Search Results

Search found 16639 results on 666 pages for 'task engine'.

Page 592/666 | < Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >

• How does PHP interface with Apache?

  - by Sbm007

  Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

  Read the article

• do the Python libraries have a natural dependence on the global namespace?

  - by msw

  I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

  Read the article

• How to fix this simple SQL query?

  - by morpheous

  I have a database with three tables: user_table country_table city_table I want to write ANSI SQL which will allow me to fetch all the user data (i.e. user details including the name of the country of the last school and the name of the city they live in now). The problem I am having is that I have to use a self join, and I am getting slightly confused. The schema is shown below: CREATE TABLE user_table (id int, first_name varchar(16), last_school_country_id int, city_id int); CREATE TABLE country_table (id int, name varchar(32)); CREATE TABLE city_table (id int, country_id int, name varchar(32)); This is the query I have come up with so far, but the results are wrong, and sometimes, the db engine (mySQL), asks me if I want to show all [HUGE NUMBER HERE] results - which makes me suspect that I am unintentionally creating a cartesian product somewhere. Can someone explain what is wrong with this SQL statement, and what I need to do to fix it? SELECT usr.id AS id, usr.first_name, ctry1.name as loc_country_name, ctry2.name as school_country_name, city.name as loc_city_name FROM user_table usr, country_table ctry1, country_table ctry2, city_table city WHERE usr.last_school_country_id=ctry2.id AND usr.city_id=city.id AND city.country_id=ctry1.id AND ctry1.id=ctry2.id;

  Read the article

• is it possible to write a program which prints its own source code utilizing a "sequence-generating-

  - by guest

  is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

  Read the article

• SQL problem - select accross multiple tables (user groups)

  - by morpheous

  I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

  Read the article

• Casting Type array to Generic array?

  - by George R

  The short version of the question - why can't I do this? I'm restricted to .NET 3.5. T[] genericArray; // Obviously T should be float! genericArray = new T[3]{ 1.0f, 2.0f, 0.0f }; // Can't do this either, why the hell not genericArray = new float[3]{ 1.0f, 2.0f, 0.0f }; Longer version - I'm working with the Unity engine here, although that's not important. What is - I'm trying to throw conversion between its fixed Vector2 (2 floats) and Vector3 (3 floats) and my generic Vector< class. I can't cast types directly to a generic array. using UnityEngine; public struct Vector { private readonly T[] _axes; #region Constructors public Vector(int axisCount) { this._axes = new T[axisCount]; } public Vector(T x, T y) { this._axes = new T[2] { x, y }; } public Vector(T x, T y, T z) { this._axes = new T[3]{x, y, z}; } public Vector(Vector2 vector2) { // This doesn't work this._axes = new T[2] { vector2.x, vector2.y }; } public Vector(Vector3 vector3) { // Nor does this this._axes = new T[3] { vector3.x, vector3.y, vector3.z }; } #endregion #region Properties public T this[int i] { get { return _axes[i]; } set { _axes[i] = value; } } public T X { get { return _axes[0];} set { _axes[0] = value; } } public T Y { get { return _axes[1]; } set { _axes[1] = value; } } public T Z { get { return this._axes.Length (Vector2 vector2) { Vector vector = new Vector(vector2); return vector; } public static explicit operator Vector(Vector3 vector3) { Vector vector = new Vector(vector3); return vector; } #endregion }

  Read the article

• Database choices

  - by flobadob

  I have a prickly design issue regarding the choice of database technologies to use for a group of new applications. The final suite of applications would have the following database requirements... Central databases (more than one database) using mysql (myst be mysql due to justhost.com). An application to be written which accesses the multiple mysql databases on the web host. This application will also write to local serverless database (sqlite/firebird/vistadb/whatever). Different flavors of this application will be created for windows (.NET), windows mobile, android if possible, iphone if possible. So, the design task is to minimise the quantity of code to achieve this. This is going to be tricky since the languages used are already c# / java (android) and objc (iphone). Not too worried about that, but can the work required to implement the various database access layers be minimised? The serverless database will hold similar data to the mysql server, so some kind of inheritance in the DAL would be useful. Looking at hibernate/nhibernate and there is linq to whatever. So many choices!

  Read the article

• Pascals Triangle by recursion

  - by Olpers

  Note : My Class Teacher gave me this question as an assignment... I am not asked to do it but please tell me how to do it with recursion Binomial coefficients can be calculated using Pascal's triangle: 1 n = 0 1 1 1 2 1 1 3 3 1 1 4 6 4 1 n = 4 Each new level of the triangle has 1's on the ends; the interior numbers are the sums of the two numbers above them. Task: Write a program that includes a recursive function to produce a list of binomial coefficients for the power n using the Pascal's triangle technique. For example, Input = 2 Output = 1 2 1 Input = 4 Output = 1 4 6 4 1 done this So Far but tell me how to do this with recursion... #include<stdio.h> int main() { int length,i,j,k; //Accepting length from user printf("Enter the length of pascal's triangle : "); scanf("%d",&length); //Printing the pascal's triangle for(i=1;i<=length;i++) { for(j=1;j<=length-i;j++) printf(" "); for(k=1;k<i;k++) printf("%d",k); for(k=i;k>=1;k--) printf("%d",k); printf("\n"); } return 0; }

  Read the article

• Re-usable Obj-C classes with custom values: The right way

  - by Prairiedogg

  I'm trying to reuse a group of Obj-C clases between iPhone applications. The values that differ from app to app have been isolated and I'm trying to figure out the best way to apply these custom values to the classes on an app-to-app basis. Should I hold them in code? // I might have 10 customizable values for each class, that's a long signature! CarController *controller = [[CarController alloc] initWithFontName:@"Vroom" engine:@"Diesel" color:@"Red" number:11]; Should I store them in a big settings.plist? // Wasteful! I sometimes only use 2-3 of 50 settings! AllMyAppSettings *settings = [[AllMyAppSettings alloc] initFromDisk:@"settings.plist"]; MyCustomController *controller = [[MyCustomController alloc] initWithSettings:settings]; [settings release]; Should I have little, optional n_settings.plists for each class? // Sometimes I customize CarControllerSettings *carSettings = [[CarControllerSettings alloc] initFromDisk:@"car_settings.plist"]; CarController *controller = [[CarController alloc] initWithSettings:carSettings]; [carSettings release]; // Sometimes I don't, and CarController falls back to internally stored, reasonable defaults. CarController *controller = [[CarController alloc] initWithSettings:nil]; Or is there an OO solution that I'm not thinking of at all that would be better?

  Read the article

• Deployment a web-site on IIS from another program

  - by slo2ols

  Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

  Read the article

• Uncommitted reads in SSIS

  - by OldBoy

  I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

  Read the article

• How to understand existing projects

  - by John

  Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

  Read the article

• What about parallelism across network using multiple PCs?

  - by MainMa

  Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

  Read the article

• XSLT for-each from query results

  - by Ben Record

  I've been on a hunt for a while trying to find a solution to this but I cannot find anywhere that addresses this problem. I'm running a SQL query through XSLT which will return three rows. Here is the query: <query name="OrderedProductNames" rowElementName ="OrderedItem"> <sql> <![CDATA[ select OrderedProductName, Quantity from Orders_ShoppingCart where OrderNumber = 101689 // Hard coded order number for testing purposes. ]]> </sql> </query> Ideally, I would like to iterate through each row returned and do a choose when which is tested on a variable from the current row being inspected in the for-each loop, but I am not entirely sure thhis is possible. My secondary thought would be to use the for-each loop as a way to inject hidden HTML input elements with the values I would need, then I could write a javascript function to complete what I'm trying to do. Any suggestion on how I would go about completing either task would be greatly appreciated.

  Read the article

• Is there a more efficient way to do this?

  - by garethdn

  I'm hoping there is a better way to the following. I'm creating a jigsaw-type application and this is the current code i'm using: -(void) touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; //location of current touch CGPoint location = [touch locationInView:self.view]; if ([touch view] == img1) { [self animateFirstTouch:img1 withLocation:location]; } else if ([touch view] == img2) { [self animateFirstTouch:img2 withLocation:location]; } else if ([touch view] == img3) { [self animateFirstTouch:img3 withLocation:location]; } else if ([touch view] == img4) { [self animateFirstTouch:img4 withLocation:location]; } else if { ...... ...... } else if ([touch view] == img40) { [self animateFirstTouch:img40 withLocation:location]; return; } } I'm hoping that there is a better, more efficieny way to do this, rather than naming every image. I'm thinking something like, if touch view is equal to a UIImageView, then perform some task. The same for touchesEnded: -(void) touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; //location of current touch CGPoint location = [touch locationInView:self.view]; if ([touch view] == image1) { [self animateReleaseTouch:image1 withLocation:location]; } else if ([touch view] == image2) { [self animateReleaseTouch:image2 withLocation:location]; } else if ([touch view] == image3) { [self animateReleaseTouch:image3 withLocation:location]; } else if ([touch view] == image4) { [self animateReleaseTouch:image4 withLocation:location]; } else if{ ...... ...... } else if ([touch view] == image40) { [self animateReleaseTouch:image40 withLocation:location]; } return; } Any help please?

  Read the article

• Effective communication in a component-based system

  - by Tesserex

  Yes, this is another question about my game engine, which is coming along very nicely, with much thanks to you guys. So, if you watched the video (or didn't), the objects in the game are composed of various components for things like position, sprites, movement, collision, sounds, health, etc. I have several message types defined for "tell" type communication between entities and components, but this only goes so far. There are plenty of times when I just need to ask for something, for example an entity's position. There are dozens of lines in my code that look like this: SomeComponent comp = (SomeComponent)entity.GetComponent(typeof(SomeComponent)); if (comp != null) comp.GetSomething(); I know this is very ugly, and I know that casting smells of improper OO design. But as complex as things are, there doesn't seem to be a better way. I could of course "hard-code" my component types and just have SomeComponent comp = entity.GetSomeComponent(); but that seems like a cop-out, and a bad one. I literally JUST REALIZED, while writing this, after having my code this way for months with no solution, that a generic will help me. SomeComponent comp = entity.GetComponent<SomeComponent>(); Amazing how that works. Anyway, this is still only a semantic improvement. My questions remain. Is this actually that bad? What's a better alternative?

  Read the article

• Data structure to build and lookup set of integer ranges

  - by actual

  I have a set of uint32 integers, there may be millions of items in the set. 50-70% of them are consecutive, but in input stream they appear in unpredictable order. I need to: Compress this set into ranges to achieve space efficient representation. Already implemented this using trivial algorithm, since ranges computed only once speed is not important here. After this transformation number of resulting ranges is typically within 5 000-10 000, many of them are single-item, of course. Test membership of some integer, information about specific range in the set is not required. This one must be very fast -- O(1). Was thinking about minimal perfect hash functions, but they do not play well with ranges. Bitsets are very space inefficient. Other structures, like binary trees, has complexity of O(log n), worst thing with them that implementation make many conditional jumps and processor can not predict them well giving poor performance. Is there any data structure or algorithm specialized in integer ranges to solve this task?

  Read the article

• Durandal Google Maps not showing properly

  - by user1891037

  Trying to show Google Maps using the Durandal. I'm now simply working with Durandal HTML Starter Kit so the other modules and all engine works properly. The thing is when I added the Google Map it doesn't fit the div size (the big part of div is just grey). As I understand, the problem is causing because Google Maps added before page is completely loaded. But I can't figure out how can I hook on page load event. Here is the module code: define(['knockout', 'gmaps'], function (ko, gmaps) { return { displayName: 'Google Maps', myMap: ko.observable({ lat: ko.observable(32), lng: ko.observable(10)}), activate: function () { console.log('activate'); ko.bindingHandlers.map = { init: function (element, valueAccessor, allBindingsAccessor, viewModel) { console.log('init'); var mapObj = ko.utils.unwrapObservable(valueAccessor()); var latLng = new gmaps.LatLng( ko.utils.unwrapObservable(mapObj.lat), ko.utils.unwrapObservable(mapObj.lng)); var mapOptions = { center: latLng, zoom: 5, mapTypeId: gmaps.MapTypeId.ROADMAP}; mapObj.googleMap = new gmaps.Map(element, mapOptions); } } }, attached: function() { console.log('attached'); }, compositionComplete: function() { console.log('compositionComplete'); } }; }); And a very simple HTML code: <section> <div id="gmap-canvas" data-bind="map:myMap"></div> </section> I'm loading Google Maps with async plug-in in my shell.js. It works fine. Screenshot with trouble here - http://clip2net.com/s/ibswAa P.S. div size is defined in .CSS file. P.S. I tried to use getElementById approach provided here and it's work great if placed in compositionComplete block. But when I tried to move my bindings to this block nothing happens at all. Thanks!

  Read the article

• Web pages that a long time to load keep on reloading, just on vista on my work n/w...

  - by Ralpharama

  I have a curious problem at work which I've been struggling with since the advent of Windows Vista. We send our own email newsletter out to 40,000+ people once a week. The sending code has been in place for years, it's in classic ASP/VBscript called through a browser and simply loops through each email address, sending it to them. The page takes 40 mins or more to run, so has a big timeout value to allow it to do so. All well and good, suddenly, after Windows Vista is installed on the work PCs, the email sending page behaved oddly - after a period of time it seems to reload the page, endlessly, so the first 20% of our users get multiple copies of the newsletter until we kill the process! If we run the code on an XP machine in the on the same office network, it works fine. If we run it on Vista outside the office, so, say, on my own ISP, then it also works fine! Note, same effect in IE and FF... So, something about my office network and Vista is causing this... I recently re-wrote the newsletter code so it would split the task into chunks of 100 users at a time, hoping this would fix it, but my most recent test shows that the office n/w vista machine once again reloads the same page over any over, even though it takes 1/10th of the time to run... Does anyone have any ideas what it might be, how I can prove it, or, better, how I can get round it? Thanks for your advice :)

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Android opengl releasing textures

  - by user1642418

  I have a bit of a problem. I am developing a game for android + engine and I got stuck. I am getting OpenGL out of memory error and either app crashes or phone hangs after loading a scene multiple times. For example: app launches, shows main menu, 1st level/scene is loaded. Then I go back to main menu, and repeat. It doesnt matter which scene I load, after 4-6 times the error occurs. Some background: Each time when scene is loaded all the resources are released and upon first frame render - needed stuff gets loaded. The performance is more or less ok. Note that I am calling glDeleteTexture method, but I think its not doing its job and releasing memory. Thing is that -when I minimize and open it again - problem doesn't occur, but almost the same things are executed. Problem doesn't occur. This way android releases memory. How do I release/get rid of unused textures properly? This happens on HTC Desire HD ( ice cream sandwich 4.0.4) . Other games works fine, so I bet this is not the problem in ROM.

  Read the article

• Avoiding repeated subqueries when 'WITH' is unavailable

  - by EloquentGeek

  MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

  Read the article

• Vim: change formatting of variables in a script

  - by sixtyfootersdude

  I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

  Read the article

• How to amend return value design in OO manner?

  - by FrontierPsycho

  Hello. I am no newb on OO programming, but I am faced with a puzzling situation. I have been given a program to work on and extend, but the previous developers didn't seem that comfortable with OO, it seems they either had a C background or an unclear understanding of OO. Now, I don't suggest I am a better developer, I just think that I can spot some common OO errors. The difficult task is how to amend them. In my case, I see a lot of this: if (ret == 1) { out.print("yadda yadda"); } else if (ret == 2) { out.print("yadda yadda"); } else if (ret == 3) { out.print("yadda yadda"); } else if (ret == 0) { out.print("yadda yadda"); } else if (ret == 5) { out.print("yadda yadda"); } else if (ret == 6) { out.print("yadda yadda"); } else if (ret == 7) { out.print("yadda yadda"); } ret is a value returned by a function, in which all Exceptions are swallowed, and in the catch blocks, the above values are returned explicitly. Oftentimes, the Exceptions are simply swallowed, with empty catch blocks. It's obvious that swalllowing exceptions is wrong OO design. My question concerns the use of return values. I believe that too is wrong, however I think that using Exceptions for control flow is equally wrong, and I can't think of anything to replace the above in a correct, OO manner. Your input, please?

  Read the article

• Proper API Design for Version Independence?

  - by Justavian

  I've inherited an enormous .NET solution of about 200 projects. There are now some developers who wish to start adding their own components into our application, which will require that we begin exposing functionality via an API. The major problem with that, of course, is that the solution we've got on our hands contains such a spider web of dependencies that we have to be careful to avoid sabotaging the API every time there's a minor change somewhere in the app. We'd also like to be able to incrementally expose new functionality without destroying any previous third party apps. I have a way to solve this problem, but i'm not sure it's the ideal way - i was looking for other ideas. My plan would be to essentially have three dlls. APIServer_1_0.dll - this would be the dll with all of the dependencies. APIClient_1_0.dll - this would be the dll our developers would actual refer to. No references to any of the mess in our solution. APISupport_1_0.dll - this would contain the interfaces which would allow the client piece to dynamically load the "server" component and perform whatever functions are required. Both of the above dlls would depend upon this. It would be the only dll that the "client" piece refers to. I initially arrived at this design, because the way in which we do inter process communication between windows services is sort of similar (except that the client talks to the server via named pipes, rather than dynamically loading dlls). While i'm fairly certain i can make this work, i'm curious to know if there are better ways to accomplish the same task.

  Read the article

< Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >