Search Results

Search found 600 results on 24 pages for 'splitting'.

Page 6/24 | < Previous Page | 2 3 4 5 6 7 8 9 10 11 12 13  | Next Page >

• Merging and splitting overlapping rectangles to produce non-overlapping ones

  - by uj

  I am looking for an algorithm as follows: Given a set of possibly overlapping rectangles (All of which are "not rotated", can be uniformly represented as (left,top,right,bottom) tuplets, etc...), it returns a minimal set of (non-rotated) non-overlapping rectangles, that occupy the same area. It seems simple enough at first glance, but prooves to be tricky (at least to be done efficiently). Are there some known methods for this/ideas/pointers? Methods for not necessarily minimal, but heuristicly small, sets, are interesting as well, so are methods that produce any valid output set at all.

  Read the article

• Splitting a list based on another list values in Mathematica

  - by Max

  In Mathematica I have a list of point coordinates size = 50; points = Table[{RandomInteger[{0, size}], RandomInteger[{0, size}]}, {i, 1, n}]; and a list of cluster indices these points belong to clusterIndices = {1, 1, 1, 1, 1, 1, 1, 2, 2, 1, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1}; what is the easiest way to split the points into two separate lists based on the clusterIndices values?

  Read the article

• Splitting string into array upon token

  - by Gnutt

  I'm writing a script to perform an offsite rsync backup, and whenever the rsyncline recieves some output it goes into a single variable. I then want to split that variable into an array upon the ^M token, so that I can send them to two different logger-sessions (so I get them on seperate lines in the log). My current line to perform the rsync result=rsync --del -az -e "ssh -i $cert" $source $destination 2>&1 Result in the log, when the server is unavailable ssh: connect to host offsite port 22: Connection timed out^M rsync: connection unexpectedly closed (0 bytes received so far) [sender] rsync error: unexplained error (code 255) at io.c(601) [sender=3.0.7]

  Read the article

• Splitting html string after so many words

  - by jimbo

  Hi all, I have a string that if it is longer than lets say 10 words, I want to split it into two parts. The second part will be included else-where after a 'more' link. The string will hold html tags too though. For an example the string could be: <p>This is just a test string with more words than the <strong>amount allow</strong> before split, blah blah blah</p> So in the case I would want: $string[0] // <p>This is just a test string with more words than</p>; $string[1] // <p>the <strong>amount allow</strong> before split, blah blah blah</p>; Thanks in advance

  Read the article

• Splitting list into a list of possible tuples

  - by user1742646

  I need to split a list into a list of all possible tuples, but I'm unsure of how to do so. For example pairs ["cat","dog","mouse"] should result in [("cat","dog"), ("cat","mouse"), ("dog","cat"), ("dog","mouse"), ("mouse","cat"), ("mouse","dog")] I was able to form the first two, but am unsure of how to get the rest. Here's what I have so far: pairs :: [a] -> [(a,a)] pairs (x:xs) = [(m,n) | m <- [x], n <- xs]

  Read the article

• Splitting up input using regular expressions in Java

  - by Joe24

  I am making a program that lets a user input a chemical for example C9H11N02. When they enter that I want to split it up into pieces so I can have it like C9, H11, N, 02. When I have it like this I want to make changes to it so I can make it C10H12N203 and then put it back together. This is what I have done so far. using the regular expression I have used I can extract the integer value, but how would I go about get C10, H11 etc..? System.out.println("Enter Data"); Scanner k = new Scanner( System.in ); String input = k.nextLine(); String reg = "\\s\\s\\s"; String [] data; data = input.split( reg ); int m = Integer.parseInt( data[0] ); int n = Integer.parseInt( data[1] );

  Read the article

• Splitting a double in two, C#

  - by Stacey

  I'm attempting to use a double to represent a bit of a dual-value type in a database that must sometimes accept two values, and sometimes accept only one (int). So the field is a float in the database, and in my C# code, it is a double (since mapping it via EF makes it a double for some reason... ) So basically what I want to do .. let's say 2.5 is the value. I want to separate that out into 2, and 5. Is there any implicit way to go about this?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Splitting values into groups evenly

  - by Paul Knopf

  Let me try to explain the situation the best I can. Lets say I have 3 values 1, 2, 3 I tell an algorithm to split this values into x columns. Lets say x = 2 for clarification. The algorithm determines that the group of values is best put into two columns the following way. 1st column 2nd column --------------------------- 1 3 2 Each column has an even number (totals, not literals) value. Now lets say I have the following values 7, 8, 3, 1, 4 I tell the algorithm that I want the values split into 3 columns. The algorithm now tells me that the following is the best fit. 1st column 2nd column 3rd column 8 7 3 1 4 Notice how the columns arent quiet even, but it is as close as it can get. A little over and a little under is considered ok, as long as the list is AS CLOSE TO EVEN AS IT CAN BE. Anybody got any suggestions? Know any good methods of doing this?

  Read the article

• Splitting a UL into three even lists

  - by Andy

  I am printing a menu using UL, the trouble is the order that is generated by my script is ignored because im printing the LI one after the other and they're spanning three across. So the order is 1 , 2 , 3 as opposed to 1 2 3 To counteract this i wanted to split my single UL into three that way the order would be maintained. Here is my code currently which works perfectly to print a single UL. //Category Drop Down Menu $this->CategoryDropDownMenu = '<ul id="subcatmenu">'; foreach($sitemap->CategoryMenu as $val) $this->CategoryDropDownMenu .= '<li><a href="'.$val[host].$val[link].'"><span>'.htmlspecialchars($val[title]).'</span></a></li>'; $this->CategoryDropDownMenu .= '</ul>';

  Read the article

• hub4com source code

  - by baash05

  Anyone know where to find the source code for hub4com? i've got to read the contents of a com port and spit it out to 4 (or more) virtual com ports, so several apps can get the incomming data.

  Read the article

• Split html text in a SEO friendly manner

  - by al nik

  I've some html text like <h1>GreenWhiteRed</h1> Is it SEO friendly to split this text in something like <h1><span class="green">Green</span><span class="white">White</span><span class="red">Red</span></h1> Is the text still ranking well and is it interpreted as a single word 'GreenWhiteRed'?

  Read the article

• Svn repository split problem

  - by Tuminoid

  I want to split a directory from a large Subversion repository to a repository of its own, and keep the history of the files in that directory. I tried the regular way of doing it first svnadmin dump /path/to/repo > largerepo.dump cat largerepo.dump | svndumpfilter include my/directory >mydir.dump but that does not work, since the directory has been moved and copied over the years and files have been moved into and out of it to other parts of the repository. The result is a lot of these: svndumpfilter: Invalid copy source path '/some/old/path' Next thing I tried is to include those /some/old/path as they appear and after a long, long list of files and directories included, the svndumpfilter completes, BUT importing the resulting dump isn't producing the same files as the current directory has. So, how do I properly split the directory from that repository while keeping the history? EDIT: I specifically want trunk/myproj to be the trunk in a new repository PLUS have the new repository include none of the other old stuff, ie. there should not be possibility for anyone to update to old revision before the split and get/see the files. The svndumpfilter solution I tried would achieve exactly that, sadly its not doable since the path/files have been moved around. The solution by ng isn't accetable since its basically a clone+removal of extras which keeps ALL the history, not just relevant myproj history. BUMP C'moon, there must be someone who definitely knows if this is doable or not, and how!

  Read the article

• Git: Stage into Commit, what is the right workflow?

  - by Lukasz Lew

  I just created a big piece of code I want to commit in several separate commits. So I can stage relevant parts, commit, stage, commit, ... and so on until I have all my changes commited. The missing part is how can I test whether I split the commit correcty. I.e. whether the part that is in staging area at least compiles? To do that I must somehow bring my work tree to be in sync with index (staging area) without losing the changes to be committed later. What is the right way to do it? What is the quickest way to do it? Update: How to do it with magit?

  Read the article

• Split string var

  - by lidermin

  Hi, I have a question: Let's say I have this string var: string strData = "1|2|3|4||a|b|c|d" Then, I make a Split: strNumbers[] = strData.Split("||"); //something like this, I know It's not this simple I need two separate parts, each one containing this: //strNumbers -> {"1","2","3","4"},{"a","b","c","d"} So that after that, I could do this: string[] strNumArray[] = strNumbers[0].Split('|'); //strNumArray -> '1', '2', '3', '4' And same with the other part (letters). Is it possible? to make this double split with the same character, but the first time the character is repeated twice?. Thanks. PD. I'm using C#.

  Read the article

• How to split this array into three's and place it in <td> using php?

  - by udaya

  Hi I have an php array of ten numbers $arr = array("first" => "1", "second" =>"2", "Third" =>"3", "Fourth" =>"4", "fifth" =>"5",, "sixth" =>"6", "seventh" =>"7", "eighth" =>"8", "ninth" =>"9","tenth"="10"); I have to place these values in a <td> by spliting the array in numbers of three such that my td contains first td contains <td>the first three values of an aray</td> second td contains <td>the next three values of an aray</td> third td contains <td>the next three values of an aray</td> if the remaining values in less than three in number it must be in the another td say now i have tenth value so my last td must contain tenth value

  Read the article

• What is the kd tree intersection logic?

  - by bobobobo

  I'm trying to figure out how to implement a KD tree. On page 322 of "Real time collision detection" by Ericson The text section is included below in case Google book preview doesn't let you see it the time you click the link text section Relevant section: The basic idea behind intersecting a ray or directed line segment with a k-d tree is straightforward. The line is intersected against the node's splitting plane, and the t value of intersection is computed. If t is within the interval of the line, 0 <= t <= tmax, the line straddles the plane and both children of the tree are recursively descended. If not, only the side containing the segment origin is recursively visited. So here's what I have: (open image in new tab if you can't see the lettering) The logical tree Here the orange ray is going thru the 3d scene. The x's represent intersection with a plane. From the LEFT, the ray hits: The front face of the scene's enclosing cube, The (1) splitting plane The (2.2) splitting plane The right side of the scene's enclosing cube But here's what would happen, naively following Ericson's basic description above: Test against splitting plane (1). Ray hits splitting plane (1), so left and right children of splitting plane (1) are included in next test. Test against splitting plane (2.1). Ray actually hits that plane, (way off to the right) so both children are included in next level of tests. (This is counter-intuitive - shouldn't only the bottom node be included in subsequent tests) Can some one describe what happens when the orange ray goes through the scene correctly?

  Read the article

• Splitting a tetris game apart - where to put time-management?

  - by nightcracker

  I am creating a tetris game in C++ & SDL, and I'm trying to do it "good" by making it object-oriented and keeping scopes small. So far I have the following structure: A main with some lowlevel SDL set up and handling input A game class that keeps track of score and provides the interface for main (move block down, etc) A map class that keeps track of the current game field, which blocks are where. Used by the game class. A block class that consists of the current falling block, used by game. A renderer class abstracting low level SDL to a format where you render "tetris blocks". Used by map and block. Now I have a though time where to place the time-management of this game. For example, where should be decided when a block bumps the bottom of the screen how long it takes the current block locks in place and a new block spawns? I also have an other unrelated question, is there some place where you can find some standard data on tetris like standard score tables, rulesets, timings, etc?

  Read the article

• Splitting a tetris game apart - where to put time-management?

  - by nightcracker

  I am creating a tetris game in C++ & SDL, and I'm trying to do it "good" by making it object-oriented and keeping scopes small. So far I have the following structure: A main with some lowlevel SDL set up and handling input A game class that keeps track of score and provides the interface for main (move block down, etc) A map class that keeps track of the current game field, which blocks are where. Used by the game class. A block class that consists of the current falling block, used by game. A renderer class abstracting low level SDL to a format where you render "tetris blocks". Used by map and block. Now I have a though time where to place the time-management of this game. For example, where should be decided when a block bumps the bottom of the screen how long it takes the current block locks in place and a new block spawns? I also have an other unrelated question, is there some place where you can find some standard data on tetris like standard score tables, rulesets, timings, etc?

  Read the article

• What options are there for splitting UI layout from code logic using a markup language?

  - by Daenyth

  What tools similar to GWT's UIBinder exist in other languages? By this I mean a system where you can define your UI layout in a markup language (preferably html+css) and attach the functionality to the layout using the code. I'm most interested in anything for python, but answers in other languages would interest me as well. I'm interested because the benefits of having a non-programmer work directly on the layout without needing to touch the code and adjust a bunch of UI toolkit method calls is very productive. I'm aware of Flex for flash, but is there anything else out there? What search terms might I use to find such frameworks? I've looked around but I haven't found anything concrete.

  Read the article

• Why does just splitting an Ethernet cable not work?

  - by Sin Jeong-hun

  I thought the Ethernet is logically a one-line communication bus (for argument's sake, I am excluding hubs). All machines attached on the bus hears the same signals and the machines themselves try to avoid collisions by randomly backing off. http://computer.howstuffworks.com/ethernet6.htm If so, why would splitting one Ethernet line from my home router into two and connecting two computers not work? Why do I have to add a switch to it? *What the Internet said would not work. [4 port home router] ------[one Ethernet cable]-----[simple splitter]======[two computers] *What the Internet said I should do [4 port home router] ------[one Ethernet cable]-----[switch]======[two computers] Is this because of the signal degradation (reduced electric current)? Thank you for all the answers! The reason why I did not just use the two ports of my home router is... The 4-port gigabit router is in my room, and I had put a computer in another room (also my room, though). Since a wired network is far more reliable and secure, I had bought a long Ethernet cable and and connected the computer to the router. Now I was thinking about adding another computer to that room. I could buy another long Ethernet cable, but then there will be two cables between the rooms. The one line already is a minor annoyance, so I thought if I could share the one line between the two computers in that room. A switch would work, but it requires power and is a little bit pricey. That is why I wondered why it would not work to simply split the physical Ethernet cable. Apparently I do not completely understand how Ethernet and a switch work. I just have some bit of knowledge I heard in my college class.

  Read the article

• Why just splitting an Ethernet cable does not work?

  - by Sin Jeong-hun

  I thought the Ethernet is logically one-line communication bus (for argument's sake, I am excluding hubs). All machines attached in the bus hears the same signals and the machines themselves try to avoid collisions by randomly backing off. http://computer.howstuffworks.com/ethernet6.htm If so, why splitting one Ethernet line from my home router into two and connecting two computers would not work? Why do I have to add a switch to it? *What the Internet said would not work. [4 port home router] ------[one Ethernet cable]-----[simple splitter]======[two computers] *What the Internet said I should do [4 port home router] ------[one Ethernet cable]-----[switch]======[two computers] Is this because of the signal degradation (reduced electric current)? Thank you for all the answers! The reason why I did not just use the two ports of my home router is... The 4-port gigabit router is in my room and I had put a computer in another room (also my room, though). Since wired network is far more reliable and secure, I had bought a long Ethernet cable and and connected the computer to the router. Now I was thinking about adding another computer to that room. I could buy another long Ethernet cable, but then there will be two cables between the rooms. The one line already is a minor annoyance, so I thought if I could share the one line between the two computers in that room. A switch would work, but it requires power and is a little bit pricey. That is why I wondered why it would not work to simply split the physical Ethernet cable. Apparently I do not completely understand how Ethernet and a switch work. I just have some bit of knowledge I heard in my college class.

  Read the article

• Is Splitting IDE hdds between Primary and Secondary faster?

  - by earlz

  Hello, I'm doing RAID 0 on two IDE harddrives (yes, this is old hardware). Will the harddrives be faster if I attach them separately so that one is on the Primary IDE controller and the other is on the Secondary IDE controller? Or would it just be as good as having them both on the Primary IDE as master and slave?

  Read the article

• Suggestions for splitting server roles amongst Hyper-V virtual servers / RAID6 or RAID10? / AppAssure

  - by Anon

  We have 2 Hyper-V hosts at present running 1 virtual server that was converted from a physical box running all roles. My plan is to split the roles over various virtual machines, upgrading to the latest software versions as I go, and use the backup server as a standby in case the main server fails. AppAssure backup software has a feature called Virtual Standby, so the VHD's can be ready to be fired up on the backup server if necessary. Off-site backups will be done via external USB drive for now. I'm just seeking some input/suggestions into how I'm planning to split the roles out amongst various virtual servers. Also, I'm curious how to setup the storage on the servers. We do not have any NAS's, SAN'S or any budget for this. What would the best RAID level be to use? I'm thinking either RAID6 (which is currently used) however I'm concerned about the write speeds, or RAID10 but again I'm worried that I can only lose 1 drive (from the same mirror) as opposed to any 2 with RAID6. I realise I have a hot swap for this, but what if a further drive fails during a rebuild? Is the write penalty of RAID6 worth the extra reliability over RAID10? Or will it be too slow with all the roles I am planning, therefore RAID10 is my only real option? The reason for the needed redundancy is I am the only technician and I'm not always on-site. Options I've considered: 1) 5 drives in RAID6 set, 200gb for host OS, rest for VM storage. 1 drive for hot swap - this is how it is currently setup 2) 4 drives in RAID10 set, 200gb for host OS, rest for VM storage. 2 drives for hot swap 3) 4 drives in RAID10 set for VM storage, 2 drives in RAID1 set for host OS. No drives for hot swap - While this is probably the best option with the amount of drives I have, I don't like the idea of having no hot swap 4) 3 drives in RAID6 set for VM storage, 2 drives in RAID1 set for host OS. 1 drive for hot swap All options give us enough storage capacity for our files, etc. We don't have any budget for extra drives or extra hot swap HD chassis for the servers. We have about 70 clients and about 150 users. MAIN SERVER Intel Xeon 5520 @ 2.27 GHz (2 processors) 16GB RAM 6 x 1TB Seagate Barracuda ES.2 Enterprise SATA drives Intel SRCSATAWB RAID controller Virtual machine workload using Hyper-V on Windows Server 2008 R2: DC01 - Active Directory Domain Controller / DNS server / Global catalog - 1GB RAM DC02 - Active Directory Domain Controller / DNS server / Global catalog - 1GB RAM Member Server - DHCP server, File server, Print server - 1GB RAM SCCM Member Server - 4GB RAM Third Party Software Member Server - A/V server, Ticketing software, etc - 4GB RAM Exchange 2007 - 4GB RAM - however we are probably migrating to a hosted solution, therefore freeing up resources BACKUP SERVER Intel Xeon E5410 @ 2.33GHz (2 processors) 16GB RAM 6 x 2TB WD RE4 SATA drives Intel SRCSASRB RAID controller Virtual machine workload using Hyper-V on Windows Server 2008 R2: AppAssure backup software - 8GB RAM

  Read the article

• Splitting a MySQL DB in two may ease server from "Too many connetions"? I don't think so

  - by Petruza

  I was requested to split a MySQL in two, it's kind of a horizontal partition, in which some rows correspond to one site, and some other correspond to another site. But they want to split it in two DBs in the same MySQL server. I'm no DB expert but I guess keeping them in the same MySQL server with the same amount of memory and processor and the same platform won't improve things. What we're trying to avoid is the "Too many connections" problem.

  Read the article

< Previous Page | 2 3 4 5 6 7 8 9 10 11 12 13  | Next Page >