Search Results

Search found 150 results on 6 pages for 'atg dynamo'.

Page 3/6 | < Previous Page | 1 2 3 4 5 6  | Next Page >

  • Webcast Replay Available: E-Business Suite Release 12.1 Upgrade Best Practices - Technical Insight

    - by BillSawyer
    I am pleased to release the replay and presentation for the latest ATG Live Webcast: E-Business Suite Release 12.1 Upgrade Best Practices - Technical Insight (Presentation)Udayan Parvate, Director, E-Business Suite Release Engineering and Uday Moogala, Senior Principal Engineer, Applications Performance discussed the best practices that you can apply when upgrading your E-Business Suite instance to Release 12.1 and beyond. They discussed upgrade paths, resources, and practices to minimize downtime during the upgrade. (April 2012)Finding other recorded ATG webcastsThe catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • ATG Live Webcast March 29: Diagnosing E-Business Suite JVM and Forms Performance Issues (Performance Series Part 4 of 4)

    - by BillSawyer
    The next webcast in our popular EBS series on performance management is going to be a showstopper.  Dave Suri, Project Lead, Applications Performance and Gustavo Jimenez, Senior Development Manager will discuss some of the steps involved in triaging and diagnosing E-Business Suite systems related to JVM and Forms components. Please join us for our next ATG Live Webcast on Mar. 29, 2012: Triage and Diagnostics for E-Business Suite JVM and Forms The topics covered in this webcast will be: Overall Menu/Sections Architecture Patches/Certified browsers/jdk versions JVM Tuning JVM Tools (jstat,eclipse mat, ibm tda) Forms Tools (strace/FRD) Java Concurrent Program options location Case studies Case Studies JVM Thread dump case for Oracle Advanced Product Catalog Forms FRD trace relating to Saving an SR Java Concurrent Program for BT Date:               Thursday, March 29, 2012Time:              8:00 AM - 9:00 AM Pacific Standard TimePresenters:  Dave Suri, Project Lead, Applications Performance                        Gustavo Jimenez, Senior Development ManagerWebcast Registration Link (Preregistration is optional but encouraged)To hear the audio feed:   Domestic Participant Dial-In Number:            877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              99342To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  597073984 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here.If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com. 

    Read the article

  • Webcast Replay Available: E-Business Suite Data Protection

    - by BillSawyer
    I am pleased to release the replay and presentation for the latest ATG Live Webcast: E-Business Suite Data Protection (Presentation)   Robert Armstrong, Product Strategy Security Architect and Eric Bing, Senior Director discussed the best practices and recommendations for securing your E-Business Suite data.Finding other recorded ATG webcasts The catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • ATG Live Webcast Nov. 15th: Best Practices for Using EBS SDK for Java with Oracle ADF

    - by Bill Sawyer
    Oracle E-Business Suite delivers functionality for handling the core business of your organization. This webcast provides best practices for how to use Oracle Application Development Framework (Oracle ADF) with the Oracle E-Business Suite SDK for Java.  Topics include: Session management with ADF Handling security Embedding ADF regions in OA Framework pages Best practices and more Date:               Thursday, November 15, 2012Time:              8:00 AM - 9:00 AM Pacific Standard TimePresenters:   Sara Woodhull, Principal Product Manager, E-Business Suite ATG                         Juan Camilo Ruiz, Principal Product Manager, ADF Webcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:    Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103192To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  591862924 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • ATG Live Webcast Dec. 13th: EBS Future Directions: Deployment and System Administration

    - by Bill Sawyer
    This webcast provides an overview of the improvements to Oracle E-Business Suite deployment and system administration that are planned for the upcoming EBS 12.2 release.   It is targeted to system administrators, DBAs, developers, and implementers. This webcast, led by Max Arderius, Manager Applications Technology Group, compares existing deployment and system administration tools for EBS 12.0 and 12.1 with the upcoming functionality planned for EBS 12.2. This was a very popular session at OpenWorld 2012, and I am pleased to bring it to the ATG Live Webcast series.  This session will cover: Understanding the Oracle E-Business Suite 12.2 Architecture Installing & Upgrading EBS 12.2 Online Patching in EBS 12.2 Cloning in EBS 12.2 Date:             Thursday, December 13, 2012Time:             8:00 AM - 9:00 AM Pacific Standard TimePresenter:   Max Arderius, Manager Applications Technology Group Webcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:   Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103194To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  593672805If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • ATG Live Webcast Nov. 8th: Advanced Management of EBS with Oracle Enterprise Manager

    - by Bill Sawyer
    The task of managing and monitoring Oracle E-Business Suite environments can be very challenging. The Application Management Pack plug-in is part of Oracle Enterprise Manager 12c Application Management Suite for Oracle E-Business Suite. The Application Management Pack plug-in is designed to monitor and manage all the different technologies that constitute Oracle E-Business Suite applications, including midtier, configuration, host, and database management—to name just a few. Customers that have implemented Oracle Enterprise Manager have experienced dramatic improvements in system visibility, diagnostic capability, and administrator productivity. This webcast will highlight the key features and benefits of Oracle Enterprise Manager, the latest version of the Oracle Application Management Suite for Oracle E-Business Suite. Advanced Management of Oracle E-Business Suite with Oracle Enterprise Manager Date:                Thursday, November 8, 2012Time:               8:00 AM - 9:00 AM Pacific Standard TimePresenters:   Angelo Rosado, Principal Product Manager, E-Business Suite ATG                         Lauren Cohn, Principal Curriculum Developer, E-Business Suite ATGWebcast Registration Link (Preregistration is optional but encouraged)To hear the audio feed:   Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103191To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  591460967 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • Oracle Accelerate : Packaged CX Solutions for Growing Companies

    - by Richard Lefebvre
    Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 Oracle Accelerate is Oracle's approach for providing simple to deploy, packaged, enterprise-class software solutions to growing midsize organizations through its network of expert partners. They come with a fixed price, a fixed scope and can be industry- or country-specific. Here is a suggestion of Oracle Accelerate solutions specially tailored for EMEA based customers looking for growing their business with CX technology: Oracle Sales Cloud Birchman Consulting's Oracle Accelerate Solution for Oracle Sales Cloud CSolutor Oracle Accelerate Solution for Oracle Sales Cloud CapricornVentis Oracle Accelerate Solution for Oracle Sales Cloud Oracle Sales Cloud for vertical industries Enigen’s Oracle Accelerate solution for Oracle Fusion CRM for Professional Services BPI's Oracle Accelerate solution for Oracle Sales Cloud for Business Services Companies BPI's Oracle Accelerate Solution for Oracle Sales Cloud for Insurance Companies BPI's Oracle Accelerate solution for Oracle Sales Cloud for Engineering & Construction Companies BPI's Oracle Accelerate Solution for Oracle Sales Cloud for Telecommunications Companies Fellow Consulting's Oracle Accelerate Solution for Oracle Sales Cloud for Consumer Goods industry Fellow Consulting's Oracle Accelerate Solution for Oracle Sales Cloud for Wholesale Distribution Fellow Consulting's Oracle Accelerate Solution for Oracle Sales Cloud for Life Science industry Oracle Service Cloud (RightNow) CapricornVentis Oracle Accelerate Solution for Oracle RightNow Cloud Service for Retail Industry for Ireland CapricornVentis Oracle Accelerate Solution for Oracle RightNow Cloud Service for Retail Industry for the United Kingdom Enigen’s Oracle Accelerate Solution for Oracle RightNow Service Cloud for the United Kingdom DNASTREAM’s RapidLaunch Oracle Accelerate solution for RightNow Oracle Commerce (ATG) ProgiCommerce - an Oracle Accelerate solution for ATG Commerce delivered by PROGIWEB Spindrift Momentum - an Oracle Accelerate Solution for ATG Commerce for Retail Industry e2x RoadRunner - the ATG Oracle Accelerate solution for Manufacturing Industry e2x RoadRunner - the ATG Oracle Accelerate solution for Telecommunications Industry e2x RoadRunner - the ATG Oracle Accelerate solution for Retail Web Commerce

    Read the article

  • ATG Live Webcast March 21 Reminder: Network, WAN, and PC Performance Tuning (Performance Series Part 3 of 3)

    - by BillSawyer
    A quick reminder about tomorrow's webcast:  Andy Tremayne, Senior Architect, Applications Performance, and co-author of Oracle Applications Performance Tuning Handbook from Oracle Press, and Uday Moogala, Senior Principal Engineer, Applications Performance, will discuss network performance for E-Business Suite. Andy and Uday will cover tuning the client and tuning the network. They will share real-life examples of network performance, and show you tools and techniques that you can use to estimate or simulate performance on your own network.The agenda for the Performance Tuning - Part 3 of 3 webcast includes the following topics: Tuning the Client Tuning the Network Date:               Thursday, March 21, 2012Time:              8:00 AM - 9:00 AM Pacific Standard TimePresenters:  Andy Tremayne, Senior Architect, Applications Performance                        Uday Moogala, Senior Principal Engineer, Applications PerformanceWebcast Registration Link (Preregistration is optional but encouraged)To hear the audio feed:   Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              99341To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  591264961If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here.

    Read the article

  • ATG Live Webcast Nov. 29th: Endeca "Evolutionizes" E-Business Suite

    - by Bill Sawyer
    If you have ever wanted any of the following within Oracle E-Business Suite: Complete Data View Advanced Searching Across Organizations and Flexfields Advanced Visualization including Charts, Metrics, and Cross Tabs Guided Navigation Then you might want to attend this webcast to learn more about Oracle Endeca's integration with Oracle E-Business Suite. Oracle Endeca includes an unstructured data correlation and analytics engine, together with catalog search and guided navigation capabilities. This webcasts focuses on the details behind Oracle Endeca's integration with Oracle E-Business Suite. It demonstrates how you can extend the use of Oracle Endeca into other areas of Oracle E-Business Suite. Date:             Thursday, November 29, 2012Time:             8:00 AM - 9:00 AM Pacific Standard TimePresenter:   Osama Elkady, Senior DirectorWebcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:   Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103192To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  595335921If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • ATG Live Webcast Dec. 6th: Minimizing EBS Maintenance Downtimes

    - by Bill Sawyer
    This webcast provides an overview of the plans and decisions you can make, and the actions you can take, that will help you minimize maintenance downtimes for your E-Business Suite instances. It is targeted to system administrators, DBAs, developers, and implementers. This session, led by Elke Phelps, Senior Principal Product Manager, and Santiago Bastidas, Principal Product Manager, will cover best practices, tools, utilities, and tasks to minimize your maintenance downtimes during the four key maintenance phases. Topics will include: Pre-Patching: Reviewing the list of patches and analyzing their impact Patching Trials: Testing the patch prior to actual production deployment Patch Deployment: Applying patching to your system Post Patching Analysis: Validating the patch application Date:                Thursday, December 6, 2012Time:               8:00 AM - 9:00 AM Pacific Standard TimePresenters:   Elke Phelps, Senior Principal Product Manager                         Santiago Bastidas, Principal Product Manager Webcast Registration Link (Preregistration is optional but encouraged) To hear the audio feed:    Domestic Participant Dial-In Number:           877-697-8128    International Participant Dial-In Number:      706-634-9568    Additional International Dial-In Numbers Link:    Dial-In Passcode:                                              103200To see the presentation:    The Direct Access Web Conference details are:    Website URL: https://ouweb.webex.com    Meeting Number:  595757500 If you miss the webcast, or you have missed any webcast, don't worry -- we'll post links to the recording as soon as it's available from Oracle University.  You can monitor this blog for pointers to the replay. And, you can find our archive of our past webcasts and training here. If you have any questions or comments, feel free to email Bill Sawyer (Senior Manager, Applications Technology Curriculum) at BilldotSawyer-AT-Oracle-DOT-com.

    Read the article

  • Upcoming Webcast: ATG Live Webcast April 5: Managing Your Oracle E-Business Suite with Oracle Enterprise Manager

    - by Oracle_EBS
    Please consider attending the following Webcast announced today on Steven Chan's E-Business Blog linked below.  Please visit his blog to learn more and to register. Managing Your Oracle E-Business Suite with Oracle Enterprise Manager   The topics covered in this webcast will be: Manage your EBS system configurations Monitor your EBS environment's performance and uptime Keep multiple EBS environments in sync with their patches and configurations Create patches for your EBS customizations and apply them with Oracle's own patching tools Visit here to learn more and join today!

    Read the article

  • Double Free inside of a destructor upon adding to a vector

    - by Shawn B
    Hey, I am working on a drum machine, and am having problems with vectors. Each Sequence has a list of samples, and the samples are ordered in a vector. However, when a sample is push_back on the vector, the sample's destructor is called, and results in a double free error. Here is the Sample creation code: class XSample { public: Uint8 Repeat; Uint8 PlayCount; Uint16 Beats; Uint16 *Beat; Uint16 BeatsPerMinute; XSample(Uint16 NewBeats,Uint16 NewBPM,Uint8 NewRepeat); ~XSample(); void GenerateSample(); void PlaySample(); }; XSample::XSample(Uint16 NewBeats,Uint16 NewBPM,Uint8 NewRepeat) { Beats = NewBeats; BeatsPerMinute = NewBPM; Repeat = NewRepeat-1; PlayCount = 0; printf("XSample Construction\n"); Beat = new Uint16[Beats]; } XSample::~XSample() { printf("XSample Destruction\n"); delete [] Beat; } And the 'Dynamo' code that creates each sample in the vector: class XDynamo { public: std::vector<XSample> Samples; void CreateSample(Uint16 NewBeats,Uint16 NewBPM,Uint8 NewRepeat); }; void XDynamo::CreateSample(Uint16 NewBeats,Uint16 NewBPM,Uint8 NewRepeat) { Samples.push_back(XSample(NewBeats,NewBPM,NewRepeat)); } Here is main(): int main() { XDynamo Dynamo; Dynamo.CreateSample(4,120,2); Dynamo.CreateSample(8,240,1); return 0; } And this is what happens when the program is run: Starting program: /home/shawn/dynamo2/dynamo [Thread debugging using libthread_db enabled] XSample Construction XSample Destruction XSample Construction XSample Destruction *** glibc detected *** /home/shawn/dynamo2/dynamo: double free or corruption (fasttop): 0x0804d008 *** However, when the delete [] is removed from the destructor, the program runs perfectly. What is causing this? Any help is greatly appreciated.

    Read the article

  • Webcast Replay Available: Performance Tuning E-Business Suite Concurrent Manager (Performance Series Part 2 of 3)

    - by BillSawyer
    I am pleased to release the replay and presentation for the latest ATG Live Webcast: Performance Tuning E-Business Suite Concurrent Manager (Performance Series Part 2 of 3) (Presentation)Andy Tremayne, Senior Architect, Applications Performance, and co-author of Oracle Applications Performance Tuning Handbook from Oracle Press, and Uday Moogala, Senior Principal Engineer, Applications Performance discussed two major components of E-Business Suite performance tuning:  concurrent management and tracing. They dispel some myths surrounding these topics, and shared with you the recommended best practices that you can use on your own E-Business Suite instance.Finding other recorded ATG webcastsThe catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • Summary of Oracle E-Business Suite Technology Webcasts and Training

    - by BillSawyer
    Last Updated: November 16, 2011We're glad to hear that you've been finding our ATG Live Webcast series to be useful.  If you missed a webcast, you can download the presentation materials and listen to the recordings below. We're collecting other learning-related materials right now.  We'll update this summary with pointers to new training resources on an ongoing basis.  ATG Live Webcast Replays All of the ATG Live Webcasts are hosted by the Oracle University Knowledge Center.  In order to access the replays, you will need a free Oracle.com account. You can register for an Oracle.com account here.If you are a first-time OUKC user, you will have to accept the Terms of Use. Sign-in with your Oracle.com account, or if you don't already have one, use the link provided on the sign-in screen to create an account. After signing in, accept the Terms of Use. Upon completion of these steps, you will be directed to the replay. You only need to accept the Terms of Use once. Your acceptance will be noted on your account for all future OUKC replays and event registrations. 1. E-Business Suite R12 Oracle Application Framework (OAF) Rich User Interface Enhancements (Presentation) Prabodh Ambale (Senior Manager, ATG Development) and Gustavo Jiminez (Development Manager, ATG Development) offer a comprehensive review of the latest user interface enhancements and updates to OA Framework in EBS 12.  The webcast provides a detailed look at new features designed to enhance usability, including new capabilities for personalization and extensions, and features that support the use of dashboards and web services. (January 2011) 2. E-Business Suite R12 Service Oriented Architectures (SOA) Using the E-Business Suite Adapter (Presentation, Viewlet) Neeraj Chauhan (Product Manager, ATG Development) reviews the Service Oriented Architecture (SOA) capabilities within E-Business Suite 12, focussing on using the E-Business Suite Adapter to integrate EBS with third-party applications via web services, and orchestrate services and distributed transactions across disparate applications. (February 2011) 3. Deploying Oracle VM Templates for Oracle E-Business Suite and Oracle PeopleSoft Enterprise Applications Ivo Dujmovic (Director, ATG Development) reviews the latest capabilities for using Oracle VM to deploy virtualized EBS database and application tier instances using prebuilt EBS templates, wire those virtualized instances together using the EBS virtualization kit, and take advantage of live migration of user sessions between failing application tier nodes.  (February 2011) 4. How to Reduce Total Cost of Ownership (TCO) Using Oracle E-Business Suite Management Packs (Presentation) Angelo Rosado (Product Manager, ATG Development) provides an overview of how EBS sysadmins can make their lives easier with the Management Packs for Oracle E-Business Suite Release 12.  This session highlights key features in Application Management Pack (AMP) and Application Change Management Pack) that can automate or streamline system configurations, monitor EBS performance and uptime, keep multiple EBS environments in sync with patches and configurations, and create patches for your own EBS customizations and apply them with Oracle's own patching tools.  (June 2011) 5. Upgrading E-Business Suite 11i Customizations to R12 (Presentation) Sara Woodhull (Principal Product Manager, ATG Development) provides an overview of how E-Business Suite developers can manage and upgrade existing EBS 11i customizations to R12.  Sara covers methods for comparing customizations between Release 11i and 12, managing common customization types, managing deprecated technologies, and more. (July 2011) 6. Tuning All Layers of E-Business Suite (Part 1 of 3) (Presentation) Lester Gutierrez, Senior Architect, and Deepak Bhatnagar, Senior Manager, from the E-Business Suite Application Performance team, lead Tuning All Layers of E-Business Suite (Part 1 of 3). This webcast provides an overview of how Oracle E-Business Suite system administrators, DBAs, developers, and implementers can improve E-Business Suite performance by following a performance tuning framework. Part 1 focuses on the performance triage approach, tuning applications modules, upgrade performance best practices, and tuning the database tier. This ATG Live Webcast is an expansion of the performance sessions at conferences that are perennial favourites with hardcore Apps DBAs. (August 2011)  7. Oracle E-Business Suite Directions: Deployment and System Administration (Presentation) Max Arderius, Manager Applications Technology Group, and Ivo Dujmovic, Director Applications Technology group, lead Oracle E-Business Suite Directions: Deployment and System Administration covering important changes in E-Business Suite R12.2. The changes discussed in this presentation include Oracle E-Business Suite architecture, installation, upgrade, WebLogic Server integration, online patching, and cloning. This webcast provides an overview of how Oracle E-Business Suite system administrators, DBAs, developers, and implementers can prepare themselves for these changes in R12.2 of Oracle E-Business Suite. (October 2011) Oracle University Courses For a general listing of all Oracle University courses related to E-Business Suite Technology, use the Oracle University E-Business Suite Technology course catalog link. Oracle University E-Business Suite Technology Course Catalog 1. R12 Oracle Applications System Administrator Fundamentals In this course students learn concepts and functions that are critical to the System Administrator role in implementing and managing the Oracle E-Business Suite. Topics covered include configuring security and user management, configuring flexfields, managing concurrent processing, and setting up other essential features such as profile options and printing. In addition, configuration and maintenance of an Oracle E-Business Suite through Oracle Applications Manager is discussed. Students also learn the fundamentals of Oracle Workflow including its setup. The System Administrator Fundamentals course provides the foundation needed to effectively control security and ensure smooth operations for an E-Business Suite installation. Demonstrations and hands-on practice reinforce the fundamental concepts of configuring an Oracle E-Business Suite, as well as handling day-to-day system administrator tasks. 2. R12.x Install/Patch/Maintain Oracle E-Business Suite This course will be applicable for customers who have implemented Oracle E-Business Suite Release 12 or Oracle E-Business Suite 12.1. This course explains how to go about installing and maintaining an Oracle E-Business Suite Release 12.x system. Both Standard and Express installation types are covered in detail. Maintenance topics include a detailed examination of the standard tools and utilities, and an in-depth look at patching an Oracle E-Business Suite system. After this course, students will be able to make informed decisions about how to install an Oracle E-Business Suite system that meets their specific requirements, and how to maintain the system afterwards. The extensive hands-on practices include performing an installation on a Linux system, navigating the file system to locate key files, running the standard maintenance tools and utilities, applying patches, and carrying out cloning operations. 3. R12.x Extend Oracle Applications: Building OA Framework Applications This class is a hands-on lab-intensive course that will keep the student busy and active for the duration of the course. While the course covers the fundamentals that support OA Framework-based applications, the course is really an exercise in J2EE programming. Over the duration of the course, the student will create an OA Framework-based application that selects, inserts, updates, and deletes data from a R12 Oracle Applications instance. 4. R12.x Extend Oracle Applications: Customizing OA Framework Applications This course has been significantly changed from the prior version to include additional deployments. The course doesn't teach the specifics of configuration of each product. That is left to the product-specific courses. What the course does cover is the general methods of building, personalizing, and extending OA Framework-based pages within the E-Business Suite. Additionally, the course covers the methods to deploy those types of customizations. The course doesn't include discussion of the Oracle Forms-based pages within the E-Business Suite. 5. R12.x Extend Oracle Applications: OA Framework Personalizations Personalization is the ability within an E-Business Suite instance to make changes to the look and behavior of OA Framework-based pages without programming. And, personalizations are likely to survive patches and upgrades, increasing their utility. This course will systematically walk you through the myriad of personalization options, starting with simple examples and increasing in complexity from there. 6. E-Business Suite: BI Publisher 5.6.3 for Developers Starting with the basic concepts, architecture, and underlying standards of Oracle XML Publisher, this course will lead a student through a progress of exercises building their expertise. By the end of the course, the student should be able to create Oracle XML Publisher RTF templates and data templates. They should also be able to deploy and maintain a BI Publisher report in an E-Business Suite instance. Students will also be introduced to Oracle BI Publisher Enterprise. 7. R12.x Implement Oracle Workflow This course provides an overview of the architecture and features of Oracle Workflow and the benefits of using Oracle Workflow in an e-business environment. You can learn how to design workflow processes to automate and streamline business processes, and how to define event subscriptions to perform processing triggered by business events. Students also learn how to respond to workflow notifications, how to administer and monitor workflow processes, and what setup steps are required for Oracle Workflow. Demonstrations and hands-on practice reinforce the fundamental concepts. 8. R12.x Oracle E-Business Suite Essentials for Implementers Oracle R12.1 E-Business Essentials for Implementers is a course that provides a functional foundation for any E-Business Suite Fundamentals course.

    Read the article

  • Webcast Replay Available: Technical Preview of EBS 12.2 Online Patching

    - by BillSawyer
    I am pleased to release the replay and presentation for ATG Live Webcast: Technical Preview of EBS 12.2 Online Patching (Presentation) Kevin Hudson, Senior Director and one of the Online Patching architects, discussed one of the cornerstone new features in our upcoming Oracle E-Business Suite 12.2 release. This ground-breaking feature is based upon Edition-Based Redefinition, a new 11gR2 Database feature that was built to Oracle Applications division specifications to allow the E-Business Suite's database tier to be patched while the environment is running.  Online Patching combines the use of Edition-Based Redefinition and new E-Business Suite technologies to allow patching to the E-Business Suite's database and application tier servers while the environment is being actively used by its end-users. (June 2012) Finding other recorded ATG webcastsThe catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • Webcast Replay Available: Scrambling Sensitive Data in E-Business Suite Release 12 Cloned Environments

    - by BillSawyer
    I am pleased to release the replay and presentation for ATG Live Webcast Scrambling Sensitive Data in EBS 12 Cloned Environments (Presentation) Eric Bing, Senior Director, Jagan Athreya, Enterprise Manager Product Management, and Elke Phelps, Senior Principal Product Manager, discussed the Oracle E-Business Suite Template for Data Masking Pack, and how it can be used in situations where confidential or regulated data needs to be shared with other non-production users who need access to some of the original data, but not necessarily every table.  Examples of non-production users include internal application developers or external business partners such as offshore testing companies, suppliers or customers. (July 2012) Finding other recorded ATG webcastsThe catalog of ATG Live Webcast replays, presentations, and all ATG training materials is available in this blog's Webcasts and Training section.

    Read the article

  • Is Berkeley DB a NoSQL solution?

    - by Gregory Burd
    Berkeley DB is a library. To use it to store data you must link the library into your application. You can use most programming languages to access the API, the calls across these APIs generally mimic the Berkeley DB C-API which makes perfect sense because Berkeley DB is written in C. The inspiration for Berkeley DB was the DBM library, a part of the earliest versions of UNIX written by AT&T's Ken Thompson in 1979. DBM was a simple key/value hashtable-based storage library. In the early 1990s as BSD UNIX was transitioning from version 4.3 to 4.4 and retrofitting commercial code owned by AT&T with unencumbered code, it was the future founders of Sleepycat Software who wrote libdb (aka Berkeley DB) as the replacement for DBM. The problem it addressed was fast, reliable local key/value storage. At that time databases almost always lived on a single node, even the most sophisticated databases only had simple fail-over two node solutions. If you had a lot of data to store you would choose between the few commercial RDBMS solutions or to write your own custom solution. Berkeley DB took the headache out of the custom approach. These basic market forces inspired other DBM implementations. There was the "New DBM" (ndbm) and the "GNU DBM" (GDBM) and a few others, but the theme was the same. Even today TokyoCabinet calls itself "a modern implementation of DBM" mimicking, and improving on, something first created over thirty years ago. In the mid-1990s, DBM was the name for what you needed if you were looking for fast, reliable local storage. Fast forward to today. What's changed? Systems are connected over fast, very reliable networks. Disks are cheep, fast, and capable of storing huge amounts of data. CPUs continued to follow Moore's Law, processing power that filled a room in 1990 now fits in your pocket. PCs, servers, and other computers proliferated both in business and the personal markets. In addition to the new hardware entire markets, social systems, and new modes of interpersonal communication moved onto the web and started evolving rapidly. These changes cause a massive explosion of data and a need to analyze and understand that data. Taken together this resulted in an entirely different landscape for database storage, new solutions were needed. A number of novel solutions stepped up and eventually a category called NoSQL emerged. The new market forces inspired the CAP theorem and the heated debate of BASE vs. ACID. But in essence this was simply the market looking at what to trade off to meet these new demands. These new database systems shared many qualities in common. There were designed to address massive amounts of data, millions of requests per second, and scale out across multiple systems. The first large-scale and successful solution was Dynamo, Amazon's distributed key/value database. Dynamo essentially took the next logical step and added a twist. Dynamo was to be the database of record, it would be distributed, data would be partitioned across many nodes, and it would tolerate failure by avoiding single points of failure. Amazon did this because they recognized that the majority of the dynamic content they provided to customers visiting their web store front didn't require the services of an RDBMS. The queries were simple, key/value look-ups or simple range queries with only a few queries that required more complex joins. They set about to use relational technology only in places where it was the best solution for the task, places like accounting and order fulfillment, but not in the myriad of other situations. The success of Dynamo, and it's design, inspired the next generation of Non-SQL, distributed database solutions including Cassandra, Riak and Voldemort. The problem their designers set out to solve was, "reliability at massive scale" so the first focal point was distributed database algorithms. Underneath Dynamo there is a local transactional database; either Berkeley DB, Berkeley DB Java Edition, MySQL or an in-memory key/value data structure. Dynamo was an evolution of local key/value storage onto networks. Cassandra, Riak, and Voldemort all faced similar design decisions and one, Voldemort, choose Berkeley DB Java Edition for it's node-local storage. Riak at first was entirely in-memory, but has recently added write-once, append-only log-based on-disk storage similar type of storage as Berkeley DB except that it is based on a hash table which must reside entirely in-memory rather than a btree which can live in-memory or on disk. Berkeley DB evolved too, we added high availability (HA) and a replication manager that makes it easy to setup replica groups. Berkeley DB's replication doesn't partitioned the data, every node keeps an entire copy of the database. For consistency, there is a single node where writes are committed first - a master - then those changes are delivered to the replica nodes as log records. Applications can choose to wait until all nodes are consistent, or fire and forget allowing Berkeley DB to eventually become consistent. Berkeley DB's HA scales-out quite well for read-intensive applications and also effectively eliminates the central point of failure by allowing replica nodes to be elected (using a PAXOS algorithm) to mastership if the master should fail. This implementation covers a wide variety of use cases. MemcacheDB is a server that implements the Memcache network protocol but uses Berkeley DB for storage and HA to replicate the cache state across all the nodes in the cache group. Google Accounts, the user authentication layer for all Google properties, was until recently running Berkeley DB HA. That scaled to a globally distributed system. That said, most NoSQL solutions try to partition (shard) data across nodes in the replication group and some allow writes as well as reads at any node, Berkeley DB HA does not. So, is Berkeley DB a "NoSQL" solution? Not really, but it certainly is a component of many of the existing NoSQL solutions out there. Forgetting all the noise about how NoSQL solutions are complex distributed databases when you boil them down to a single node you still have to store the data to some form of stable local storage. DBMs solved that problem a long time ago. NoSQL has more to do with the layers on top of the DBM; the distributed, sometimes-consistent, partitioned, scale-out storage that manage key/value or document sets and generally have some form of simple HTTP/REST-style network API. Does Berkeley DB do that? Not really. Is Berkeley DB a "NoSQL" solution today? Nope, but it's the most robust solution on which to build such a system. Re-inventing the node-local data storage isn't easy. A lot of people are starting to come to appreciate the sophisticated features found in Berkeley DB, even mimic them in some cases. Could Berkeley DB grow into a NoSQL solution? Absolutely. Our key/value API could be extended over the net using any of a number of existing network protocols such as memcache or HTTP/REST. We could adapt our node-local data partitioning out over replicated nodes. We even have a nice query language and cost-based query optimizer in our BDB XML product that we could reuse were we to build out a document-based NoSQL-style product. XML and JSON are not so different that we couldn't adapt one to work with the other interchangeably. Without too much effort we could add what's missing, we could jump into this No SQL market withing a single product development cycle. Why isn't Berkeley DB already a NoSQL solution? Why aren't we working on it? Why indeed...

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Choosing the Right JDeveloper Release for Your EBS Environment

    - by Sara Woodhull
    Oracle E-Business Suite developers use a special build of Oracle JDeveloper. This build contains the correct Oracle Application Framework (OA Framework or OAF) libraries corresponding to a specific version of Oracle E-Business Suite (specifically, to an ATG patch level). For customers and developers who are building OA Framework components and extensions to Oracle E-Business Suite, one of the first questions is "How do I find the right version of JDeveloper?"Oracle makes these OA Framework/JDeveloper builds available in separate patches when a new ATG patch level is released.   A handy My Oracle Support Document shows the ATG patch levels and the corresponding patch containing the correct version of JDeveloper with the right versions of OA Framework libraries:How to find the correct version of JDeveloper to use with eBusiness Suite 11i or Release 12.x (Doc ID 416708.1)

    Read the article

  • IOmeter Hanging

    - by Xiuhtecuhtli
    am attempting to setup a test bed with 2 server using IOmeter.exe I have IoMeter & Dynamo running on My Manger server @ 10.0.0.3 i have another machine running only Dynamo @ 10.0.0.4 so. on 10.0.0.4 i run "Dyanmo.exe /i 10.0.0.4 /m 10.0.0.3" at this point the Iometer.exe on 10.0.0.3 Hangs and stops responding. Any Thoughts?

    Read the article

  • Putting our OLTP and OLAP services on the same cluster

    - by Dynamo
    We're currently in a bit of a debate about what to do with our scattered SQL environment. We are setting up a cluster for our data warehouses for sure and are now in the process of deciding if our OLTP databases should go on the same one. The cluster will be active/active with database services running on one node and reporting and analytical services on the other node. From a technical standpoint I don't see an issue here. With the services being run on different nodes they shouldn't compete too heavily for resources. The only physical resource that may be an issue would be the shared disk space. Our environment is also quite small. Our biggest OLAP database at the moment is only about 40GB and our OLTP are all under 10GB. I see a potential political issue here as different groups are involved but I'm just strictly wondering if there would be any major technical issues that could arise from this setup.

    Read the article

  • How can I remove unallocated space from a SQL Server database?

    - by Dynamo
    I have a database that was recently shrunk and when I run sp_spaceused I see that it has 500MB of unallocated space. I'm trying to keep this database to a certain size (do to MSDE size restrictions for my desktop users) and I'm not sure if the unallocated space affects the overall database size. Is there a way to remove this unallocated space from the database?

    Read the article

< Previous Page | 1 2 3 4 5 6  | Next Page >