Search Results

Search found 150 results on 6 pages for 'atg dynamo'.

Page 6/6 | < Previous Page | 2 3 4 5 6 

  • Post Crosstalk 2012

    - by David Dorf
    This year the Oracle Retail users conference, Crosstalk, had a 20% increase in attendees, which was driven by both new customers and those acquired via Endeca.  As the product assets of Oracle have grown, so has the completeness of the solution set.  This year was marked by the breadth of omni-channel stories. Rose Spicer and her marketing team (see photo on left) always strive for an equal balance of retailer presentations, networking opportunities, and unique experiences -- this year was no exception.  We had 41 different retailers from China, Russia, South Africa, Brazil, Chile, US, Canada and the UK sharing their insights with one another. In all there were 251 executives from 120 iconic brands such as Daphne, Kohl's, Morrisons, Abercrombie & Fitch, Hot Topic, Talbots, Petco, Deckers, Sportmaster, Mr. Price, Falabella, and Disney to name a few. From a product perspective, there were a few new developments from Oracle Retail: Endeca's search engine has been integrated into the ATG commerce platform. The latest Retail Analytics application, Oracle Retail Customer Analytics, is generally available. Oracle Retail previewed a new fully-integrated mobile POS. But the real benefit of attending Crosstalk was hearing about the experiences of retailers and partners.  Here are are a few interesting facts I picked up: At Kohl's, the most popular website accessed by customers within their stores is Facebook.  With all the buzz about showrooming, I was really expecting it to be Amazon. Daphne, a Chinese shoe retailer, is opening 3 new stores per day.  Being located near the factories allows them to have a very agile supply chain as well. Disney Stores have increased sales by 25% at stores upgraded to include Mobile POS.  They continue to lead the pack with excellent customer experiences. Quicksilver reported that 1 in 5 visits to their website comes from a tablet.  More evidence that tablets are replacing traditional PCs in households. By tagging shoes with RFID, Saks is able to ensure all shoe models are on display.  If a model is not being displayed, it has no chance of being sold. Additionally, there were awards, store tours on Michigan Avenue, fireworks at Navy Pier, and the Oracle Retail house band, Bolo313, performing at Solider Field.  Speaking of which, a few retailers got on stage and jammed with band -- possible rival to Rock & Roll Retail? You can always find the latest info from us at the Retail Rack. The next events on tap are the Partner Summit followed by OpenWorld.

    Read the article

  • A Complete Customer Experience Solution (3 of 3 in 'No Customer Left Behind' Series)

    - by Kathryn Perry
    A guest post by David Vap, Group Vice President, Oracle Applications Product Development In my previous post, I talked about taking three concrete steps to improve your customers' overall experiences: 1) understand your customer, 2) empower your ecosystem, and 3) adapt your business. To do these effectively and efficiently, it's important to find the right technology that can bridge the gaps across your channels, interactions, departments, and repositories. Oracle has spent the past three years and more than six billion dollars acquiring and developing some of the world's best-of-breed applications. The result is the most comprehensive customer experience (CX) portfolio offering in the World - bar none: ATG Best in Class Selling Experiences Fatwire Best in Class Marketing Experiences Inquira Best in Class Support Experiences Endecca Best in Class Search Experiences RightNow Best in Class Service Experiences Vitrue & Involver Best in Class Social Marketing Collective Intellect Best In Class Social Listening We don't expect organizations to eat the CX elephant in one bite, nor should they try to. There are key strategic initiatives within each of the four main pillars of our customer experience offering for which we deliver solutions: 1. Customer Experience for Marketing Social Listening and Engagement Social Marketing Marketing Websites Demand Generation and Lead Management Marketing and Loyalty Management 2. Customer Experience for Commerce Search, Navigation & Content Delivery Cross-Channel Commerce Targeting & Product Recommendations Social Commerce Order Management & Fulfillment Retail Store Operations 3. Customer Experience for Sales Sales Force Automation Social Selling Territory & Quota Management Revenue Forecasting Partner Relationship Management Quote to Cash Incentive Compensation 4. Customer Experience for Service Cross-Channel Customer Service Knowledge Management Social Customer Service Eligibility Management Contracts, Assets, and Entitlements Industry-Specific Solutions eBilling Oracle's customer experience portfolio is socially infused at each layer of our pillars rather than simply bolted on as a side process. This combines with the power of the Cloud to run the parts of the solution that need the access, efficiency, and agility from a managed infrastructure. You can get the compliance control from on-premise backbone infrastructure systems that run your business and don't change that often. Please take advantage of our teams of Oracle customer experience professionals and our key agency and technology partner ecosystem. They can help you develop strategic solution roadmaps that build and deliver customer experience and that are tailored to your business needs and objectives. No one has built a better customer service portfolio to manage the entire customer journey than Oracle. It is backed by CX thought leadership programs, a commitment from our executives, and a worldview that your technology decisions must be driven by your customer experiences to succeed. If you’d like to follow up on this conversation, please leave a comment or contact me at [email protected]. You can get more information on Oracle’s complete customer experience solution here.

    Read the article

  • PRUEBAS DE ESPECIALIZACION GRATUITAS 2013

    - by agallego
    Consigue  tu Certificado de Especialista Oracle  de forma GRATUITA , 27 y 28 de Noviembre de 2013  Ahora puedes realizar los exámenes de implementación de las especializaciones de Oracle y convertirte en especialista. Podrás realizar cualquiera de los exámenes de implementación de la siguiente lista: Oracle Fusion Customer Relationship Management 11g Sales Certified Implementation Specialist (1Z0-456) Oracle Fusion Financials 11g General Ledger Implementation Specialist(1Z0-508) Oracle Fusion Financials 11g Accounts Payable Implementation Specialist(1Z0-507) Oracle Fusion Financials 11g Accounts Receivable Implementation Specialist(1Z0-506) Oracle Fusion Human Capital Management 11g Human Resources Certified Implementation Specialist (1Z0-584) Oracle Fusion Human Capital Management 11g Talent Management Certified Implementation Specialist (1Z0-585) Oracle ATG Web Commerce 10 Implementation Developer Certified Implementation Specialist (1Z0-510) Oracle Hyperion Planning 11 Essentials (1Z0-533) Oracle Business Intelligence Applications 7.9.6 for ERP Essentials (1Z0-525) Oracle Hyperion Financial Management 11 Essentials (1Z0-532) Oracle Business Intelligence Applications 7.9.6 for CRM Essentials (1Z0-524) Oracle Hyperion Data Relationship Management 11.1.2 Essentials (1Z1-588) Oracle Business Intelligence Foundation Suite 11g Essentials (1Z0-591) Oracle Essbase 11 Essentials (1Z0-531) SPARC T4-Based Server Installation Essentials (1Z0-597) Oracle Solaris 11 Installation and Configuration Essentials (1Z0-580) Sun ZFS Storage Appliance Certified Implementation Specialist Exalogic Elastic Cloud X2-2 Certified Implementation Specialist Oracle Exadata 11g Essentials (1Z0-536) Oracle VM 3 for x86 Essenstials (1Z0-590) Oracle Linux Fundamentals (1Z0-402) Oracle Linux System Administration (1Z0-403) Oracle Service-Oriented Architecture Certified Implementation Specialist (1Z0-451) Oracle Unified Business Process Management Suite 11g Certified Implementation Specialist (1Z0-560) Oracle WebLogic Server 12c Certified Implementation Specialist (1Z0-599) Oracle WebCenter Portal 11g Essentials (1Z0-541) Oracle WebCenter Content 11g Essentials (1Z0-542) Oracle Application Development Framework 11g Certified Implementation Specialist Oracle Identity Analytics 11g Certified Implementation Specialist (1Z0-545) Oracle Enterprise Manager 12c Essentials (1Z0-457) Puedes consultar la información acerca de los examenes en cada uno de los enlaces. Para prepararte los examenes sigue la Guia de estudio que encontrarás en la página de cada examen. Requisitos: ser  Partner Gold, Platinum o Diamond de Oracle y tener un usuario de Oracle Pearson Vue.  ¿Cuándo?: 27 y 28 de noviembre  a las (9:00, 12:00, 16:00)  ¿Dónde?: Core Networks, C.E.Parque Norte, Edificio Olmo, Planta 1 Serrano Galvache 56 | 28033, Madrid Para inscribirte: Create una cuenta en Pearson Vue (www.pearsonvue.com/oracle). Para Registrarte aquí. Para más información sobre el programa de especializaciones, haz clic aquí. No pierdas esta oportunidad e inscríbete hoy.  Para cualquier duda contactar con [email protected]. Ana María Gallego Partner Enablement Manager Spain and Portugal      

    Read the article

  • E-Business Suite, ADF, Mobile and Eclipse: Oracle OpenWorld is Here!

    - by Juan Camilo Ruiz
    Oracle OpenWorld 2012 is around the corner! Lots of exciting news and content awaits for all attendees next week - the theme of my participation: ADF and E-Business Suite integration, together with ADF development in Oracle Enterprise Eclipse Package and JDeveloper.If you are coming to San Francisco and are a reader of this blog, you might be wondering what I'll be doing next week and also what should you attend? So, the following is the list of activities where I'll be participating or that I recommend you should not miss:First and foremost: On Thursday Oct. 4: Using Oracle ADF with Oracle E-Business Suite: The Full Integration View.  11.15 a.m - Moscone West 3003:  This is an emerging hot topic among both ADF and Oracle E-Business Suite Customers. In this session I'll be doing a presentation with Sara Woodhull from the Applications Technology Group (ATG) in Oracle E-Business Suite and Siva Puthurkattil from Lake County, Illinois. Sunday, Sept. 30:  I'll be hanging out at the ADF EMG User Day, learning directly from our users and Gurus. Monday, Oct. 1: Don't miss Chris Tonas's keynote for developers - at 10:45 am. Salon 8 at the Marriot - The Future of Development for Oracle Fusion—From Desktop to Mobile to Cloud. Then: At 12.15 p.m. Moscone West 3014 - Extend Oracle Fusion Apps to Tablets/Smartphones with Oracle Mobile Technology Followed by: At 1.45 p.m. Moscone West 3002/3004 -  Extend Oracle Applications to Mobile Devices with Oracle’s Mobile Technologies I'll be participating in a couple of Hands-On Labs: Build Mobile Applications for Oracle E-Business Suite 1:45 PM- Marriott Marquis - Salon 10A And: Introduction to ADF 3.15 p.m - Marrriott Marquis - Salon 3/4. Tuesday, Oct. 2: I'll be at the Oracle Enterprise Pack for Eclipse demo booth showing some nice demos on ADF development with Eclipse. Wednesday, Oct. 3: Mobile Apps for Oracle E-Business Suite with Oracle ADF Mobile and Oracle SOA Suite 10:15 AM - Moscone West - 3001. Let's have a beer at the Oracle ADF Developer Meetup. OTN Louge 4:30 p.,m - 5.30 p.m! Thursday, Oct. 4: After my session, come to experience ADF development in Eclipse at the Oracle ADF for Java EE Developers with Oracle Enterprise Pack for Eclipse HandsOn Lab 12.45 p,m - Marriot room 3/4. All the Oracle OpenWorld related sessions can be found here: ADF - http://goo.gl/eJFNi Mobile: http://goo.gl/mGoRM E-Business Suite: http://goo.gl/5NqMd

    Read the article

  • Oracle Internet Directory 11gR1 11.1.1.6 Certified with E-Business Suite

    - by Elke Phelps (Oracle Development)
    Oracle E-Business Suite comes with native user authentication and management capabilities out-of-the-box. If you need more-advanced features, it's also possible to integrate it with Oracle Internet Directory and Oracle Single Sign-On or Oracle Access Manager, which allows you to link the E-Business Suite with third-party tools like Microsoft Active Directory, Windows Kerberos, and CA Netegrity SiteMinder.  For details about third-party integration architectures, see either of these article for EBS 11i and 12: In-Depth: Using Third-Party Identity Managers with E-Business Suite Release 12 In-Depth: Using Third-Party Identity Managers with the E-Business Suite Release 11i Oracle Internet Directory 11.1.1.6 is now certified with Oracle E-Business Suite Release 11i, 12.0 and 12.1.  OID 11.1.1.6 is part of Oracle Fusion Middleware 11g Release 1 Version 11.1.1.6.0, also known as FMW 11g Patchset 5.  Certified E-Business Suite releases are: EBS Release 11i 11.5.10.2 + ATG PH.H RUP 7 and higher EBS Release 12.0.6 and higher EBS Release 12.1.1 and higher Supported Configurations Oracle Internet Directory 11.1.1.5.0 can be integrated with two single sign-on solutions for EBS environments: Oracle Internet Directory and Directory Integration Platform from Fusion Middleware 11gR1 Patchset 5 (11.1.1.6.0) with Oracle Access Manager 10g (10.1.4.3) with an existing Oracle E-Business Suite system (Release 11i or 12.1.x). Oracle Internet Directory and Directory Integration Platform from Fusion Middleware 11gR1 Patchset 5 (11.1.1.6.0) with Oracle Access Manager 11gR1 (11.1.1.5) with an existing Oracle E-Business Suite system (Release 12.0.6 or higher or 12.1.x). Oracle Internet Directory (OID) and Directory Integration Platform (DIP) from Oracle Fusion Middleware 11gR1 Patchset 5  (11.1.1.6.0) with Oracle Single Sign-On Server and Oracle Delegated Administration Services Release 10g (10.1.4.3.0) with an existing Oracle E-Business Suite system (Release 11i, 12.0.6 or 12.1.x) Oracle Access Manager strongly recommended Oracle has two single sign-on solutions: Oracle Single Sign-On Server (OSSO) and Oracle Access Manager (OAM). Oracle strongly recommends that all new single sign-on implementations use Oracle Access Manager. Oracle Access Manager is the preferred solution going forward, and forms the basis of Oracle Fusion Middleware 11g. OSSO is no longer being actively developed and will not be ported to Oracle WebLogic Server. Platform certifications Oracle Internet Directory is certified to run on any operating system for which Oracle WebLogic Server 11g is certified. Refer to the Oracle Fusion Middleware 11g System Requirements for more details.For information on operating systems supported by Oracle Internet Directory and its components, refer to the Oracle Identity and Access Management 11gR1 certification matrix.Integration with Oracle Internet Directory involves components spanning several different suites of Oracle products. There are no restrictions on which platform any particular component may be installed so long as the platform is supported for that component.References Overview of Single Sign-On Integration Options for Oracle E-Business Suite Note 1388152.1 Using the Latest Oracle Internet Directory 11gR1 Patchset with Oracle Single Sign-on and Oracle E-Business Suite (Note 876539.1) Integrating Oracle E-Business Suite with Oracle Access Manager 11g using Oracle E-Business Suite AccessGate (Note 1309013.1) Integrating Oracle E-Business Suite with Oracle Access Manager 10g using Oracle E-Business Suite AccessGate (Note 975182.1) Migrating Oracle Single Sign-On 10gR3 to Oracle Access Manager 11g with Oracle E-Business Suite (Note 1304550.1) Oracle Fusion Middleware Download, Installation & Configuration Readme Oracle Fusion Middleware Installation Guide for Oracle Identity Management 11g Release 1 (11.1.1) (Part Number E12002-09) Oracle Fusion Middleware Upgrade Guide for Oracle Identity Management 11g Release 1 (11.1.1) (Part Number E10129-09) Oracle Fusion Middleware Upgrade Planning Guide 11g Release 1 (11.1.1) (Part Number E10125-06) Oracle Fusion Middleware Patching Guide 11g Release 1 (11.1.1) (Part Number E16793-12) Related Articles Understanding Options for Integrating Oracle Access Manager with E-Business Suite In-Depth: Using Third-Party Identity Managers with E-Business Suite Release 12 In-Depth: Using Third-Party Identity Managers with the E-Business Suite Release 11i Oracle Access Manager 10gR3 Certified with E-Business Suite Portal 11.1.1.4 Certified with E-Business Suite Discoverer 11.1.1.4 Certified with E-Business Suite

    Read the article

  • Welcome to the SOA &amp; E2.0 Partner Community Forum

    - by Jürgen Kress
    With more than 200 registrations the SOA & E2.0 Partner Community Forum is a huge success!   Conference program Is available online: http://tinyurl.com/soaforumagenda Agenda Tuesday March 15th 2011 12:15 Welcome & Introduction – Hans Blaas & Jürgen Kress, Oracle 12:30 Oracle Middleware Strategy and Information on Application Grid and Exalogic - Andrew Sutherland, Oracle 13:15 Managing Online Customer, Partner and Employee Engagement Oracle E2.0 Solutions - Andrew Gilboy, Oracle 14:00 Coffee Break 14:30 Partner SOA/ BPM Reference Case – Leon Smiers, Capgemini 15:15 Partner WebCenter/ UCM Reference Case – Vikram Setia, Infomentum 16.00 Break 16.30 SOA and BPM 11gR1 PS3 Update – David Shaffer 17:00 Why specialization is important for Partners – Nick Kritikos, Hans Blaas & Jürgen Kress 17:45 Social Event   Wednesday March 16th 2011 09.00 Welcome & Introduction Day II 09.15 Breakout sessions Round 1 SOA Suite 11g PS3 & OSB Importance of ADF & Jdeveloper SOA Security IDM WebCenter PS3, Whats New E2.0 Sales Plays 10.30 Break 10.45 Breakout sessions Round 2 WebCenter PS3, Whats New Applications Management Enterprise Manager and Amberpoint ADF/WebCenter 11g integration with BPM Suite 11g Importance of ADF & Jdeveloper JCAPS & OC4J migration opportunities for service business 12.00 Lunch 13.00 Breakout sessions Round 3 BPM 11g, Whats New Universal Content Management! 11g SOA Security IDM E2.0 Surrounding Products: ATG, Documaker, Primavera Middleware Industry Value Propositions & Sales Plays 14.30 Break 14.45 Fusion Applications, Rajan Krishnan, Oracle 15.30 SOA & E2.0 Summary & Closing, Hans Blaas & Jürgen Kress, Oracle 15.45 Finish & Departure 16:00 Bus departure   Capgemini Nederland BV Papendorpseweg 100 3500 GN Utrecht The Netherlands Tel: +31 30 689 00 00 For a detailed routedescription by car or public transport please visit: http://www.nl.capgemini.com/pdf/Papendorp_UK.pdf Hotel In case you have not booked your hotel yet, please make your own hotel reservation. You can book your hotel room at the 'Hotel Vianen' at a special rate, by using the Oracle booking code: DDG VIA-GF41422. One night package € 110,- for a single room, including breakfast. Kindly secure your hotel room as soon as possible. The number of rooms is limited! Hotel Vianen Prins Bernhardstraat 75 4132 XE Vianen [email protected] The Netherlands [email protected] Arrival on 14th of March and staying at Hotel Vianen. On 15th of March we have arranged a transfer from Hotel Vianen to the Capgemini Offices. The bus is parked in front of the hotel and will leave at 10.15AM (UTC/GMT+1). Logistics Pass with barcode At your arrival you will receive a pass with a barcode. This pass will give you access to the conference building and the different floors within the building. Please make sure to hand in your pass at the registration desk at the end of the day. Arrival by plane Transfer from Schiphol Airport to Capgemini on 15th of March will be arranged by Oracle. A hostess will be welcoming you at the Meeting Point at Schiphol Airport (this is a red and white large cubicle situated next to Delifrance) The buses will depart from Schiphol Airport at 09.00AM, 09.45AM and 10.30AM (UTC/GMT+1).     For future SOA Partner Community Forums  become a member for registration please visit www.oracle.com/goto/emea/soa (OPN account required) Blog Twitter LinkedIn Mix Forum Wiki Website Technorati Tags: SOA Partner Community Forum,Community,SOA Partner Community,Utrecht 03.2011,OPN,Oracle,Jürgen Kress

    Read the article

  • Oracle Database 11gR2 11.2.0.3 Certified with E-Business Suite on Windows

    - by John Abraham
    As a follow up to our original certification announcement, Oracle Database 11g Release 2 (11.2.0.3) is now certified with Oracle E-Business Suite Release 11i and Release 12 on the following Microsoft Windows operating systems: Release 12.1 (12.1.1 and higher) Microsoft Windows Server (32-bit) (2003, 2008) Microsoft Windows x64 (64-bit) (20031, 20081, 2008 R22) Release 12.0 (12.0.4 and higher) Microsoft Windows Server (32-bit) (2003) Microsoft Windows x64 (64-bit) (2003, 2008)1 Release 11i (11.5.10.2 + ATG PF.H RUP 6 and higher) Microsoft Windows Server (32-bit) (2003, 20081) Microsoft Windows x64 (64-bit) (2003, 2008, 2008 R2)1 Notes 1: This OS is a 'database tier only' or 'split tier configuration' platform where the application tier must be on a fully certified E-Business Suite platform. 2: This OS is a 'database tier only' platform for Release 11i. For 12.1.1 or higher, it is also supported on the application tier via the migration process outlined in My Oracle Support Document 1188535.1. Pending Certification E-Business Suite 12.0 with 11.2.0.3 Split Tier Certification on Microsoft Windows x64 (64-bit) (2008 R2) is in progress and will be announced separately. This announcement for Oracle E-Business Suite 11i and R12 includes: Real Application Clusters (RAC) Oracle Database Vault Transparent Data Encryption (Column Encryption) TDE Tablespace Encryption Advanced Security Option (ASO)/Advanced Networking Option (ANO) Export/Import Process for Oracle E-Business Suite Release 11i and Release 12 Database Instances Transportable Database and Transportable Tablespaces Data Migration Processes for Oracle E-Business Suite Release 11i and Release 12 References MOS Document 881505.1 - Interoperability Notes - Oracle E-Business Suite Release 11i with Oracle Database 11g Release 2 (11.2.0) MOS Document 1058763.1 - Interoperability Notes - Oracle E-Business Suite Release 12 with Oracle Database 11g Release 2 (11.2.0) MOS Document 1091086.1 - Integrating Oracle E-Business Suite Release 11i with Oracle Database Vault 11gR2 MOS Document 1091083.1 - Integrating Oracle E-Business Suite Release 12 with Oracle Database Vault 11gR2 MOS Document 216205.1 - Database Initialization Parameters for Oracle E-Business Suite 11i MOS Document 396009.1 - Database Initialization Parameters for Oracle Applications Release 12 MOS Document 823586.1 - Using Oracle 11g Release 2 Real Application Clusters with Oracle E-Business Suite Release 11i MOS Document 823587.1 - Using Oracle 11g Release 2 Real Application Clusters with Oracle E-Business Suite Release 12 MOS Document 403294.1 - Using Transparent Data Encryption (TDE) Column Encryption with Oracle E-Business Suite Release 11i MOS Document 732764.1 - Using Transparent Data Encryption (TDE) Column Encryption with Oracle E-Business Suite Release 12 MOS Document 828223.1 - Using TDE Tablespace Encryption with Oracle E-Business Suite Release 11i MOS Document 828229.1 - Using TDE Tablespace Encryption with Oracle E-Business Suite Release 12 MOS Document 391248.1 - Encrypting Oracle E-Business Suite Release 11i Network Traffic using Advanced Security Option and Advanced Networking Option MOS Document 732764.1 - Using Transparent Data Encryption (TDE) Column Encryption with Oracle E-Business Suite Release 12 MOS Document 557738.1 - Export/Import Process for Oracle E-Business Suite Release 11i Database Instances Using Oracle Database 11g Release 1 or 11g Release 2 MOS Document 741818.1 - Export/Import Process for Oracle E-Business Suite Release 12 Database Instances Using Oracle Database 11g Release 1 or 11g Release 2 MOS Document 1366265.1 - Using Transportable Tablespaces to Migrate Oracle Applications 11i Using Oracle Database 11g Release 2 MOS Document 1311487.1 - Using Transportable Tablespaces to Migrate Oracle E-Business Suite Release 12 Using Oracle Database 11g Release 2 MOS Document 729309.1 - Using Transportable Database to Migrate Oracle E-Business Suite Release 11i Using Oracle Database 10g Release 2 or 11g MOS Document 734763.1 - Using Transportable Database to Migrate Oracle E-Business Suite Release 12 Using Oracle Database 10g Release 2 or 11g MOS Document 1188535.1 - Migrating Oracle E-Business Suite R12 to Microsoft Windows Server 2008 R2 Please also review the platform-specific Oracle Database Installation Guides for operating system and other prerequisites. Related Articles Database 11.2.0.2 Certified with EBS R12 on IBM: Linux on System z EBS R12 Certified with Database 11gR2 on SLES 11 11gR2 11.2.0.3 Database Certified with E-Business Suite

    Read the article

  • Oracle Data Integration 12c: Simplified, Future-Ready, High-Performance Solutions

    - by Thanos Terentes Printzios
    In today’s data-driven business environment, organizations need to cost-effectively manage the ever-growing streams of information originating both inside and outside the firewall and address emerging deployment styles like cloud, big data analytics, and real-time replication. Oracle Data Integration delivers pervasive and continuous access to timely and trusted data across heterogeneous systems. Oracle is enhancing its data integration offering announcing the general availability of 12c release for the key data integration products: Oracle Data Integrator 12c and Oracle GoldenGate 12c, delivering Simplified and High-Performance Solutions for Cloud, Big Data Analytics, and Real-Time Replication. The new release delivers extreme performance, increase IT productivity, and simplify deployment, while helping IT organizations to keep pace with new data-oriented technology trends including cloud computing, big data analytics, real-time business intelligence. With the 12c release Oracle becomes the new leader in the data integration and replication technologies as no other vendor offers such a complete set of data integration capabilities for pervasive, continuous access to trusted data across Oracle platforms as well as third-party systems and applications. Oracle Data Integration 12c release addresses data-driven organizations’ critical and evolving data integration requirements under 3 key themes: Future-Ready Solutions : Supporting Current and Emerging Initiatives Extreme Performance : Even higher performance than ever before Fast Time-to-Value : Higher IT Productivity and Simplified Solutions  With the new capabilities in Oracle Data Integrator 12c, customers can benefit from: Superior developer productivity, ease of use, and rapid time-to-market with the new flow-based mapping model, reusable mappings, and step-by-step debugger. Increased performance when executing data integration processes due to improved parallelism. Improved productivity and monitoring via tighter integration with Oracle GoldenGate 12c and Oracle Enterprise Manager 12c. Improved interoperability with Oracle Warehouse Builder which enables faster and easier migration to Oracle Data Integrator’s strategic data integration offering. Faster implementation of business analytics through Oracle Data Integrator pre-integrated with Oracle BI Applications’ latest release. Oracle Data Integrator also integrates simply and easily with Oracle Business Analytics tools, including OBI-EE and Oracle Hyperion. Support for loading and transforming big and fast data, enabled by integration with big data technologies: Hadoop, Hive, HDFS, and Oracle Big Data Appliance. Only Oracle GoldenGate provides the best-of-breed real-time replication of data in heterogeneous data environments. With the new capabilities in Oracle GoldenGate 12c, customers can benefit from: Simplified setup and management of Oracle GoldenGate 12c when using multiple database delivery processes via a new Coordinated Delivery feature for non-Oracle databases. Expanded heterogeneity through added support for the latest versions of major databases such as Sybase ASE v 15.7, MySQL NDB Clusters 7.2, and MySQL 5.6., as well as integration with Oracle Coherence. Enhanced high availability and data protection via integration with Oracle Data Guard and Fast-Start Failover integration. Enhanced security for credentials and encryption keys using Oracle Wallet. Real-time replication for databases hosted on public cloud environments supported by third-party clouds. Tight integration between Oracle Data Integrator 12c and Oracle GoldenGate 12c and other Oracle technologies, such as Oracle Database 12c and Oracle Applications, provides a number of benefits for organizations: Tight integration between Oracle Data Integrator 12c and Oracle GoldenGate 12c enables developers to leverage Oracle GoldenGate’s low overhead, real-time change data capture completely within the Oracle Data Integrator Studio without additional training. Integration with Oracle Database 12c provides a strong foundation for seamless private cloud deployments. Delivers real-time data for reporting, zero downtime migration, and improved performance and availability for Oracle Applications, such as Oracle E-Business Suite and ATG Web Commerce . Oracle’s data integration offering is optimized for Oracle Engineered Systems and is an integral part of Oracle’s fast data, real-time analytics strategy on Oracle Exadata Database Machine and Oracle Exalytics In-Memory Machine. Oracle Data Integrator 12c and Oracle GoldenGate 12c differentiate the new offering on data integration with these many new features. This is just a quick glimpse into Oracle Data Integrator 12c and Oracle GoldenGate 12c. Find out much more about the new release in the video webcast "Introducing 12c for Oracle Data Integration", where customer and partner speakers, including SolarWorld, BT, Rittman Mead will join us in launching the new release. Resource Kits Meet Oracle Data Integration 12c  Discover what's new with Oracle Goldengate 12c  Oracle EMEA DIS (Data Integration Solutions) Partner Community is available for all your questions, while additional partner focused webcasts will be made available through our blog here, so stay connected. For any questions please contact us at partner.imc-AT-beehiveonline.oracle-DOT-com Stay Connected Oracle Newsletters

    Read the article

  • Oracle Database 11.2.0.4 Certified with EBS on Microsoft Windows Server

    - by John Abraham
    As a follow up to to a previous announcement, Oracle Database 11g Release 2 (11.2.0.4) is now certified with Oracle E-Business Suite Release 11i and Release 12 on the following Microsoft Windows Server operating systems: Release 12.2 (12.2.3 and higher): Microsoft Windows x64 (64-bit) (2008 R2) Release 12.1 (12.1.1 and higher): Microsoft Windows Server (32-bit) (2003, 2008) Microsoft Windows x64 (64-bit) (20031, 20081, 2008 R22) Release 12.0 (12.0.4 and higher): Microsoft Windows Server (32-bit) (2003) Microsoft Windows x64 (64-bit) (2003, 2008, 2008 R2)1 Release 11i (11.5.10.2 + ATG PF.H RUP 6 and higher):: Microsoft Windows Server (32-bit) (2003, 20081) Microsoft Windows x64 (64-bit) (2003, 2008, 2008 R2)1 Notes: 1: This OS is a 'database tier only' or 'split tier configuration' platform where the application tier must be on a fully certified E-Business Suite platform. 2: This OS is a 'database tier only' platform for Release 11i. For 12.1.1 or higher, it is also supported on the application tier via the migration process outlined in My Oracle Support Document 1188535.1. This announcement for Oracle E-Business Suite 11i and R12 includes: Oracle Database 11gR2 version 11.2.0.4 Oracle Database 11gR2 version 11.2.0.4 Real Application Clusters (RAC) Oracle Database Vault 11gR2 version 11.2.0.4 Transparent Data Encryption (Column Encryption) using Oracle Database 11gR2 version 11.2.0.4 TDE Tablespace Encryption using Oracle Database 11gR2 version 11.2.0.4 Advanced Security Option (ASO)/Advanced Networking Option (ANO) with Oracle Database 11gR2 version 11.2.0.4 Export/Import Process for Oracle E-Business Suite Release 11i and Release 12 Database Instances Transportable Database and Transportable Tablespaces Data Migration Processes for Oracle E-Business Suite Release 11i and Release 12 Certification data in My Oracle Support (http://support.oracle.com) has been updated with this certification - please review the documents below for all requirements and additional details: Where can I find more information? MOS Document 881505.1 - Interoperability Notes - Oracle E-Business Suite Release 11i with Oracle Database 11g Release 2 (11.2.0) MOS Document 1058763.1 - Interoperability Notes - Oracle E-Business Suite Release 12 with Oracle Database 11g Release 2 (11.2.0) MOS Dcoument 1623879.1 - Interoperability Notes - Oracle E-Business Suite Release 12.2 with Oracle Database 11g Release 2 (11.2.0) MOS Document 1091086.1 - Integrating Oracle E-Business Suite Release 11i with Oracle Database Vault 11gR2 MOS Document 1091083.1 - Integrating Oracle E-Business Suite Release 12 with Oracle Database Vault 11gR2 MOS Document 216205.1 - Database Initialization Parameters for Oracle E-Business Suite 11i MOS Document 396009.1 - Database Initialization Parameters for Oracle Applications Release 12 MOS Document 823586.1 - Using Oracle 11g Release 2 Real Application Clusters with Oracle E-Business Suite Release 11i MOS Document 823587.1 - Using Oracle 11g Release 2 Real Application Clusters with Oracle E-Business Suite Release 12 MOS Document 946413.1 - Using Oracle Applications with a Split Configuration Database Tier on Oracle Release 11g Release 2 MOS Document 403294.1 - Using Transparent Data Encryption (TDE) Column Encryption with Oracle E-Business Suite Release 11i MOS Document 732764.1 - Using Transparent Data Encryption (TDE) Column Encryption with Oracle E-Business Suite Release 12 MOS Document 828223.1 - Using TDE Tablespace Encryption with Oracle E-Business Suite Release 11i MOS Document 828229.1 - Using TDE Tablespace Encryption with Oracle E-Business Suite Release 12 MOS Document 391248.1 - Encrypting Oracle E-Business Suite Release 11i Network Traffic using Advanced Security Option and Advanced Networking Option MOS Document 376700.1 - Enabling SSL in Oracle Application Release 12 MOS Document 732764.1 - Using Transparent Data Encryption (TDE) Column Encryption with Oracle E-Business Suite Release 12 MOS Document 557738.1 - Export/Import Process for Oracle E-Business Suite Release 11i Database Instances Using Oracle Database 11g Release 1 or 11g Release 2 MOS Document 741818.1 - Export/Import Process for Oracle E-Business Suite Release 12 Database Instances Using Oracle Database 11g Release 1 or 11g Release 2 MOS Document 1366265.1 - Using Transportable Tablespaces to Migrate Oracle Applications 11i Using Oracle Database 11g Release 2 MOS Document 1311487.1 - Using Transportable Tablespaces to Migrate Oracle E-Business Suite Release 12 Using Oracle Database 11g Release 2 MOS Document 729309.1 - Using Transportable Database to Migrate Oracle E-Business Suite Release 11i Using Oracle Database 10g Release 2 or 11g MOS Document 734763.1 - Using Transportable Database to Migrate Oracle E-Business Suite Release 12 Using Oracle Database 10g Release 2 or 11g MOS Document 1188535.1 - Migrating Oracle E-Business Suite R12 to Microsoft Windows Server 2008 R2 MOS Dcoument 1349240.1 - Database Preparation Guidelines for an Oracle E-Business Suite Release 12.2 Upgrade MOS Document 1594274.1 - Oracle E-Business Suite Release 12.2: Consolidated List of Patches and Technology Bug Fixes Please also review the platform-specific Oracle Database Installation Guides for operating system and other prerequisites.

    Read the article

  • Building Extensions Using E-Business Suite SDK for Java

    - by Sara Woodhull
    We’ve just released Version 2.0.1 of Oracle E-Business Suite SDK for Java.  This new version has several great enhancements added after I wrote about the first version of the SDK in 2010.  In addition to the AppsDataSource and Java Authentication and Authorization Service (JAAS) features that are in the first version, the Oracle E-Business Suite SDK for Java now provides: Session management APIs, so you can share session information with Oracle E-Business Suite Setup script for UNIX/Linux for AppsDataSource and JAAS on Oracle WebLogic Server APIs for Message Dictionary, User Profiles, and NLS Javadoc for the APIs (included with the patch) Enhanced documentation included with Note 974949.1 These features can be used with either Release 11i or Release 12.  References AppsDataSource, Java Authentication and Authorization Service, and Utilities for Oracle E-Business Suite (Note 974949.1) FAQ for Integration of Oracle E-Business Suite and Oracle Application Development Framework (ADF) Applications (Doc ID 1296491.1) What's new in those references? Note 974949.1 is the place to look for the latest information as we come out with new versions of the SDK.  The patch number changes for each release.  Version 2.0.1 is contained in Patch 13882058, which is for both Release 11i and Release 12.  Note 974949.1 includes the following topics: Applying the latest patch Using Oracle E-Business Suite Data Sources Oracle E-Business Suite Implementation of Java Authentication and Authorization Service (JAAS) Utilities Error loggingSession management  Message Dictionary User profiles Navigation to External Applications Java EE Session Management Tutorial For those of you using the SDK with Oracle ADF, besides some Oracle ADF-specific documentation in Note 974949.1, we also updated the ADF Integration FAQ as well. EBS SDK for Java Use Cases The uses of the Oracle E-Business Suite SDK for Java fall into two general scenarios for integrating external applications with Oracle E-Business Suite: Application sharing a session with Oracle E-Business Suite Independent application (not shared session) With an independent application, the external application accesses Oracle E-Business  Suite data and server-side APIs, but it has a completely separate user interface. The external application may also launch pages from the Oracle E-Business Suite home page, but after the initial launch there is no further communication with the Oracle E-Business Suite user interface. Shared session integration means that the external application uses an Oracle E-Business Suite session (ICX session), shares session context information with Oracle E-Business Suite, and accesses Oracle E-Business Suite data. The external application may also launch pages from the Oracle E-Business Suite home page, or regions or pages from the external application may be embedded as regions within Oracle Application Framework pages. Both shared session applications and independent applications use the AppsDataSource feature of the Oracle E-Business Suite SDK for Java. Independent applications may also use the Java Authentication and Authorization (JAAS) and logging features of the SDK. Applications that are sharing the Oracle E-Business Suite session use the session management feature (instead of the JAAS feature), and they may also use the logging, profiles, and Message Dictionary features of the SDK.  The session management APIs allow you to create, retrieve, validate and cancel an Oracle E-Business Suite session (ICX session) from your external application.  Session information and context can travel back and forth between Oracle E-Business Suite and your application, allowing you to share session context information across applications. Note: Generally you would use the Java Authentication and Authorization (JAAS) feature of the SDK or the session management feature, but not both together. Send us your feedback Since the Oracle E-Business Suite SDK for Java is still pretty new, we’d like to know about who is using it and what you are trying to do with it.  We’d like to get this type of information: customer name and brief use case configuration and technologies (Oracle WebLogic Server or OC4J, plain Java, ADF, SOA Suite, and so on) project status (proof of concept, development, production) any other feedback you have about the SDK You can send me your feedback directly at Sara dot Woodhull at Oracle dot com, or you can leave it in the comments below.  Please keep in mind that we cannot answer support questions, so if you are having specific issues, please log a service request with Oracle Support. Happy coding! Related Articles New Whitepaper: Extending E-Business Suite 12.1.3 using Oracle Application Express To Customize or Not to Customize? New Whitepaper: Upgrading your Customizations to Oracle E-Business Suite Release 12 ATG Live Webcast: Upgrading your EBS 11i Customizations to Release 12

    Read the article

  • OpenWorld: Our (Road) Maps are Looking Good!

    - by Tony Berk
    Wow, only one (or two) days down at Oracle OpenWorld! Are you on overload yet? I'm still trying to figure out how to be in 3 sessions at the same time... I guess everyone needs to prioritize! There was a lot to see in Monday's sessions, especially some great forward-looking roadmap sessions. In case you aren't here or you decided to go to other sessions, this is my quick summary of what I could capture from a couple of the roadmaps: In the Fusion CRM Strategy and Roadmap session, Anthony Lye provided an overview of the Fusion CRM strategy including the key design principles of 3 E's: Easy, Effective and Efficient. After an overview of how Oracle has deployed Fusion CRM internally to 25,000 users worldwide, Anthony discussed the features coming in the next release, the releases in the next 12 months and beyond. I can't detail too much since you haven't read Oracle's Safe Harbor statement, but check out Fusion Tap and look for new features and added functionality for sales prediction, marketing, social and integration with a number of the key Customer Experience products.  In the Oracle RightNow CX Cloud Service Vision and Roadmap session, Chris Hamilton presented the focus areas for the RightNow product. As a result of the large increase in development resources after the acquisition, the RightNow CX team is planning a lot of enhancements to the functionality, infrastructure and integrations. As a key piece of the Oracle Customer Experience (CX) strategy, RightNow will be integrated with Oracle Social Network, Oracle Commerce (ATG and Endeca), Oracle Knowledge, Oracle Policy Automation and, of course, further integration with Fusion Sales and Marketing. Look forward to seeing more on the Virtual Assistant, Smart Interaction Hub and Mobility. In addition to the roadmaps, I was looking forward to hearing from Oracle CRM customers. So, I sat in on two great Siebel customer panels: The Maximizing User Adoption Rates for Siebel Sales and Siebel Partner Relationship Management panel consisted of speakers from CSL Behring, McKesson and Intuit. It was great to get an overview of implementations for both B2B and B2C companies. It was great hearing that all of these companies have more than 1,000 sales users (Intuit has 4,000) and how the 360 degree view of the customer in Siebel is helping these customers improve their customers' experience (CX). They are all great examples of centralized implementations which have standardized processes across the globe and across business units.  Waste Management, Farmers Insurance and the US Citizenship & Immigration Services presented in the Driving Great Customer Experiences with Siebel Service Applications session. Talk about serving large customer bases! Is it possible that Farmers with only 10 million households is the smallest of these 3? All of them provided great examples of how they are improving the customer experience (CX) including 60-70% improvements in efficiency or reducing the number of applications the customer service reps (CSRs) need to use from 10 to 1 (Waste Management) and context aware call transfers to avoid the caller explaining their issue 3 times (USCIS). So that's my wrap up of only 4 sessions from Monday. In between sessions, I stopped by the Oracle DEMOgrounds and CRM Pavilion to visit with a group of great partners and see the products and partner integrations in action. Don't miss a recap of Mark Hurd's Keynote. I can't believe there were another 40+ sessions covering CRM, Fusion, Cloud, etc. that I missed today! Anyone else see any great sessions?

    Read the article

  • svn 503 error when commit new files

    - by philipp
    I am struggling with a strange error when I try to commit my repository. I have a V-server with webmin installed on it. Via Webmin I installed an svn module, created repositories and everything worked fine until three days ago. Trying to commit brings the following error: Commit failed (details follow): Server sent unexpected return value (503 Service unavailable) in response to PROPFIND request for '/svn/rle/!svn/wrk/a1f963a7-0a33-fa48-bfde-183ea06ab958/RLE/.htaccess' Server sent unexpected return value (503 Service unavailable) in response to PROPFIND request for '/svn/rle/RLE/.htaccess' I google everywhere and found only very few solutions. One indicated that a wrong error document is set, another one dealt about the problem that filenames might cause this error and last but not least a wrong proxy configuration in the local svn config could be the reason. After trying all of the solutions suggested I could not reach anything. Only after a server reboot there was a little difference in the error-message, telling me that the server was not able to move a temp file, because the operation was permitted. So I also controlled the permissions of the svn directory, but also with no success. An svn update than restored the "normal" error from above and nothing changed since then. The only change I made on the server, I guess that this could be the reason why svn does not work anymore, was to install the php5_mysql module for apache via apt-get install php5_mysql. Atg the moment I have totally no idea where I could search. I don't know if the problem is on my server or in my repository and I would be glad to get any hint to solve this. Thanks in advance Greetings philipp error log: [Tue Oct 25 19:23:02 2011] [error] [client 217.50.254.18] Could not create activity /svn/rle/!svn/act/d8dd436f-d014-f047-8e87-01baac46a593. [500, #0] Tue Oct 25 19:23:02 2011] [error] [client 217.50.254.18] could not begin a transaction [500, #1] [Tue Oct 25 19:24:21 2011] [error] [client 217.50.254.18] Could not create activity /svn/rle/!svn/act/adac52c2-6f46-f540-b218-2f2ff03b51a4. [500, #0] http.conf: <Location /svn> DAV svn SVNParentPath /home/xxx/svn AuthType Basic AuthName xxx.de AuthUserFile /home/xxx/etc/svn.basic.passwd Require valid-user AuthzSVNAccessFile /home/xxx/etc/svn-access.conf Satisfy Any ErrorDocument 404 default RewriteEngine off </Location> The permissions for the repository directory are : rwxrwxrwx (0777). the directory /svn/rle/!svn/act/adac52c2-6f46-f540-b218-2f2ff03b51a4 does not exist on the server. I think this is part of the repository. So, I just just want to admit that i tried to reach the repository via Browser and i worked, I could see everything, so the error only occurs when I try to commit new files. I also created a second repository and tried to commit files in there, what gave me the same error.

    Read the article

  • 11gR2 11.2.0.3 Database Certified with E-Business Suie

    - by Elke Phelps (Oracle Development)
    The 11gR2 11.2.0.2 Database was certified with E-Business Suite (EBS) 11i and EBS 12 almost one year ago today.  I’m pleased to announce that 11.2.0.3, the second patchset for the 11gR2 Database is now certified. Be sure to review the interoperability notes for R11i and R12 for the most up-to-date requirements for deployment. This certification announcement is important as you plan upgrades to the technology stack for your environment. For additional upgrade direction, please refer to the recently published EBS upgrade recommendations article. Database support implications may also be reviewed in the database patching and support article. Oracle E-Business Suite Release 11i Prerequisites 11.5.10.2 + ATG PF.H RUP 6 and higher Certified Platforms Linux x86 (Oracle Linux 4, 5) Linux x86 (RHEL 4, 5) Linux x86 (SLES 10) Linux x86-64 (Oracle Linux 4, 5) -- Database-tier only Linux x86-64 (RHEL 4, 5) -- Database-tier only Linux x86-64 (SLES 10--Database-tier only) Oracle Solaris on SPARC (64-bit) (10) Oracle Solaris on x86-64 (64-bit) (10) -- Database-tier only Pending Platform Certifications Microsoft Windows Server (32-bit) Microsoft Windows Server (64-bit) HP-UX PA-RISC (64-bit) HP-UX Itanium IBM: Linux on System z  IBM AIX on Power Systems Oracle E-Business Suite Release 12 Prerequisites Oracle E-Business Suite Release 12.0.4 or later; or,Oracle E-Business Suite Release 12.1.1 or later Certified Platforms Linux x86 (Oracle Linux 4, 5) Linux x86 (RHEL 4, 5) Linux x86 (SLES 10) Linux x86-64 (Oracle Linux 4, 5) Linux x86-64 (RHEL 4, 5) Linux x86-64 (SLES 10) Oracle Solaris on SPARC (64-bit) (10) Oracle Solaris on x86-64 (64-bit) (10)  -- Database-tier only Pending Platform Certifications Microsoft Windows Server (32-bit) Microsoft Windows Server (64-bit) HP-UX PA-RISC (64-bit) IBM: Linux on System z IBM AIX on Power Systems HP-UX Itanium Database Feature and Option CertificationsThe following 11gR2 11.2.0.2 database options and features are supported for use: Advanced Compression Active Data Guard Advanced Security Option (ASO) / Advanced Networking Option (ANO) Database Vault  Database Partitioning Data Guard Redo Apply with Physical Standby Databases Native PL/SQL compilation Oracle Label Security (OLS) Real Application Clusters (RAC) Real Application Testing SecureFiles Virtual Private Database (VPD) Certification of the following database options and features is still underway: Transparent Data Encryption (TDE) Column Encryption 11gR2 version 11.2.0.3 Transparent Data Encryption (TDE) Tablespace Encryption 11gR2 version 11.2.0.3 About the pending certifications Oracle's Revenue Recognition rules prohibit us from discussing certification and release dates, but you're welcome to monitor or subscribe to this blog for updates, which I'll post as soon as soon as they're available.     EBS 11i References Interoperability Notes - Oracle E-Business Suite Release 11i with Oracle Database 11g Release 2 (11.2.0) (Note 881505.1) Using Oracle 11g Release 2 Real Application Clusters with Oracle E-Business Suite Release 11i (Note 823586.1) Encrypting Oracle E-Business Suite Release 11i Network Traffic using Advanced Security Option and Advanced Networking Option (Note 391248.1) Using Transparent Data Encryption with Oracle E-Business Release 11i (Note 403294.1) Integrating Oracle E-Business Suite Release 11i with Oracle Database Vault 11gR2 (Note 1091086.1) Using Oracle E-Business Suite with a Split Configuration Database Tier on Oracle 11gR2 Version 11.2.0.1.0 (Note 946413.1) Export/Import Process for Oracle E-Business Suite Release 11i Database Instances Using Oracle Database 11g Release 1 or 2 (Note 557738.1) Database Initialization Parameters for Oracle Applications Release 11i (Note 216205.1) EBS 12 References Interoperability Notes - Oracle E-Business Suite Release 12 with Oracle Database 11g Release 2 (11.2.0) (Note 1058763.1) Database Initialization Parameters for Oracle Applications Release 12 (Note 396009.1) Using Oracle 11g Release 2 Real Application Clusters with Oracle E-Business Suite Release 12 (Note 823587.1) Using Transparent Data Encryption with Oracle E-Business Suite Release 12 (Note 732764.1) Integrating Oracle E-Business Suite Release 12 with Oracle Database Vault 11gR2 (Note 1091083.1) Export/Import Process for Oracle E-Business Suite Release 12 Database Instances Using Oracle Database 11g Release 1 or 11g Release 2 (Note 741818.1) Enabling SSL in Oracle Applications Release 12 (Note 376700.1) Related Articles 11gR2 Database Certified with E-Business Suite 11i 11gR2 Database Certified with E-Business Suite 12 11gR2 11.2.0.2 Database Certified with E-Business Suite 12 Can E-Business Users Apply Database Patch Set Updates? On Apps Tier Patching and Support: A Primer for E-Business Suite Users On Database Patching and Support:  A Primer for E-Business Suite Users Quarterly E-Business Suite Upgrade Recommendations;  October 2011 Edition The preceding is intended to outline our general product direction.  It is intended for information purposes only, and may not be incorporated into any contract.   It is not a commitment to deliver any material, code, or functionality, and should not be relied upon in making purchasing decision.  The development, release, and timing of any features or functionality described for Oracle's products remains at the sole discretion of Oracle.

    Read the article

  • 2012 Oracle Fusion Innovation Awards - Part 2

    - by Michelle Kimihira
    Author: Moazzam Chaudry Continuing from Friday's blog on 2012 Oracle Fusion Innovation Awards, this blog (Part 2) will provide more details around the customers. It was a tremendous honor to be in single room of winners. We only wish we could have had more time to share stories from all the winners.  We received great insight from all the innovative solutions that our customers deploy and would like to share them broadly, so that others can benefit from best practices. There was a customer panel session joined by Ingersoll Rand, Nike and Motability and here is what was discussed: Barry Bonar, Enterprise Architect from Ingersoll Rand shared details around their solution, comprised of Oracle Exalogic, Oracle WebLogic Server and Oracle SOA Suite. This combined solutoin enabled their business transformation to increase decision-making, speed and efficiency, resulting in 40% reduced IT spend, 41X Faster response time and huge cost savings. Ashok Balakrishnan, Architect from Nike shared how they leveraged Oracle Coherence to analyze their digital "footprint" of activities. This helps them compete, collaborate and compare athletic data over time. Lastly, Ashley Doodly, Head of IT from Motability shared details around their solution compromised of Oracle SOA Suite, Service Bus, ADF, Coherence, BO and E-Business Suite. This solution helped Motability achieve 100% ROI within the first few months, performance in seconds vs. 10's of minutes and tremendous improvement in throughput that increased up to 50%.  This year's winners by category are: Oracle Exalogic Customer Results using Fusion Middleware Netshoes ATG on Exalogic: 6X Reduced H/W foot print, 6.2X increased throughput and 3 weeks time to market Claro Part of America Movil, running mission critical Java Application on Exalogic with 35X Faster Java response time, 5X Throughput Underwriters Laboratories Exalogic as an Apps Consolidation platform to power tremendous growth Ingersoll Rand EBS on Exalogic: Up to 40% Reduction in overall IT budget, 3x reduced foot print Oracle Cloud Application Foundation Customer Results using Fusion Middleware  Mazda Motor Corporation Tuxedo ART Batch runtime environment to migrate their batch apps on new open environment and reduce main frame cost. HOTELBEDS Technology Open Source to WebLogic transformation Globalia Corporation Introduced Oracle Coherence to fully reengineer DTH system and provide multiple business and technical benefits Nike Nike+, digital sports platform, has 8M users and is expecting an 5X increase in users, many of who will carry multiple devices that frequently sync data with the Digital Sport platform Comcast Corporation The solution is expected to increase availability, continuity, performance, and simplify and make the code at the application layer more flexible. Oracle SOA and Oracle BPM Customer Results using Fusion Middleware NTT Docomo Network traffic solution based on Oracle event processing and coherence - massive in scale: 12M users (50M in future) - 800,000 events/sec. Schneider National, Inc. SOA/B2B/ADF/Data Integration to orchestrate key order processes across Siebel, OTM & EBS.  Platform runs 60M trans/day and  50 million composite SOA instances per day across 10G and 11G Amadeus Oracle BPM solution: Business Rules and processes vary across local (80), regional (~10) and corporate approval process. Up to 10 levels of approval. Plans to deploy across 20+ markets Navitar SOA solution integrates a fully non-Oracle legacy application/ERP environment using Oracle’s SOA Suite and Oracle AIA Foundation Pack. Motability Uses SOA Suite to synchronize data across the systems and to manage the vehicle remarketing process Oracle WebCenter Customer Results using Fusion Middleware  News Limited Single platform running websites for 50% of Australia's newspapers University of Louisville “Facebook for Medicine”: Oracle Webcenter platform and Oracle BIEE to analyze patient test data and uncover potential health issues. Expecting annualized ROI of 277% China Mobile Jiangsu Company portal (25k users) to drive collaboration & productivity Life Technologies Portal for remotely monitoring & repairing biotech instruments LA Dept. of Water & Power Oracle WebCenter Portal to power ladwp.com on desktop and mobile for 1.6million users Oracle Identity Management Customer Results using Fusion Middleware Education Testing Service Identity Management platform for provisioning & SSO of 6 million GRE, GMAT, TOEFL customers Avea Oracle Identity Manager allowing call center personnel to quickly change Identity Profile to handle varying call loads based on a user self service interface. Decreased Admin Cost by 30% Oracle Data Integration Customer Results using Fusion Middleware Raymond James Near real-time integration for improved systems (throughput & performance) and enhanced operational flexibility in a 24 X 7 environment Wm Morrison Supermarkets Electronic Point of Sale integration handling over 80 million transactions a day in near real time (15 min intervals) Oracle Application Development Framework and Oracle Fusion Development Customer Results using Fusion Middleware Qualcomm Incorporated Solution providing  immediate business value enabling a self-service model necessary for growing the new customer base, an increase in customer satisfaction, reduced “time-to-deliver” Micros Systems, Inc. ADF, SOA Suite, WebCenter  enables services that include managing distribution of hotel rooms availability and rates to channels such as Hotel Web-site, Expedia, etc. Marfin Egnatia Bank A new web 2.0 UI provides a much richer experience through the ADF solution with the end result being one of boosting end-user productivity    Business Analytics (Oracle BI, Oracle EPM, Oracle Exalytics) Customer Results using Fusion Middleware INC Research Self-service customer portal delivering 5–10% of the overall revenue - expected to grow fast with the BI solution Experian Reduction in Time to Complete the Financial Close Process Hologic Inc Solution, saving months of decision-making uncertainty! We look forward to seeing many more innovative nominations. The nominatation process for 2013 begins in April 2013.    Additional Information: Blog: Oracle WebCenter Award Winners Blog: Oracle Identity Management Winners Blog: Oracle Exalogic Winners Blog: SOA, BPM and Data Integration will be will feature award winners in its respective areas this week Subscribe to our regular Fusion Middleware Newsletter Follow us on Twitter and Facebook

    Read the article

  • PRUEBAS DE ESPECIALIZACION 2013/2014

    - by agallego
    Consigue  tu Certificado de Especialista Oracle  de forma GRATUITA , 27 y 28 de Noviembre de 2013  Ahora puedes realizar los exámenes de implementación de las especializaciones de Oracle y convertirte en especialista. Podrás realizar cualquiera de los exámenes de implementación de la siguiente lista: Oracle Fusion Customer Relationship Management 11g Sales Certified Implementation Specialist (1Z0-456) Oracle Fusion Customer Relationship Management 11g Incentive Compensation Certified Implementation Specialist (1Z0-472) Oracle ATG Web Commerce 10 Implementation Developer Certified Implementation Specialist (1Z0-510) Oracle RightNow CX Cloud Service 2012 Certified Implementation Specialist (1Z0-465) Oracle RightNow CX Cloud Service 2012 Developer Certified Implementation Specialist (1Z0-480) Oracle Fusion Human Capital Management 11g Human Resources Certified Implementation Specialist (1Z0-584) Oracle Fusion Human Capital Management 11g Talent Management Certified Implementation Specialist (1Z0-585) Oracle Taleo Recruiting Cloud Service 2013 Certified Implementation Specialist  (1Z0-474) Oracle Fusion Financials 11g Accounts Payable Certified Implementation Specialist(1Z0-507) Oracle Fusion Financials 11g Accounts Receivable Certified Implementation Specialist(1Z0-506) Oracle Fusion Financials 11g General Ledger Certified Implementation Specialist (1Z0-508) Oracle Fusion Distributed Order Orchestration 11g Essentials (1Z0-469) Oracle Documaker Standard Edition 12 Implementation Essentials (1Z0-570) Oracle Hyperion Planning 11 Essentials (1Z0-533) Oracle Hyperion Financial Management 11 Essentials (1Z0-532) Oracle Business Intelligence Foundation Suite 11g Essentials (1Z0-591) Oracle Essbase 11 Essentials (1Z0-531) Oracle GoldenGate 10 Essentials (1Z0-539) Oracle GoldenGate 11g Certified Implementation Exam Essentials Oracle Business Intelligence Applications 7.9.6 for CRM Essentials (1Z0-524) Oracle Business Intelligence Applications 7.9.6 for ERP Essentials (1Z0-525) Oracle Oracle Endeca Information Discovery 2.3 Certified Implementation Specialist (1Z0-461) Oracle SOA Suite 11g Essentials (1Z0-478) Oracle Service-Oriented Architecture Certified Implementation Specialist (1Z0-451) Oracle Unified Business Process Management Suite 11g Certified Implementation Specialist (1Z0-560) Oracle WebLogic Server 12c Certified Implementation Specialist (1Z0-599) Oracle Application Grid Certified Implementation Specialist(1Z0-523) Oracle WebCenter Content 11g Essentials (1Z0-542) Oracle WebCenter Portal 11g Essentials (1Z0-541) Oracle Application Development Framework Essentials (1Z1-554) Oracle Identity Governance Suite 11g Essentials(1z0-459) Oracle Access Management Suite Plus 11g Essentials Exam(1z0-479) M2M Platform Certified Architecture Essentials (1Z0-467) Oracle WebCenter Sites 11g Certified Implementation Specialist (1Z0-462)  Oracle Cloud Application Foundation Essentials(1Z0-468) Oracle Exadata 11g Essentials (1Z0-536) Exadata Database Machine Models X3-2 and X3-8 Certified Implementation Specialist (1Z0-485) Oracle Certified Expert, Oracle Exadata X3 Administration(1Z0-027) Exalogic Elastic Cloud X2-2 Certified Implementation Specialist (1Z0-569) Oracle Linux System Administration (1Z0-403) Oracle Linux Fundamentals (1Z0-402) Oracle Linux 6 Certified Implementation Specialist (1Z0-460) Oracle VM 3 for x86 Certified Implementation Specialist (1Z0-590) Oracle Enterprise Manager 11g Essentials  (1Z0-530 ) Oracle Enterprise Manager 12c Essentials (1Z0-457) SPARC T4-Based Server Installation Essentials (1Z0-597) 1Z0-821 Oracle Solaris 11 System Administration 1Z0-822 Oracle Solaris 11 Advanced System Administration Oracle Solaris 11 Installation and Configuration Essentials (1Z0-580) StorageTek Tape Libraries Certified Implementation Specialist(1Z0-546) Sun ZFS Storage Appliance Certified Implementation Specialist The Primavera P6 Enterprise Project Portfolio Management 8 Essentials (1Z0-567) The Primavera Portfolio Management Essentials (1Z0-544) Primavera Contract Management 14 Certified Implementation Specialist (1Z0-582) Oracle Utilities Customer Care and Billing 2 Certified Implementation Specialist (1Z0-562) Oracle Policy Automation 10 Certified Implementation Specialist (1Z0-534) Oracle User Productivity Kit 11 Certified Implementation Specialist (1Z0-566) Oracle User Productivity Kit 11 Technical Certified Implementation Specialist (1Z0-583) Oracle Retail Demand Forecasting 13.3 Functional Implementer Certified Implementation Specialist (1Z0-463) Oracle Retail Predictive Application Server 13 Configuration Implementation Specialist (1Z0-576) Oracle Retail Merchandising System 13.2 Foundation Functional Implementer Certified Implementation Specialist (1Z0-453) Oracle Retail Predictive Application Server 13 Configuration Implementation Specialist (1Z0-576) Oracle Retail Point-of-Service Technical Certified Implementation Specialist (1Z0-572) Oracle Retail Price Management 13.2 Functional Implementer Certified Implementation Specialist (1Z0-454) Oracle Retail Predictive Application Server 13 Configuration Implementation Specialist (1Z0-576) Oracle Retail Store Inventory Management 13.2 Functional Implementer Certified Implementation Specialist (1Z0-455) Oracle Flexcube Universal Banking 11 Technical Implementation Essentials (1Z0-579) Oracle FlexCube Universal Banking 11 Basic Implementation Essentials (1Z0-561) Oracle Flexcube Universal Banking 11 Technical Implementation Essentials (1Z0-579) Oracle FLEXCUBE Direct Banking 6 Implementation Essentials (1Z0-594)   Puedes consultar la información acerca de los examenes en cada uno de los enlaces. Para prepararte los examenes sigue la Guia de estudio que encontrarás en la página de cada examen. Requisitos: ser  Partner Gold, Platinum o Diamond de Oracle y tener un usuario de Oracle Pearson Vue.  ¿Cuándo?: 27 y 28 de noviembre  a las (9:00, 12:00, 16:00)  ¿Dónde?: Core Networks, C.E.Parque Norte, Edificio Olmo, Planta 1 Serrano Galvache 56 | 28033, Madrid Para inscribirte: Create una cuenta en Pearson Vue (www.pearsonvue.com/oracle). Para Registrarte aquí. Para más información sobre el programa de especializaciones, haz clic aquí. No pierdas esta oportunidad e inscríbete hoy.  Para cualquier duda contactar con [email protected]. Ana María Gallego Partner Enablement Manager Spain and Portugal        

    Read the article

  • Parner Webcast - Innovations in Products Program

    - by Richard Lefebvre
    We are pleased to invite you to join the Innovations in Products –webcast. Innovations in Products will present Oracle Applications' Product's new functions and features including sales positioning. The key objectives of these webcasts are to inspire System Integrator's implementation personnel to conduct successful after sales in their Customer projects. Innovations in Products will be presented on the 1st Monday of each quarter after the billable day (4:00 to 5:00 PM CET). The webcast is intended for System Integrator's Implementation Certified Specialists but Innovations in Products is open for other interested Oracle Applications system Integrator's personnel as well. At first, two Oracle representatives will discuss Oracle's contribution to Partners. Then you will see product breakout session followed by Q&A with Oracle Experts. Each session will last for maximum 1 hour. A Q&A document covering all questions and answers will be made available after the webcast. What are the Benefits for partners? Find out how Innovations in Products helps you to improve your after sales Discover new functions and features so you can enrich your Customers's solution Learn more about Oracle Applications products, especially sales positioning Hear crucial questions raised by colleague alike, learn from their interest Engage and present your questions to subject experts Be inspired of the richness of Oracle Application portfolio – for your and your customer’s benefit Note: Should you already be familiar with a specific Product, then choose another one. Doing so you would expand your knowledge of the overall Applications portfolio. Some presentations contain product demonstration, although these presentations are not intended to be extremely detailed technical presentations. Note: At the latter part of this email you have also 17 links into the recent Applications Products presentations and 6 links into the Public Sector Value Proposition presentations that were presented in Innovations in Industries -program. Product breakout sessions: Topics Speaker To Register Fusion Applications Technology and Extensibility: A next-generation platform that adapts to client needs. Matthew Johnson, Sr. Director, SCM Product Development, EMEA CLICK HERE Fusion Applications - Transforming your Back-Office Accounting Function: Changing how people work in back office functions to drive value add Liam Nolan, Director, ERP Product Development, EMEA CLICK HERE Fusion HCM & Talent Overview & Extensibility: A more in-depth look into a personalized HCM solution Synco Jonkeren, Vice-President HCM Product Development & Management, EMEA CLICK HERE Fusion HCM Compensation Planning: Compensate To Compete Rosie Warner, Director, HCM Sales Development CLICK HERE Enterprise PLM for the Product Value Chain: Oracle Enterprise PLM offers Industry specific solutions that cover the Product Value Chain Ulf Köster, Sales Development Leader Enterprise PLM, Oracle Western Europe CLICK HERE Oracle's Asset Management and Maintenance Solution: What you need to know to successfully implement Oracle Asset Management solutions within Oracle Installed Base Philip Carey, Asset Management and Maintenance Solution Specialist CLICK HERE For more details please visit Innovations in Products and other breakout sessions on OPN page. Delivery Format Innovations in Products –program is a series of FREE prerecorded Applications product presentations followed by Q&A. It will be delivered over the Web. Participants have the opportunity to submit questions during the web cast via chat and subject matter experts will provide verbal answers live. Innovations in Products consists of several parallel prerecorded product breakout sessions, each lasting for max. 1 hour. At first, two Oracle representatives will discuss Oracle’s contribution to Partners. Then you’ll see the product breakout sessions followed by Q&A with Oracle Experts. A Q&A document covering all questions and answers will be made available after the webcast. You can also see Innovations in Products afterwards as its content will be available online for the next 6-12 months. The next Innovations in Products web casts will be presented as follows: July 2nd 2012 October 1st 2012 January 14th 2013 April 8th 2013. Note: Depending on local network bandwidth please allow some seconds time the presentations to download. You might want to refresh your screen by pressing F5. Duration Maximum 1 hour For further information please contact me Markku Rouhiainen. Recent Innovations in Products presentations Applications Products presented on April the 2nd, 2012 Speaker To Register Fusion CRM: Effective, Efficient and Easy James Penfold , Senior Director, Applications Product Development and Product Management CLICK HERE Fusion HCM: Talent management overview performance, goals, talent review Jaime Losantos Viñolas, Director, HCM Sales Development CLICK HERE Distributed Order Management - Fusion SCM Solution Vikram K Singla, Business Development Director, Supply Chain Management Applications, UK CLICK HERE Oracle Transportation Management Dominic Regan, Senior Director Oracle Transportation Management EMEA CLICK HERE Oracle Value Chain Planning: Demantra Sales & Operation Planning and Demantra Demand Management Lionel Albert, Senior Director Value Chain Planning, EMEA CLICK HERE Oracle CX (Customer Experience) - formerly CEM: Powering Great Customer Experiences Maria Ramirez , CRM Presales Consultant, EPC CLICK HERE EPM 11.1.2.2 Overview Nicholas Cox , EMEA Sales Development Director - Enterprise Performance Management CLICK HERE Oracle Hyperion Profitability and Cost Management, 11.1.2.1 Daniela Lazar , Senior EPM Sales Consultant, EPC CLICK HERE January the 16th 2012 Speaker To Register CRM / ATG: Best-in-Class CRM & Commerce Maria Ramirez , Associate CRM Presales Consultant, EPC CLICK HERE CRM / Automate Business Rules for Maximum Efficiency with OPA (Oracle Policy Automation) Marco Nilo, Associate CRM Presales Consultant, EPC CLICK HERE CRM / InQuira Toby Baker, Principal Sales Consultant, CRM Product Specialist Team CLICK HERE EPM / Business Intelligence Foundation Suite – Sales and Product Updates Liviu Nitescu, Senior BI Sales Consultant, EPC CLICK HERE EPM / Hyperion Planning 11.1.2.1 - Sales & Product Updates Andreea Voinea, EPM Sales Consultant, EPC CLICK HERE ERP / JDE EnterpriseOne Fulfillment Management Overview Mirela Andreea Nasta , ERP Presales Consultant, EPC CLICK HERE ERP / Spotlights on iExpenses Elena Nita ,ERP Presales Consultant, EPC CLICK HERE MDM / Master Data Management Martin Boyd , Senior Director Product Strategy CLICK HERE Product break through session Fusion Applications Human Capital Management Rosie Warner , Director, HCM Sales Development CLICK HERE Recent Innovations in Industries Value Proposition presentations January the 16th 2012 Speaker To Register Process Modernisation Iemke Idsingh Public Sector Solutions Director CLICK HERE Shared Services Ann Smith Business Development Director, Shared Services CLICK HERE Strengthening Financial Discipline Whilst Delivering Cashable Savings Philippa Headley UK Sales Development Director Public Sector - EPM Solutions CLICK HERE Social Welfare Industry Solutions Christian Wernberg-Tougaard Industry Director - Social Welfare CLICK HERE Police Industry Solutions Jeff Penrose Solution Sales Director CLICK HERE Tax and Revenue Management Industry Solutions Andre van der Post Global Director - Tax Solutions and Strategy CLICK HERE  

    Read the article

  • Highlights from the Oracle Customer Experience Summit @ OpenWorld

    - by Kathryn Perry
    A guest post by David Vap, Group Vice President, Oracle Applications Product Development The Oracle Customer Experience Summit was the first-ever event covering the full breadth of Oracle's CX portfolio -- Marketing, Sales, Commerce, and Service. The purpose of the Summit was to articulate the customer experience imperative and to showcase the suite of Oracle products that can help our customers create the best possible customer experience. This topic has always been a very important one, but now that there are so many alternative companies to do business with and because people have such public ways to voice their displeasure, it's necessary for vendors to have multiple listening posts in place to gauge consumer sentiment. They need to know what is going on in real time and be able to react quickly to turn negative situations into positive ones. Those can then be shared in a social manner to enhance the brand and turn the customer into a repeat customer. The Summit was focused on Oracle's portfolio of products and entirely dedicated to customers who are committed to building great customer experiences within their businesses. Rather than DBAs, the attendees were business people looking to collaborate with other like-minded experts and find out how Oracle can help in terms of technology, best practices, and expertise. The event was at the Westin St. Francis Hotel in San Francisco as part of Oracle OpenWorld. We had eight hundred people attend, which was great for the first year. Next year, there's no doubt in my mind, we can raise that number to 5,000. Alignment and Logic Oracle's Customer Experience portfolio is made up of a combination of acquired and organic products owned by many people who are new to Oracle. We include homegrown Fusion CRM, as well as RightNow, Inquira, OPA, Vitrue, ATG, Endeca, and many others. The attendees knew of the acquisitions, so naturally they wanted to see how the products all fit together and hear the logic behind the portfolio. To tell them about our alignment, we needed to be aligned. To accomplish that, a cross functional team at Oracle agreed on the messaging so that every single Oracle presenter could cover the big picture before going deep into a product or topic. Talking about the full suite of products in one session produced overflow value for other products. And even though this internal coordination was a huge effort, everyone saw the value for our customers and for our long-term cooperation and success. Keynotes, Workshops, and Tents of Innovation We scored by having Seth Godin as our keynote speaker ? always provocative and popular. The opening keynote was a session orchestrated by Mark Hurd, Anthony Lye, and me. Mark set the stage by giving real-world examples of bad customer experiences, Anthony clearly articulated the business imperative for addressing these experiences, and I brought it all to life by taking the audience around the Customer Lifecycle and showing demos and videos, with partners included at each of the stops around the lifecycle. Brian Curran, a VP for RightNow Product Strategy, presented a session that was in high demand called The Economics of Customer Experience. People loved hearing how to build a business case and justify the cost of building a better customer experience. John Kembel, another VP for RightNow Product Strategy, held a workshop that customers raved about. It was based on the journey mapping methodology he created, which is a way to talk to customers about where they want to make improvements to their customers' experiences. He divided the audience into groups led by facilitators. Each person had the opportunity to engage with experts and peers and construct some real takeaways. From left to right: Brian Curran, John Kembel, Seth Godin, and George Kembel The conference hotel was across from Union Square so we used that space to set up Innovation Tents. During the day we served lunch in the tents and partners showed their different innovative ideas. It was very interesting to see all the technologies and advancements. It also gave people a place to mix and mingle and to think about the fringe of where we could all take these ideas. Product Portfolio Plus Thought Leadership Of course there is always room for improvement, but the feedback on the format of the conference was positive. Ninety percent of the sessions had either a partner or a customer teamed with an Oracle presenter. The presentations weren't dry, one-way information dumps, but more interactive. I just followed up with a CEO who attended the conference with his Head of Marketing. He told me that they are using John Kembel's journey mapping methodology across the organization to pull people together. This sort of thought leadership in these highly competitive areas gives Oracle permission to engage around the technology. We have to differentiate ourselves and it's harder to do on the product side because everyone looks the same on paper. But on thought leadership ? we can, and did, take some really big steps. David VapGroup Vice PresidentOracle Applications Product Development

    Read the article

  • RightNow CX @ OpenWorld: What to Experience

    - by Tony Berk
    We want to welcome our RightNow CX customers to Oracle OpenWorld next week. Get ready for a great week and a whole new experience! For a high level overview of what is going on during the week, please review these previous posts: Is There a Cloud Over OpenWorld? and What to "CRM" in San Francisco? CRM Highlights for OpenWorld '12. Also, don't forget you can add on the Customer Experience Summit @ OpenWorld to make your week even more complete and get involved with the Experience Revolution! Below is a highlight of only some of the RightNow related sessions at OpenWorld. Please use OpenWorld Schedule Builder or check the OpenWorld Content Catalog for all of the session details and any time or location changes. Tip: Pre-enrolled session registrants via Schedule Builder are allowed into the session rooms before anyone else, so Schedule Builder will guarantee you a seat. Many of the sessions below will likely be at capacity. No better way to start off than hearing where Oracle RightNow is going! Oracle RightNow CX Cloud Service Vision and Roadmap (CON9764) - Oct 1, 10:45 AM. Oracle RightNow CX Cloud Service combines Web, social, and contact center experiences for a unified, cross-channel service solution in the cloud, enabling organizations to increase sales and adoption, build trust, strengthen relationships, and reduce costs and effort. Come to this session to hear from David Vap and his team of Oracle experts about where the product is going and how Oracle is committed to accelerating the pace of innovation and value to its customers. Interested in the Cloud and want to know why some leading CIOs are moving to the cloud? You can hear first hand from CIOs from Emerson, Intuit and Overstock.com: CIOs and Governance in the Cloud (CON9767) - Oct 3, 11:45 AM.   And of course there are a number of sessions that drill down into more specific areas. Here are just a few: Deliver Outstanding Customer Experiences: Oracle RightNow Dynamic Agent Desktop Cloud Service (CON9771) - Oct 1, 4:45 PM. This session covers how companies have delivered exceptional customer experiences and how the Oracle RightNow Dynamic Agent Desktop Cloud Service roadmap will evolve in the future. The Oracle RightNow Contact Center Experience suite includes incident management, knowledge, guided processes, and other service capabilities to unify the customer experience across channels. Come learn about the powerful tools that enable even your junior agents to consistently provide outstanding service across all customer interaction channels. Self-Service in the Age of Data Intimacy (CON11516) - Oct 1, 3:15. Even though businesses are generating more and more data around their relationships and interactions with customers, very little of the information a business generates ends up available to the contact center and even less is made available to the online service experience. The generic one-size-fits-all approach that typifies most online service experiences ultimately fails to address all user needs, and that failure ultimately leads to the continued use of high-cost agent-assisted channels for low-value interactions. This session introduces Oracle RightNow Web Experience’s Virtual Assistant and discusses how you can deliver rich, engaging, highly personalized experiences with the quality of agent-assisted service at a much lower cost. Improve Chat Experiences: Best Practices for Chat Pilots and Deployments (CON11517) - Oct 1, 4:45 PM. Today’s organizations are challenged to grow revenue and retain customers with fewer resources, and many have turned to chat as an approach to improving the customer experience, increasing sales conversions, and reducing costs at the same time. From setting goals and metrics and training staff to customizing and tuning the solution, this session provides best practices and lessons learned from a broad set of implementations to help you get the most out of your chat solution. Differentiated Experience with Web Service (CON9770) - Oct 2, 1:15 PM. A reputation for excellent customer service can differentiate your brand and drive revenue. In this session, learn how to develop that reputation by transforming your online self-service into a highly interactive, branded customer experience. See live examples of how Oracle RightNow Web Experience has helped customers deliver on their Web service strategies. Unifying the Agent’s Engagement Console (CON11518) - Oct 2, 1:15 PM. Does your customer experience suffer because your agents are toggling between multiple tools? Do your agent productivity and morale suffer as well? Come to this session to learn how Oracle RightNow CX Cloud Service seamlessly unifies these disparate systems into a single engagement console. Regardless of channel, powerful adaptive tools consistently guide agents across contextually aware personalized workflows. Great agent experiences drive great customer experiences. Oracle RightNow CX Cloud Service and the Oracle Customer Experience Portfolio (CON9775) - Oct 3, 10:15 AM. This session covers how Oracle’s integrated suite of customer experience (CX) products fits with the Oracle CX portfolio of products (Oracle Fusion Customer Relationship Management; the Oracle ATG, Oracle Endeca, and Oracle Knowledge product families; and Oracle Business Intelligence) to increase revenues, strengthen customer relationships, and reduce costs across the entire end-to-end customer lifecycle for companies that sell to consumers and those that sell to businesses. Greater Insights from Customer Engagements (CON9773) Oct 4, 12:45 PM. In this session, hear how to leverage service interaction insights, customer feedback, and segmented service engagements to improve the customer experience. Discover how customers, such as J&P Cycles, learn and take action based on business insights gained through their customer engagements. Again, these are just some of the sessions, so check out the Content Catalog for details on Knowledge Management, Customization, Integration and more in the Oracle Develop stream for Customer Experience. Be sure to visit the Oracle DEMOgrounds in the Moscone West Exhibit Hall. If this is your first OpenWorld, welcome! If you are returning, hi again and enjoy!

    Read the article

  • What to "CRM" in San Francisco? CRM Highlights for OpenWorld '12

    - by Tony Berk
    There is plenty to SEE for CRM during OpenWorld in San Francisco, September 30 - October 4! As I mentioned in my earlier post about some of the keynote sessions, Is There a Cloud Over OpenWorld?, I'm going try to highlight some key sessions to help you find the best sessions for you. Interested to find out where Oracle CRM products are headed, then find your "roadmap" session. Here are some of the sessions in the CRM Track that you might want to consider attending for products you currently own or might consider for the future. I think you'll agree, there is quite a bit of investment going on across Oracle CRM. Please use OpenWorld Schedule Builder or check the OpenWorld Content Catalog for all of the session details and any time or location changes. Tip: Pre-enrolled session registrants via Schedule Builder are allowed into the session rooms before anyone else, so Schedule Builder will guarantee you a seat. Many of the sessions below will likely be at capacity. General Session: Oracle Fusion CRM—Improving Sales Effectiveness, Efficiency, and Ease of Use (Session ID: GEN9674) - Oct 2, 11:45 AM - 12:45 PM. Anthony Lye, Senior VP, Oracle leads this general session focused on Oracle Fusion CRM. Oracle Fusion CRM optimizes territories, combines quota management and incentive compensation, integrates sales and marketing, and cleanses and enriches data—all within a single application platform. Oracle Fusion can be configured, changed, and extended at runtime by end users, business managers, IT, and developers. Oracle Fusion CRM can be used from the Web, from a smartphone, from Microsoft Outlook, or from an iPad. Deloitte, sponsor of the CRM Track, will also present key concepts on CRM implementations. Oracle Fusion Customer Relationship Management: Overview/Strategy/Customer Experiences/Roadmap (CON9407) - Oct 1, 3:15PM - 4:15PM. In this session, learn how Oracle Fusion CRM enables companies to create better sales plans, generate more quality leads, and achieve higher win rates and find out why customers are adopting Oracle Fusion CRM. Gain a deeper understanding of the unique capabilities only Oracle Fusion CRM provides, and learn how Oracle’s commitment to CRM innovation is driving a wide range of future enhancements. Oracle RightNow CX Cloud Service Vision and Roadmap (CON9764) - Oct 1, 10:45 AM - 11:45 AM. Oracle RightNow CX Cloud Service combines Web, social, and contact center experiences for a unified, cross-channel service solution in the cloud, enabling organizations to increase sales and adoption, build trust, strengthen relationships, and reduce costs and effort. Come to this session to hear from Oracle experts about where the product is going and how Oracle is committed to accelerating the pace of innovation and value to its customers. Siebel CRM Overview, Strategy, and Roadmap (CON9700) - Oct 1, 12:15PM - 1:15PM. The world’s most complete CRM solution, Oracle’s Siebel CRM helps organizations differentiate their businesses. Come to this session to learn about the Siebel product roadmap and how Oracle is committed to accelerating the pace of innovation and value for its customers on this platform. Additionally, the session covers how Siebel customers can leverage many Oracle assets such as Oracle WebCenter Sites; InQuira, RightNow, and ATG/Endeca applications, and Oracle Policy Automation in conjunction with their current Siebel investments. Oracle Fusion Social CRM Strategy and Roadmap: Future of Collaboration and Social Engagement (CON9750) - Oct 4, 11:15 AM - 12:15 PM. Social is changing the customer experience! Come find out how Oracle can help you know your customers better, encourage brand affinity, and improve collaboration within your ecosystem. This session reviews Oracle’s social media solution and shows how you can discover hidden insights buried in your enterprise and social data. Also learn how Oracle Social Network revolutionizes how enterprise users work, collaborate, and share to achieve successful outcomes. Oracle CRM On Demand Strategy and Roadmap (CON9727) - Oct 1, 10:45AM - 11:45AM. Oracle CRM On Demand is a powerful cloud-based customer relationship management solution. Come to this session to learn directly from Oracle experts about future product plans and hear how Oracle is committed to accelerating the pace of innovation and value to its customers. Knowledge Management Roadmap and Strategy (CON9776) - Oct 1, 12:15PM - 1:15PM. Learn how to harness the knowledge created as a natural byproduct of day-to-day interactions to lower costs and improve customer experience by delivering the right answer at the right time across channels. This session includes an overview of Oracle’s product roadmap and vision for knowledge management for both the Oracle RightNow and Oracle Knowledge (formerly InQuira) product families. Oracle Policy Automation Roadmap: Supercharging the Customer Experience (CON9655) - Oct 1, 12:15PM - 1:15PM. Oracle Policy Automation delivers rapid customer value by streamlining the capture, analysis, and deployment of policies across every facet of the customer experience. This session discusses recent Oracle Policy Automation enhancements for policy analytics; the latest Oracle Policy Automation Connector for Siebel; and planned new capabilities, including availability with the Oracle RightNow product line. There is much more, so stay tuned for more highlights or check out the Content Catalog and search for your areas of interest. Which session are you most interested in? Make your suggestions! But no voting for Pearl Jam or Kings of Leon. Those are after hours! 

    Read the article

  • Highlights from the Oracle Customer Experience Summit @ OpenWorld

    - by Richard Lefebvre
    The Oracle Customer Experience Summit was the first-ever event covering the full breadth of Oracle's CX portfolio -- Marketing, Sales, Commerce, and Service. The purpose of the Summit was to articulate the customer experience imperative and to showcase the suite of Oracle products that can help our customers create the best possible customer experience. This topic has always been a very important one, but now that there are so many alternative companies to do business with and because people have such public ways to voice their displeasure, it's necessary for vendors to have multiple listening posts in place to gauge consumer sentiment. They need to know what is going on in real time and be able to react quickly to turn negative situations into positive ones. Those can then be shared in a social manner to enhance the brand and turn the customer into a repeat customer. The Summit was focused on Oracle's portfolio of products and entirely dedicated to customers who are committed to building great customer experiences within their businesses. Rather than DBAs, the attendees were business people looking to collaborate with other like-minded experts and find out how Oracle can help in terms of technology, best practices, and expertise. The event was at the Westin St. Francis Hotel in San Francisco as part of Oracle OpenWorld. We had eight hundred people attend, which was great for the first year. Next year, there's no doubt in my mind, we can raise that number to 5,000. Alignment and Logic Oracle's Customer Experience portfolio is made up of a combination of acquired and organic products owned by many people who are new to Oracle. We include homegrown Fusion CRM, as well as RightNow, Inquira, OPA, Vitrue, ATG, Endeca, and many others. The attendees knew of the acquisitions, so naturally they wanted to see how the products all fit together and hear the logic behind the portfolio. To tell them about our alignment, we needed to be aligned. To accomplish that, a cross functional team at Oracle agreed on the messaging so that every single Oracle presenter could cover the big picture before going deep into a product or topic. Talking about the full suite of products in one session produced overflow value for other products. And even though this internal coordination was a huge effort, everyone saw the value for our customers and for our long-term cooperation and success. Keynotes, Workshops, and Tents of Innovation We scored by having Seth Godin as our keynote speaker ? always provocative and popular. The opening keynote was a session orchestrated by Mark Hurd, Anthony Lye, and me. Mark set the stage by giving real-world examples of bad customer experiences, Anthony clearly articulated the business imperative for addressing these experiences, and I brought it all to life by taking the audience around the Customer Lifecycle and showing demos and videos, with partners included at each of the stops around the lifecycle. Brian Curran, a VP for RightNow Product Strategy, presented a session that was in high demand called The Economics of Customer Experience. People loved hearing how to build a business case and justify the cost of building a better customer experience. John Kembel, another VP for RightNow Product Strategy, held a workshop that customers raved about. It was based on the journey mapping methodology he created, which is a way to talk to customers about where they want to make improvements to their customers' experiences. He divided the audience into groups led by facilitators. Each person had the opportunity to engage with experts and peers and construct some real takeaways. The conference hotel was across from Union Square so we used that space to set up Innovation Tents. During the day we served lunch in the tents and partners showed their different innovative ideas. It was very interesting to see all the technologies and advancements. It also gave people a place to mix and mingle and to think about the fringe of where we could all take these ideas. Product Portfolio Plus Thought Leadership Of course there is always room for improvement, but the feedback on the format of the conference was positive. Ninety percent of the sessions had either a partner or a customer teamed with an Oracle presenter. The presentations weren't dry, one-way information dumps, but more interactive. I just followed up with a CEO who attended the conference with his Head of Marketing. He told me that they are using John Kembel's journey mapping methodology across the organization to pull people together. This sort of thought leadership in these highly competitive areas gives Oracle permission to engage around the technology. We have to differentiate ourselves and it's harder to do on the product side because everyone looks the same on paper. But on thought leadership ? we can, and did, take some really big steps. David Vap Group Vice President Oracle Applications Product Development

    Read the article

  • What to "CRM" in San Francisco? CRM Highlights for OpenWorld '12

    - by Richard Lefebvre
    There is plenty to SEE for CRM during OpenWorld in San Francisco, September 30 - October 4! Here are some of the sessions in the CRM Track that you might want to consider attending for products you currently own or might consider for the future. I think you'll agree, there is quite a bit of investment going on across Oracle CRM. Please use OpenWorld Schedule Builder or check the OpenWorld Content Catalog for all of the session details and any time or location changes. Tip: Pre-enrolled session registrants via Schedule Builder are allowed into the session rooms before anyone else, so Schedule Builder will guarantee you a seat. Many of the sessions below will likely be at capacity. General Session: Oracle Fusion CRM—Improving Sales Effectiveness, Efficiency, and Ease of Use (Session ID: GEN9674) - Oct 2, 11:45 AM - 12:45 PM. Anthony Lye, Senior VP, Oracle leads this general session focused on Oracle Fusion CRM. Oracle Fusion CRM optimizes territories, combines quota management and incentive compensation, integrates sales and marketing, and cleanses and enriches data—all within a single application platform. Oracle Fusion can be configured, changed, and extended at runtime by end users, business managers, IT, and developers. Oracle Fusion CRM can be used from the Web, from a smartphone, from Microsoft Outlook, or from an iPad. Deloitte, sponsor of the CRM Track, will also present key concepts on CRM implementations. Oracle Fusion Customer Relationship Management: Overview/Strategy/Customer Experiences/Roadmap (CON9407) - Oct 1, 3:15PM - 4:15PM. In this session, learn how Oracle Fusion CRM enables companies to create better sales plans, generate more quality leads, and achieve higher win rates and find out why customers are adopting Oracle Fusion CRM. Gain a deeper understanding of the unique capabilities only Oracle Fusion CRM provides, and learn how Oracle’s commitment to CRM innovation is driving a wide range of future enhancements. Oracle RightNow CX Cloud Service Vision and Roadmap (CON9764) - Oct 1, 10:45 AM - 11:45 AM. Oracle RightNow CX Cloud Service combines Web, social, and contact center experiences for a unified, cross-channel service solution in the cloud, enabling organizations to increase sales and adoption, build trust, strengthen relationships, and reduce costs and effort. Come to this session to hear from Oracle experts about where the product is going and how Oracle is committed to accelerating the pace of innovation and value to its customers. Siebel CRM Overview, Strategy, and Roadmap (CON9700) - Oct 1, 12:15PM - 1:15PM. The world’s most complete CRM solution, Oracle’s Siebel CRM helps organizations differentiate their businesses. Come to this session to learn about the Siebel product roadmap and how Oracle is committed to accelerating the pace of innovation and value for its customers on this platform. Additionally, the session covers how Siebel customers can leverage many Oracle assets such as Oracle WebCenter Sites; InQuira, RightNow, and ATG/Endeca applications, and Oracle Policy Automation in conjunction with their current Siebel investments. Oracle Fusion Social CRM Strategy and Roadmap: Future of Collaboration and Social Engagement (CON9750) - Oct 4, 11:15 AM - 12:15 PM. Social is changing the customer experience! Come find out how Oracle can help you know your customers better, encourage brand affinity, and improve collaboration within your ecosystem. This session reviews Oracle’s social media solution and shows how you can discover hidden insights buried in your enterprise and social data. Also learn how Oracle Social Network revolutionizes how enterprise users work, collaborate, and share to achieve successful outcomes. Oracle CRM On Demand Strategy and Roadmap (CON9727) - Oct 1, 10:45AM - 11:45AM. Oracle CRM On Demand is a powerful cloud-based customer relationship management solution. Come to this session to learn directly from Oracle experts about future product plans and hear how Oracle is committed to accelerating the pace of innovation and value to its customers. Knowledge Management Roadmap and Strategy (CON9776) - Oct 1, 12:15PM - 1:15PM. Learn how to harness the knowledge created as a natural byproduct of day-to-day interactions to lower costs and improve customer experience by delivering the right answer at the right time across channels. This session includes an overview of Oracle’s product roadmap and vision for knowledge management for both the Oracle RightNow and Oracle Knowledge (formerly InQuira) product families. Oracle Policy Automation Roadmap: Supercharging the Customer Experience (CON9655) - Oct 1, 12:15PM - 1:15PM. Oracle Policy Automation delivers rapid customer value by streamlining the capture, analysis, and deployment of policies across every facet of the customer experience. This session discusses recent Oracle Policy Automation enhancements for policy analytics; the latest Oracle Policy Automation Connector for Siebel; and planned new capabilities, including availability with the Oracle RightNow product line. There is much more, so stay tuned for more highlights or check out the Content Catalog and search for your areas of interest. 

    Read the article

  • conversion of DNA to Protein - c structure issue

    - by sam
    I am working on conversion of DNA sequence to Protein sequence. I had completed all program only one error I found there is of structure. dna_codon is a structure and I am iterating over it.In first iteration it shows proper values of structure but from next iteration, it dont show the proper value stored in structure. Its a small error so do not think that I havnt done anything and downvote. I am stucked here because I am new in c for structures. CODE : #include <stdio.h> #include<string.h> void main() { int i, len; char short_codons[20]; char short_slc[1000]; char sequence[1000]; struct codons { char amino_acid[20], slc[20], dna_codon[40]; }; struct codons c1 [20]= { {"Isoleucine", "I", "ATT, ATC, ATA"}, {"Leucine", "L", "CTT, CTC, CTA, CTG, TTA, TTG"}, {"Valine", "V", "GTT, GTC, GTA, GTG"}, {"Phenylalanine", "F", "TTT, TTC"}, {"Methionine", "M", "ATG"}, {"Cysteine", "C", "TGT, TGC"}, {"Alanine", "A", "GCT, GCC, GCA, GCG"}, {"Proline", "P", "CCT, CCC, CCA,CCG "}, {"Threonine", "T", "ACT, ACC, ACA, ACG"}, {"Serine", "S", "TCT, TCC, TCA, TCG, AGT, AGC"}, {"Tyrosine", "Y", "TAT, TAC"}, {"Tryptophan", "W", "TGG"}, {"Glutamine", "Q", "CAA, CAG"}, {"Aspargine","N" "AAT, AAC"}, {"Histidine", "H", "CAT, CAC"}, {"Glutamic acid", "E", "GAA, GAG"}, {"Aspartic acid", "D", "GAT, GAC"}, {"Lysine", "K", "AAA, AAG"}, {"Arginine", "R", "CGT, CGC, CGA, CGG, AGA, AGG"}, {"Stop codons", "Stop", "AA, TAG, TGA"} }; int count = 0; printf("Enter the sequence: "); gets(sequence); char *input_string = sequence; char *tmp_str = input_string; int k; char *pch; while (*input_string != '\0') { char string_3l[4] = {'\0'}; strncpy(string_3l, input_string, 3); printf("\n-----------%s & %s----------", string_3l, tmp_str ); for(k=0;k<20;k++) { //printf("@REAL - %s", c1[0].dna_codon); printf("@ %s", c1[k].dna_codon); int x; x = c1[k].dna_codon; pch = strtok(x, ","); while (pch != NULL) { printf("\n%d : %s with %s", k, string_3l, pch); count=strcmp(string_3l, pch); if(count==0) { strcat(short_slc, c1[k].slc); printf("\n==>%s", short_slc); } pch = strtok (NULL, " ,.-"); } } input_string = input_string+3; } printf("\nProtien sequence is : %s\n", short_slc); } INPUT : TAGTAG OUTPUT : If you see output of printf("\n-----------%s & %s----------", string_3l, tmp_str ); in both iterations, we found that values defined in structure are reduced. I want to know why structure reduces it or its my mistake? because I am stucked here

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • A Look Back at 2010 Predictions

    - by David Dorf
    Now is the time of year people make their predictions for next year, but before I start thinking about 2011 it's worth a look back to see how my predictions for 2010 fared. 1. Borders and Blockbuster bite the dust. I would have never predicted a strong brand such as Circuit City could die, but now I know it can happen to anyone. Borders has lost the battle with Barnes & Noble and Blockbuster has lost to Netflix. And just to be sure, Amazon put an extra nail in each coffin. Borders received additional investment from Bennett LeBow to keep it afloat, but the stock is down around $1.25 with no profits in sight. Blockbuster filed for bankruptcy back in September. 2. Every retailer finally has a page on Facebook... but very few figure out how to keep fans engaged. Retailer postings become noise, and fans start to unsubscribe. Twitter goes in the same direction. A few standout retailers will figure out how to use social media, and the rest will remain dumbfounded. Most retailers are on the Facebook bandwagon, and their fan bases seem to be increasing thanks to promotions like The Gap's logo redesign, Lowes' black Friday sneak peak, and Walmart's Crowd Savers. There are several examples of f-commerce advancements, including some interesting integrations from Amazon.3. Smartphones consolidate and grow. More and more people will step-up to smartphones, most of which will choose iPhone, Blackberry, and Android phones. Other smartphones will vanish, and networks will start to strain. But retailers will finally embrace mobile as the next big channel. Retail marketing departments will build mobile apps without the help of their IT department, and eventually they will get into a bind. Android has been on a tear lately stealing market share from Blackberry. Palm and Microsoft are trending down, and Apple is holding steady. Smartphone sales are up 15% and expected to continue. Retailers understand the importance of mobile, and some innovative applications have been produced this year. 4. Google helps the little guys. Google will push its Favorite Places project to help give exposure to small retailers and restaurants. They will enable small retailers to act like big ones by providing storefronts, detailed product information, and coupons for consumers. Google will find a way to bring augmented reality to the masses. I can't say I've seen much new from Google regarding Favorite Places, but they've continued to push local product search. From the PC or smartphone, consumers can search for products and see which nearby stores have it stock. Oracle Retail even productized an integration to Google to support this effort. I suppose if Google ever buys Groupon then it will bring them even closer to local shopping. Google talked about augmented humanity, but that has nothing to do with augmented reality. 5. Steve Jobs Is Bugs Bunny and Steve Ballmer is Elmer Fudd. (OK, I stole that headline from an InformationWeek article. I couldn't resist.) Both Apple and Microsoft will continue to open new stores, but only Apple will show real growth. POSReady 2009 (formerly WEPOS) will continue to share the POS market with Linux. The iPhone and iPod will continue to capture market share, but there won't be an Apple tablet. There won't be an Apple tablet? What was I thinking? While Apple has well over 300 stores, there are less than 10 Microsoft stores. Initial impressions show that even though Microsoft is locating its store near Apple Stores, they are not converting customers, with shoppers citing a lack of assortment and high prices. 6. Consolidation of e-commerce software providers. Software vendors in the areas of search, reviews, online call-centers, payments, and e-commerce will consolidate, partly driven by the success of m-commerce and SaaS. Amazon will find someone else to buy, and eBay will continue to lose momentum. Consolidation of e-commerce providers continued with IBM acquiring Sterling Commerce and CoreMetrics, and Oracle recently announcing the acquisition of ATG. Amazon grabbed Zappos, Woot, and Diapers.com to continue its dominance of online selling. While eBay's Marketplace growth may have slowed, its PayPal division is doing quite well, fueled in part by demand for mobile payments. 7. Book publishers mirror music labels. Just as the iPod brought digital downloads to the masses, the Kindle and Nook will power the e-book revolution. Books will continue to use DRM for a few more years before following the path of music. Publishers will try to preserve the margins of hardbacks by associating e-book releases with paperbacks. Amazon has done a good job providing e-reader clients for smartphones, PCs, and tablets. Competition from Barnes & Noble has forced Amazon to support book loaning, and both companies are making it easier for people to publish ebooks (with or without DRM). Progress is slow but steady. 8. NFC makes inroads, RFID treads water. Near Field Communications start to appear in mobile phones, and retailers beta test its use for payments and loyalty programs. RFID tag costs come down a bit, but not enough to spur accelerated adoption.Nokia announced plans to offer NFC-enabled phones in 2011, and rumors are swirling about NFC in the upcoming iPhone.  I think NFC is heading in the right direction, and I've heard more interest from retailers about specialized uses for RFID.9. Digital Signage goes the way of augmented reality. People use their camera phones to leave geo-tagged notes all over cities, rating stores and restaurants, and "painting" graffiti. But people get tired of holding their phones in front of their faces, so AR glasses are offered in much the same way bluetooth headsets emerged. Retailers experiement with in-store advertising using AR. Several retailers like Pizza Hut, Benetton, and Target have experimented with AR but its still somewhat of a gimmick used by marketing.  I think this prediction is a year or two too early. 10. JDA flip-flops again. After announcing their embracing of the .Net architecture, then switching to J2EE after the Manugistics acquisition, JDA will finally decide to standardize on Apple's Objective C. Everything will be ported to the iPhone and be available on the AppStore. After all, there's not much left to try. This was, of course, a joke but the sentiment is still valid.  JDA seems more supply-chain focused than retail focused, which is a an outcrop if their i2 acquisition.  Of the 10 predictions, I'm going to say I got 6 somewhat correct.  (Don't you just love grading your own paper?)  Soon I'll post my predictions for 2011 so be on the lookout.  Until then here's one more prediction:  Va Tech beats Stanford in the Orange Bowl -- count on it!

    Read the article

  • ???? ????? ????? ?????? ????? 10.2.0.4

    - by gadi.chen
    Normal 0 false false false EN-US X-NONE HE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} DBA's ?????? ?????? ???? ??? ????? ??? ?????? ???? ????? ????? ??? ?????. ??? ????? ???? ????? ???? ??????? 30-Apr-2011  ???? ???? ?????? ????? ???? ??????? 10.2.0.4. ?????? ????? EBS ?? ????? ????? ????? ????? ??? ??? ???? ????? ?????? extended support, ???? ???? 11.5.10.2 ??? ???? ? 01-Dec-2011 . ) ????? ?????? ????  Minimum Baseline For Extended Support ????? ?????: 883202.1) ???? ????? ????? ?????? ?????? ?? ????? ????? ????? ????????? ???? ?? :   # ATG.RUP6 # Forms6i Patchset 19 # JRE 1.6.0_03       ???? ???? ?????? EBS ?? ????? ?????? ?????? ????? ???? ?????? ?? ,?? ??? ????? ?? ???? ??????.   ????? ???? 10.2.0.4 ?? ???? ?patches ????? ????  30-Apr-2011 . ???? ????  patches ????? ?? ????? ????? 10.2.0.5   .   ???? ????? EBS ????? 3 ?????? ?????? ?? ???: 1.      ????? ????? 11.2.0.2 - ??? ???? ????? ??????? ?????? ??? EBS ??????? 11i   ? R12 2.      ????? ????? 11.1.0.7 -  ??? ???? ????? ?????? ????? ????? 11.1 ??? ?????. 3.      ?????/????? patch 10.2.0.5 -   ???? ????? ?????? ????? ?????? ????? 10gR2 . v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false false EN-US X-NONE HE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";}   ?????? ??????? ???? ??????:     http://blogs.oracle.com/stevenChan/2011/01/ecs_10gr2_10204.html On Database Patching and Support: A Primer for E-Business Suite Users Oracle Database 10.2 End of Premier Support -- Frequently Asked Questions (Note 1130327.1)        

    Read the article

< Previous Page | 2 3 4 5 6