionality and views while keeping DRY. I've also considered abstracting the code into a gem, but this seems a little odd. Do I make the gem depend on the Rails gems, and the define models & controllers inside it, and then subclass them in my various applications? Or do I define many modules inside the gem that I include in the different spots inside my various applications? How do I test the gem and then test the set of customizations and overridden functionality on top of it? I'm also concerned with how I'll develop the gem and the Rails apps in tandem, can I vendor a git repository of the gem into the app and push from that so I don't have to build a new gem every iteration? Also, are there private gem hosts/can I set my own gem source up? Also, any general suggestions for this kind of undertaking? Abstraction paradigms to adhere to? Required reading? Comments from the wise who have done this before? Thanks!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • do the Python libraries have a natural dependence on the global namespace?

    - by msw
    I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

    Read the article

  • Continuous Flash music player while navigating site

    - by phx-zs
    I have a site that includes a Flash music player integrated into the layout. I want users to be able to navigate around the site without interrupting the music. I've done plenty of research and thinking and the following are the options I came up with (keeping in mind I want to be as SEO friendly as possible). Anyone have another idea? AJAX: I set up a version that changes the main content div to whatever nav link they click, thereby not interrupting the Flash player. I set it up in the proper search-engine-friendly manner with direct links and JQuery/Ajax functions. If someone goes to site.com/ and clicks the Contact nav link, it loads what's in the main content div on site.com/contact.php into the main content div and changes the URL bar to site.com/#Contact. The same goes for if they go to site.com/contact.php and click About in the nav, it loads the About content and changes the URL bar to site.com/contact.php#About. Obviously this opens up a whole new can of worms with AJAX and hash navigation/history issues, and I would end up with people possibly linking to things like site.com/contact.php#About (which I think looks terrible and can't be too great for SEO). Store the Flash player vars somewhere and reload them with the page: I'm not sure how to go about this, but I thought about keeping my regular navigation without AJAX and have it so when a user clicks a nav link, before it changes pages it stores the Flash player vars (current song and song position) somewhere, then loads them into Flash when the new page loads. Something with an iframe? Good alternative to a Flash player that will work for this type of application? Thanks!

    Read the article

  • Update table using SSIS

    - by thursdaysgeek
    I am trying to update a field in a table with data from another table, based on a common key. If it were in straight SQL, it would be something like: Update EHSIT set e.IDMSObjID = s.IDMSObjID from EHSIT e, EHSIDMS s where e.SITENUM = s.SITE_CODE However, the two tables are not in the same database, so I'm trying to use SSIS to do the update. Oh, and the sitenum/site_code are varchar in one and nvarchar in the other, so I'll have to do a data conversion so they'll match. How do I do it? I have a data flow object, with the source as EHSIDMS and the destination as EHSIT. I have a data conversion to convert the unicode to non-unicode. But how do I update based on the match? I've tried with the destination, using a SQL Command as the Data Access mode, but it doesn't appear to have the source table. If I just map the field to be updated, how does it limit it based on fields matching? I'm about to export my source table to Excel or something, and then try inputting from there, although it seems that all that would get me would be to remove the data conversion step. Shouldn't there be an update data task or something? Is it one of those Data Flow transformation tasks, and I'm just not figuring out which it is?

    Read the article

  • Image Resizing and Compression

    - by GSTAR
    Hi guys, I'm implementing an image upload facility for my website. The uploading facility is complete but what I'm working on at the moment is manipulating the images. For this task I am using PHPThumb (http://phpthumb.gxdlabs.com). Anyway as I go along I'm coming across potential issues, to do with resizing and compression. Basically I want to acheive the following results: The ideal image dimensions are: 800px width, 600px height. If an uploaded image exceeds either of these dimensions, it will need be resized to meet the requirements. Otherwise, leave as it is. The ideal file size is 200kb. If an uploaded image exceeds this then it will need to be compressed to meet this requirement. Otherwise, leave as it is. So in a nutshell: 1) Check the dimensions, resize if required. 2) Check the filesize, compress if required. Has anybody done anything like this / could you give me some pointers? Is PHPThumb the correct tool to do this in?

    Read the article

  • How to test a Grails Service that utilizes a criteria query (with spock)?

    - by user569825
    I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

    Read the article

< Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >