Search Results

Search found 16639 results on 666 pages for 'task engine'.

Page 592/666 | < Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >

  • Hundreds of custom UserControls create thousands of USER Objects

    - by Andy Blackman
    I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

    Read the article

  • How to exclude tags folder from triggering build in Teamcity?

    - by Jaya mareedu
    Hello, I recently installed Teamcity 5.0.3. I am trying to setup automated build for a .NET 2.0 VS2005 project. I use NAnt and MSBuild task to perform the build. The project structure is a typical SVN structure svn://localhost/ITools is my repository and the project structure is VisualTrack trunk branches tags I created a new project in Teamcity and then created a build configuration for that project. I asked it to kick off a build everytime there is a change detected in SVN VisualTrack VCS. I also configured it to create a label in VisualTrack/tags for every successful build. The problem I am running into is that the build is getting trigerred everytime teamcity is creating a new label under tags. I only want the build to be triggered if some developer commits his or her changes into trunk. Next step I took was to create a build trigger rule to exclude the tags path by specifying a trigger pattern as -:VisualTrack/tags/**, but looks like its not working. I believe the pattern I specified is not correct. Can someone please help me resolve this issue? Thanks, Jaya.

    Read the article

  • How can I abstract out the core functionality of several Rails applications?

    - by hornairs
    I'd like to develop a number of non-trivial Rails applications which all implement a core set of functionality but each have certain particular customizations, extensions, and aesthetic differences. How can I pull the core functionality (models, controllers, helpers, support classes, tests) common to all these systems out in such a way that updating the core will benefit every application based upon it? I've seen Rails Engines but they seem to be too detached, almost too abstracted to be built upon. I can seem them being useful for adding one component to an existing app, for example bolting on a blog engine to your existing e-commerce site. Since engines seem to be mostly self contained, it seems difficult and inconvenient to override their functionality and views while keeping DRY. I've also considered abstracting the code into a gem, but this seems a little odd. Do I make the gem depend on the Rails gems, and the define models & controllers inside it, and then subclass them in my various applications? Or do I define many modules inside the gem that I include in the different spots inside my various applications? How do I test the gem and then test the set of customizations and overridden functionality on top of it? I'm also concerned with how I'll develop the gem and the Rails apps in tandem, can I vendor a git repository of the gem into the app and push from that so I don't have to build a new gem every iteration? Also, are there private gem hosts/can I set my own gem source up? Also, any general suggestions for this kind of undertaking? Abstraction paradigms to adhere to? Required reading? Comments from the wise who have done this before? Thanks!

    Read the article

  • Uncommitted reads in SSIS

    - by OldBoy
    I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • Is there a recommended way to communicate scientific/engineering programming to C developers?

    - by ggkmath
    Hi, I have a lot of MATLAB code that needs to get ported to C (execution speed is critical for this work) as part of a back-end process for a web application. When I attempt to outsource this code to a C developer, I assume (correct me if I'm wrong) few C developers also understand MATLAB code (things like indexing and memory management are different, etc.). I wonder if there are any C developers out there that can recommend a procedure for me to follow to best communicate what the code does? For example, should I provide the MATLAB code and explain what it's doing line by line? Or, should I just provide the math/algorithm, explain it in plain English, and let the C developer implement it with this understanding in his/her own way (e.g. can I assume the developer understands how to work with complex math (i.e. imaginary numbers), how to generate histograms, perform an FFT, etc.)? Or, is there a better method? I expect I'm not the first to need to do this, so I wonder if any C developers out there ran into this situation and can share any conventional wisdom how they'd like this task to be transferred? Thanks in advance for any comments.

    Read the article

  • Get active window title in X

    - by dutt
    I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

    Read the article

  • MACRO compilation PROBLEM

    - by wildfly
    i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

    Read the article

  • Database choices

    - by flobadob
    I have a prickly design issue regarding the choice of database technologies to use for a group of new applications. The final suite of applications would have the following database requirements... Central databases (more than one database) using mysql (myst be mysql due to justhost.com). An application to be written which accesses the multiple mysql databases on the web host. This application will also write to local serverless database (sqlite/firebird/vistadb/whatever). Different flavors of this application will be created for windows (.NET), windows mobile, android if possible, iphone if possible. So, the design task is to minimise the quantity of code to achieve this. This is going to be tricky since the languages used are already c# / java (android) and objc (iphone). Not too worried about that, but can the work required to implement the various database access layers be minimised? The serverless database will hold similar data to the mysql server, so some kind of inheritance in the DAL would be useful. Looking at hibernate/nhibernate and there is linq to whatever. So many choices!

    Read the article

  • Oracle 10.1 and 11.2 produce different XML using the same statement

    - by MindFyer
    I am migrating a database from Oracle 10.1 to 11.2 and I have the following problem. The statement SELECT '<?xml version="1.0" encoding="utf-8" ?>' || (Xml).getClobVal() AS XmlClob FROM ( SELECT XmlElement( "Element1", ( SELECT XmlAgg(tpx.Xml) FROM ( SELECT XmlElement("Element3",XmlForest('content' as Element4)) AS Xml FROM dual ) tpx ) AS "Element2" ) AS Xml FROM dual ) On the original 10.1 database produces XML like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element2> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element2> </Element1> On the new 11.2 system it looks like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element1> Is there some environmental variable I am missing that tells Oracle how to format its XML. There are hundreds of thousands of lines of PL/SQL in the database; it would be a mammoth task to rewrite if it turned out they had changed they way Oracle formats XML between versions. Hopefully someone has come accross this before. Thanks

    Read the article

  • PendingIntent in Widget + TaskKiller

    - by YaW
    Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

    Read the article

  • Casting Type array to Generic array?

    - by George R
    The short version of the question - why can't I do this? I'm restricted to .NET 3.5. T[] genericArray; // Obviously T should be float! genericArray = new T[3]{ 1.0f, 2.0f, 0.0f }; // Can't do this either, why the hell not genericArray = new float[3]{ 1.0f, 2.0f, 0.0f }; Longer version - I'm working with the Unity engine here, although that's not important. What is - I'm trying to throw conversion between its fixed Vector2 (2 floats) and Vector3 (3 floats) and my generic Vector< class. I can't cast types directly to a generic array. using UnityEngine; public struct Vector { private readonly T[] _axes; #region Constructors public Vector(int axisCount) { this._axes = new T[axisCount]; } public Vector(T x, T y) { this._axes = new T[2] { x, y }; } public Vector(T x, T y, T z) { this._axes = new T[3]{x, y, z}; } public Vector(Vector2 vector2) { // This doesn't work this._axes = new T[2] { vector2.x, vector2.y }; } public Vector(Vector3 vector3) { // Nor does this this._axes = new T[3] { vector3.x, vector3.y, vector3.z }; } #endregion #region Properties public T this[int i] { get { return _axes[i]; } set { _axes[i] = value; } } public T X { get { return _axes[0];} set { _axes[0] = value; } } public T Y { get { return _axes[1]; } set { _axes[1] = value; } } public T Z { get { return this._axes.Length (Vector2 vector2) { Vector vector = new Vector(vector2); return vector; } public static explicit operator Vector(Vector3 vector3) { Vector vector = new Vector(vector3); return vector; } #endregion }

    Read the article

  • [C#] how to do Exception Handling & Tracing

    - by shrimpy
    Hi all, i am reading some C# books, and got some exercise don't know how to do, or not sure what does the question mean. Problem: After working for a company for some time, your skills as a knowledgeable developer are recognized, and you are given the task of “policing” the implementation of exception handling and tracing in the source code (C#) for an enterprise application that is under constant incremental development. The two goals set by the product architect are: 100% of methods in the entire application must have at least a standard exception handler, using try/catch/finally blocks; more complex methods must also have additional exception handling for specific exceptions All control flow code can optionally write “tracing” information to assist in debugging and instrumentation of the application at run-time in situations where traditional debuggers are not available (eg. on staging and production servers). (i am not quite understand these criterias, i came from the java world, java has two kind of exception, check and unchecked exception. Developer must handle checked exception, and do logging. about unchecked exception, still do logging maybe, but most of the time we just throw it. however here comes to C#, what should i do????) Question for Problem: List rules you would create for the development team to follow, and the ways in which you would enforce rules, to achieve these goals. How would you go about ensuring that all existing code complies with the rules specified by the product architect; in particular, what considerations would impact your planning for the work to ensure all existing code complies?

    Read the article

  • do the Python libraries have a natural dependence on the global namespace?

    - by msw
    I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

    Read the article

  • What Test Environment Setup do Top Project Committers Use in the Ruby Community?

    - by viatropos
    Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

    Read the article

  • What about parallelism across network using multiple PCs?

    - by MainMa
    Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

    Read the article

  • Vim: change formatting of variables in a script

    - by sixtyfootersdude
    I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

    Read the article

  • Yeoman 'grunt test' fails on clean project with 'port already in use'

    - by XMLilley
    With: Mac OS 10.8.4 Node 0.10.12 npm 1.3.1 grunt-cli 0.1.9 yo 1.0.0-rc.1 bower 0.9.2 [email protected] I encounter the following error with a clean yo angular project, followed by grunt server then grunt test: Running "connect:test" (connect) task Fatal error: Port 9000 is already in use by another process. I'm new to Yeoman and am stumped. I've deleted my original project and created a new one in a fresh folder just to make sure I wasn't overlooking any invisible configs. I restarted the machine to make sure I wasn't running any temporary server processes I had forgotten about. After all attempts, the basic server starts fine, attaches to Chrome, and the watcher updates the browser on any changes. (Notably, the server is running on 9000, which seems odd for the test-runner to also be trying to use 9000.) But I get that same error on attempting to start the test runner. Is this something I can fix, or an issue I should report to the Yeoman team? Thanks.

    Read the article

  • Slow query. Wrong database structure?

    - by Tin
    I have a database with table that contains tasks. Tasks have a lifecycle. The status of the task's lifecycle can change. These state transitions are stored in a separate table tasktransitions. Now I wrote a query to find all open/reopened tasks and recently changed tasks but I already see with a rather small number of tasks (<1000) that execution time has becoming very long (0.5s). Tasks +-------------+---------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +-------------+---------+------+-----+---------+----------------+ | taskid | int(11) | NO | PRI | NULL | auto_increment | | description | text | NO | | NULL | | +-------------+---------+------+-----+---------+----------------+ Tasktransitions +------------------+-----------+------+-----+-------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+-----------+------+-----+-------------------+----------------+ | tasktransitionid | int(11) | NO | PRI | NULL | auto_increment | | taskid | int(11) | NO | MUL | NULL | | | status | int(11) | NO | MUL | NULL | | | description | text | NO | | NULL | | | userid | int(11) | NO | | NULL | | | transitiondate | timestamp | NO | | CURRENT_TIMESTAMP | | +------------------+-----------+------+-----+-------------------+----------------+ Query SELECT tasks.taskid,tasks.description,tasklaststatus.status FROM tasks LEFT OUTER JOIN ( SELECT tasktransitions.taskid,tasktransitions.transitiondate,tasktransitions.status FROM tasktransitions INNER JOIN ( SELECT taskid,MAX(transitiondate) AS lasttransitiondate FROM tasktransitions GROUP BY taskid ) AS tasklasttransition ON tasklasttransition.lasttransitiondate=tasktransitions.transitiondate AND tasklasttransition.taskid=tasktransitions.taskid ) AS tasklaststatus ON tasklaststatus.taskid=tasks.taskid WHERE tasklaststatus.status IS NULL OR tasklaststatus.status=0 or tasklaststatus.transitiondate>'2013-09-01'; I'm wondering if the database structure is best choice performance wise. Could adding indexes help? I already tried to add some but I don't see great improvements. +-----------------+------------+----------------+--------------+------------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | +-----------------+------------+----------------+--------------+------------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | tasktransitions | 0 | PRIMARY | 1 | tasktransitionid | A | 896 | NULL | NULL | | BTREE | | | | tasktransitions | 1 | taskid_date_ix | 1 | taskid | A | 896 | NULL | NULL | | BTREE | | | | tasktransitions | 1 | taskid_date_ix | 2 | transitiondate | A | 896 | NULL | NULL | | BTREE | | | | tasktransitions | 1 | status_ix | 1 | status | A | 3 | NULL | NULL | | BTREE | | | +-----------------+------------+----------------+--------------+------------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ Any other suggestions?

    Read the article

  • Issue changing innodb_log_file_size

    - by savageguy
    I haven't done much tweaking in the past so this might be relatively easy however I am running into issues. This is what I do: Stop MySQL Edit my.cnf (changing innodb_log_file_size) Remove ib_logfile0/1 Start MySQL Starts fine however all InnoDB tables have the .frm file is invalid error, the status shows InnoDB engine is disabled so I obviously go back, remove the change and everything works again. I was able to change every other variable I've tried but I can't seem to find out why InnoDB fails to start even after removing the log files. Am I missing something? Thanks. Edit: Pasting of the log below - looks like it still seems to find the log file even though they are not there? Shutdown: 090813 10:00:14 InnoDB: Starting shutdown... 090813 10:00:17 InnoDB: Shutdown completed; log sequence number 0 739268981 090813 10:00:17 [Note] /usr/sbin/mysqld: Shutdown complete Startup after making the changes: InnoDB: Error: log file ./ib_logfile0 is of different size 0 5242880 bytes InnoDB: than specified in the .cnf file 0 268435456 bytes! 090813 11:00:18 [Warning] 'user' entry '[email protected]' ignored in --skip-name-resolve mode. 090813 11:00:18 [Note] /usr/sbin/mysqld: ready for connections. Version: '5.0.81-community-log' socket: '/var/lib/mysql/mysql.sock' port: 3306 MySQL Community Edition (GPL) 090813 11:00:19 [ERROR] /usr/sbin/mysqld: Incorrect information in file: './XXXX/User.frm' 090813 11:00:19 [ERROR] /usr/sbin/mysqld: Incorrect information in file: './XXXX/User.frm' 090813 11:00:19 [ERROR] /usr/sbin/mysqld: Incorrect information in file: './XXXX/User.frm' Its just a spam of the same error until I correct it When it did start after it recreated the log files so it must be looking in the same spot I am.

    Read the article

  • How to Bind a Command in WPF

    - by MegaMind
    Sometimes we used complex ways so many times, we forgot the simplest ways to do the task. I know how to do command binding, but i always use same approach. Create a class that implements ICommand interface and from the view model i create new instance of that class and binding works like a charm. This is the code that i used for command binding public partial class MainWindow : Window { public MainWindow() { InitializeComponent(); DataContext = this; testCommand = new MeCommand(processor); } ICommand testCommand; public ICommand test { get { return testCommand; } } public void processor() { MessageBox.Show("hello world"); } } public class MeCommand : ICommand { public delegate void ExecuteMethod(); private ExecuteMethod meth; public MeCommand(ExecuteMethod exec) { meth = exec; } public bool CanExecute(object parameter) { return false; } public event EventHandler CanExecuteChanged; public void Execute(object parameter) { meth(); } } But i want to know the basic way to do this, no third party dll no new class creation. Do this simple command binding using a single class. Actual class implements from ICommand interface and do the work.

    Read the article

  • Extending / changing how Zend_Search_Lucene searches

    - by Grant Collins
    Hi, I am currently using Zend_Search_Lucene to index and search a number of documents currently at around a 1000 or so. What I would like to do is change how the engine scores hits on a document, from the current default. Zend_Search_Lucene scores on the frequency of number of hits within a document, so a document that has 10 matches of the word PHP will score higher than a document with only 3 matches of PHP. What I am trying to do is pass a number of key words and score depending on the hits of those keywords. e.g. I pass 5 key words say,PHP, MySQL, Javascript, HTML and CSS that I search against the index. One document has 3 matches to those key words and one document has all 4 matches, the 4 matches scores the highest. The number of instances of those words in the document do not concern me. Now I've had a quick look at Zend_Search_Lucene_Search_Similarity however I have to confess that I am not sure (or that bright) to know how to use this to achieve what I am after. Is what I want to do possible using Lucene or is there a better solution out there?

    Read the article

  • Turning a series of raw images into movie frames in Android

    - by Nicholas Killewald
    I've got an Android project I'm working on that, ultimately, will require me to create a movie file out of a series of still images taken with a phone's camera. That is to say, I want to be able to take raw image frames and string them together, one by one, into a movie. Audio is not a concern at this stage. Looking over the Android API, it looks like there are calls in it to create movie files, but it seems those are entirely geared around making a live recording from the camera on an immediate basis. While nice, I can't use that for my purposes, as I need to put annotations and other post-production things on the images as they come in before they get fed into a movie (plus, the images come way too slowly to do a live recording). Worse, looking over the Android source, it looks like a non-trivial task to rewire that to do what I want it to do (at least without touching the NDK). Is there any way I can use the API to do something like this? Or alternatively, what would be the best way to go about this, if it's even feasible on cell phone hardware (which seems to keep getting more and more powerful, strangely...)?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Effective communication in a component-based system

    - by Tesserex
    Yes, this is another question about my game engine, which is coming along very nicely, with much thanks to you guys. So, if you watched the video (or didn't), the objects in the game are composed of various components for things like position, sprites, movement, collision, sounds, health, etc. I have several message types defined for "tell" type communication between entities and components, but this only goes so far. There are plenty of times when I just need to ask for something, for example an entity's position. There are dozens of lines in my code that look like this: SomeComponent comp = (SomeComponent)entity.GetComponent(typeof(SomeComponent)); if (comp != null) comp.GetSomething(); I know this is very ugly, and I know that casting smells of improper OO design. But as complex as things are, there doesn't seem to be a better way. I could of course "hard-code" my component types and just have SomeComponent comp = entity.GetSomeComponent(); but that seems like a cop-out, and a bad one. I literally JUST REALIZED, while writing this, after having my code this way for months with no solution, that a generic will help me. SomeComponent comp = entity.GetComponent<SomeComponent>(); Amazing how that works. Anyway, this is still only a semantic improvement. My questions remain. Is this actually that bad? What's a better alternative?

    Read the article

< Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >